- Email: [email protected]
Pig whey acidic protein gene is surrounded by two ubiquitously expressed genes
Biochimica et Biophysica Acta 1627 (2003) 7 – 14 www.bba-direct.com
Pig whey acidic protein gene is surrounded by two ubiquitously expressed genes Sylvie Rival-Gervier *, Dominique The´pot, Genevie`ve Jolivet, Louis-Marie Houdebine Laboratoire de biologie du de´veloppement et reproduction, Institut National de la Recherche Agronomique, INRA, 78350 Jouy-en-Josas, France Received 5 November 2002; received in revised form 3 March 2003; accepted 19 March 2003
Abstract A 140-kb pig DNA fragment containing the whey acidic protein (WAP) gene cloned in a bacterial artificial chromosome (BAC344H5) has been shown to contain all of the cis-elements necessary for position-independent, copy-dependent and tissue-specific expression in transgenic mice. The insert from this BAC was sequenced. This revealed the presence of two other genes with quite different expression patterns in pig tissues and in transfected HC11 mouse mammary cells. The RAMP3 gene is located 15 kb upstream of the WAP gene in reverse orientation. The CPR2 gene is located 5 kb downstream of the WAP gene in the same orientation. The same locus organization was found in the human genome. The region between RAMP3 and CPR2 in the human genome contains a WAP gene-like sequence with several points of mutation which may account for the absence of WAP from human milk. D 2003 Elsevier Science B.V. All rights reserved. Keywords: WAP; CPR2; RAMP3; Mammary gland; Bacterial artificial chromosome
Whey acidic protein (WAP) is the major protein found in the milk of rodents [1,2], rabbits [3,4] and camels [5]. It has also been identified in the milk of pigs [6] and of three marsupial species [7– 9]. The WAP gene is expressed at high levels and specifically in the mammary gland. Its expression is controlled by lactogenic hormones and the extracellular matrix. In mice and rabbits, the level of WAP mRNA increases several thousand fold between the virgin state and mid-lactation [10 –12]. It has been demonstrated that the pig WAP gene is regulated in the same way as the WAP gene of other species [6,13]. We have recently demonstrated that transgenic mice harboring a randomly integrated 140-kb pig genomic DNA fragment expressed the included porcine WAP gene in a copy number-dependent manner and at high levels, specifically in the mammary gland of lactating animals [14]. This finding led us to conclude that the pig genomic DNA region studied contained all the regulatory elements controlling WAP gene expression. A growing body of evidence indicates that genes included in long genomic DNA fragments are expressed
* Corresponding author. Tel.: +33-1-34-65-25-47; fax: +33-1-34-6522-41. E-mail address: [email protected] (S. Rival-Gervier).
in a reliable manner in transgenic animals [15]. This has led some authors to define the concept of insulators [16]. Insulators are relatively large regions which most likely contain numerous regulatory elements with different and complementary functions. One of the systems studied in most detail is the h-globin locus which is bordered by locus control regions (LCRs), insulating the globin genes of the locus and allowing their specific and high expression. The 5VLCR of the chicken h-globin locus has been shown to contain an insulator defined by its capacity to block the action of globin gene enhancers [17]. This element and others also insulate the h-globin locus from neighboring genes, namely the olfactive receptor genes [18]. In the case of the WAP gene, the chromosomal location has been determined in several species [13,19,20]. However, it is not known whether the WAP gene is surrounded or not by genes preferentially expressed in the mammary gland. We carried out the present experiments to tentatively identify in the 140-kb pig BAC (BAC344H5) other genes surrounding the pig WAP gene and to point out regions which may play a determinant role in the regulation of WAP gene expression, as is the case for the hglobin gene locus. For this purpose, we recently performed the partial sequencing of BAC344H5, which has been described
0167-4781/03/$ - see front matter D 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0167-4781(03)00051-4
8
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
elsewhere [13]. This sequence was used in a BLASTN search of the National Center for Biotechnology Information (NCBI) database. The WAP gene sequence was easily identified. Moreover, a high percentage of identity with the human cycle progression protein 2 (CPR2) gene (Genbank accession number 18565717) was also found in several discrete sequences in the 3Vflanking region of the porcine WAP gene. The finding that each region of homology corresponded to some individual human CPR2 exons suggested that we had identified the porcine orthologue of this gene (Genbank accession number AY231133 to AY231143). Specific analysis of this region by FASTA highlighted the first eight exons of the CPR2 gene (exon1, 72% identity over 68 bp; exon2, 76% identity over 467 bp; exon3, 80% identity over 317 bp; exon4, 81% identity over 111 bp; exon5, 87% identity over 145 bp; exon6, 84% identity over 246 bp; exon7, 78% identity over 112 bp; exon8, 85% identity over 115 bp). The closest sequence with homology to human CPR2 was located solely 5 kb downstream of the polyadenylation signal of the WAP gene and corresponds to the first exon. The coding regions of the WAP and CPR2 genes are both in the same DNA strand (Fig. 1). No sequence from BAC344H5 showed any homology with exon9 of human
CPR2. We cloned the 3Vend of pig CPR2 mRNA using 3V RACE performed with the 5V/3V RACE kit (Roche Diagnostics). Complementary DNAs were synthesized using oligo(dT) and AMV reverse transcriptase from mRNA extracted from the lung of a pig. The specific 3Vends of CPR2 cDNA were amplified by PCR using the CPR2exon2b primer (5VCCAGCCGAGACTCACCCGGGGA 3V) associated with the PCR anchor primer. The PCR products were cloned in the pGEM-T easy vector (Promega). Both strands of the clone were sequenced by the dideoxymethod with fluorescent primers. Sequencing of this fragment showed a ninth exon which presents 76% identity over 234 bp with the human CPR2 exon9. The presence of this exon in BAC344H5 and BAC905F9 was determined using specific PCR with CPR2-exon9-5V(5VGTACTACGAGTG GCTGGAACTC 3V) and CPR2-exon9-3V (5V GCCACCACCCCACTTCCAAC 3V) primers. It was found in BAC905F9 but not in BAC344H5. Human CPR2 is one of 13 cell proliferation regulators identified so far [21]. The CPR genes control a variety of biochemical functions involved in cell proliferation. The CPR2 gene encodes a leucine-rich protein containing multiple putative leucine zipper domains characteristic of transcription factors. It has been suggested that this
Fig. 1. WAP gene locus organization. n indicates the location of the four exons of the porcine WAP gene. 5 indicates the location of the entire porcine WAP gene. A: AscI; X: XhoI; E: EcoRI; N: NotI. Position and orientation of RAMP3, WAP and CPR2 genes are represented by arrows. The pWAPpXhoI encompasses the WAP gene surrounded by 1 and 2.4 kb upstream and downstream of the transcribed region, respectively. The BAC905F9 contains 70 kb upstream and 50 kb downstream of the WAP gene. The BAC344H5 encompasses 130 kb upstream of the cap site of the WAP gene.
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
protein may act at the level of the transcription of cyclin genes (CLN1 and CLN2) or the stability of their transcripts. The human CPR2 gene is widely expressed in the placenta, in the infant brain, muscle, heart, spleen, skin epidermis, white blood cells, in fetal heart, brain, liver, spleen, in 12-week-old brain and retina and in tumoral tissues derived from ovary, trachea and skin. We then studied the expression pattern of endogenous CPR2 and WAP genes in a range of porcine tissues (lung, liver, kidney, spleen, heart, stomach and mammary gland of lactating animals) by RT-PCR analyses. The results are shown in Fig. 2. WAP mRNA was only detected in the mammary gland of a 9-day lactating pig. Furthermore, all the tissues tested were positive for CPR2 mRNAs. The concentration of CPR2 mRNA appeared to be quite similar in all tissues. Human CPR2 gene was initially located at 7p11 –p13. The closest gene identified on the 5V side of the human CPR2 gene was the receptor (calcitonin)-activity modifying protein 3 (RAMP3) gene (NCBI human database). We then looked for this gene in our sequence using FASTA analysis. Sequences with homologies to human exons (Genbank, accession number AJ001016) were easily identified (exon1, Genbank, accession number AY236153, 81% identity over 61 bp; exon2, Genbank, accession
9
number AY236154, 78% identity over 133 bp; exon3, Genbank, accession number AY236155, 82% identity over 265 bp). Porcine RAMP3 exon1 was located 16,600 bp upstream of the WAP gene. WAP and RAMP3 genes were situated in the opposite direction (Fig. 1). Human RAMP3 is a member of the RAMP family which is required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. In the presence of RAMP3, CRLR acts as an adrenomedullin receptor. The human RAMP3 gene is expressed in a wide range of human tissues (heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas) [22]. We then studied the expression pattern of endogenous RAMP3 gene by RT-PCR analyses. The results are shown in Fig. 2. Likewise, we observed its constitutive expression in a range of porcine tissues (lung, liver, kidney, spleen, heart, stomach and mammary gland of lactating animals). However, this expression was more or less intense, depending on the tissues tested. Mammary gland appeared to express the RAMP3 gene at the lowest level. WAP, RAMP3 and CPR2 gene sequences were in close vicinity, but their expression patterns were very different. The data given above indicate that the WAP gene is specifically expressed in the mammary gland of lactating animals, whereas CPR2 and RAMP3 genes are expressed
Fig. 2. WAP, RAMP3 and CPR2 gene transcription in different tissues of pig. Tissue samples were collected from a non-lactating pig (lung, liver, kidney, spleen, heart, stomach) or from a 9-day lactating pig (mammary gland). Total RNAs were prepared using the SV total RNA isolation system (Promega), according to the manufacturer’s recommendations. The first strand of cDNA was synthesized (in a final volume of 20 Al) with the AMV reverse transcriptase (RT+) according to the manufacturer’s recommendations (first strand cDNA synthesis kit for RT-PCR, Roche Diagnostics Boehringer Mannheim Corp., Indianapolis, USA), using 1 Ag of total RNA and the oligo(dT) primer. The absence of DNA was verified by performing a RT reaction without reverse transcriptase (RT ). PCR was then performed using 1 Al of 20 Al of material obtained after reverse transcription with different sets of primer corresponding to each gene. To detect CPR2 mRNA, CPR2-5V(5VGCGATGCACGTGCCTCCTGAGAGA 3V) in exon2 and CPR2-3V(5VGCCAGGAAGGCCAGGTGCTTGTAC3V) in exon3 were used. For RAMP3 mRNA, RAMP3-exon1-3V(5VTGGCTAGCCATGGAGGCGACAGC3V) in exon1 and RAMP3-exon3c (5VAG GGTCAGCAGGATGGGCACCA 3V) in exon3 were used. The WAP mRNA was detected using the WAP primer set described previously [13]. To normalize RT-PCR amplification, the endogenous pig actin cDNA was amplified from the same RT products, as previously described [27].
10
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
relatively ubiquitously. It appeared interesting to determine whether a BAC containing the three entire genes was able to direct the expression of these genes when it was transfected into mammary cells. The HC11 cell line was derived from spontaneously immortalized COMMA1D cells isolated from the mammary gland of a mid-pregnant mouse [23]. In this cell line, endogenous h-casein and WAP gene expressions are regulated by lactogenic hormones (insulin, hydrocortisone and prolactin) and by cell – extracellular matrix interactions. We have already shown that the expression of the WAP gene from BAC905F9 was detectable by RT-PCR in transfected HC11 cells [13]. The BAC905F9 encompasses RAMP3, WAP and CPR2 fulllength genes (Fig. 1). In addition, the pWAPpXhoI plasmid (Fig. 1) contains the WAP gene only. It was therefore necessary to determine whether the RAMP3 and CPR2 genes were also expressed from the BAC905F9 in HC11 cells. Specific CPR2 and RAMP3 PCRs were performed on reverse transcripts, as described previously. Fig. 3 shows that WAP mRNA was detectable in cells transfected with the pWAPpXhoI plasmid or with BAC905F9. No CPR2 and RAMP3 mRNAs were detectable in cells transfected by plasmid pWAPpXhoI. On the other hand, specific
Fig. 3. Porcine WAP, CPR2 and RAMP3 gene expression in mouse epithelial cell line (HC11). HC11 cells were cotransfected with the RSVneo and pWAPpXhoI or BAC905F9. Pools of clones were selected by G418 (150 Ag/ml). The culture of mouse mammary HC11 cells transfected or not by BAC905F9 and pWAPpXoI and the conditions of WAP gene induction have been described in a previous work as well as WAP and GAPDH mRNA detection by RT-PCR [13]. Specific porcine WAP RT-PCR (A), CPR2 RT-PCR (B) and RAMP3 RT-PCR (C) were performed on nontransfected HC11 cell lines (HC11 NT), pWAPpXhoI pool (pWAPpXhoI) and BAC905F9 pool (BAC905F9). Reverse transcription and PCR were performed as described in the legend to Fig. 2. PCR products were electrophoresed on agarose gel and the BET pictures are presented (A, B and C). RAMP3 RT-PCR products were blotted on nylon membrane and hybridized with labeled porcine cDNA RAMP3 exon3 probe (D).
CPR2 and RAMP3 RT-PCR were positive in cells transfected with BAC905F9, which harbors the three genes. However, RAMP3 gene expression was particularly weak because we needed to hybridize the RT-PCR product to visualize unambiguously the amplified sequence. This low expression level in transfected HC11 cells may be due to the fact that some regulatory elements of the RAMP3 gene are missing from the 5Vend of the BAC. More likely, this reflects the natural situation. Indeed, the RAMP3 gene is very weakly expressed in the mammary gland of lactating pig (Fig. 2). In the NCBI database, RAMP3 and CPR2 genes are positioned on human chromosome 7 (7p13 – p12 and 7p14– p13, respectively). Localization of the porcine WAP gene on porcine chromosome 18 has been reported previously [13]. These findings were consistent with other studies which demonstrated, using the FISH technique, that porcine chromosome 18 displayed homologies with human chromosomal segments 7p15.2 – p12 and 7q31.3 – qter7 (http:// www.toulouse.inra.fr/lgc/pig/compare/SSCHTML/SSC18S. HTM). In the mouse genome, according to the MGSC database (http://www.ensembl.org/Mus _musculus/), the three murine genes (CPR2, RAMP3 and WAP) are newly colocalized on chromosome 11, in close proximity and in similar respective positions. Whey acidic protein has not been found in human milk, and its gene has not been described in the human genome. The synteny observed in the RAMP3 – CPR2 region between humans and pigs raised the question as to whether a human WAP gene is present in the RAMP3 – CPR2 intergenic region. FASTA analysis revealed the presence of a sequence highly homologous to other known WAP genes in this region. However, close examination of this homologous sequence showed that some important features (position of ATG and stop codons) of a functional WAP gene are missing (Fig. 4). Despite strong homology at the DNA level, if the human WAP-like sequence is transcribed, it does not encode a WAP protein after translation. However, we do not know whether this mutated gene is transcribed or not. All these facts support the hypothesis that the human homologous sequence of the porcine WAP gene is present between the RAMP3 and CPR2 genes but the existence of a transcript from this WAP-like sequence has not been investigated so far. The most unexpected result of this study is that the WAP gene is surrounded by two genes which are constitutively expressed and located in very close proximity to the WAP gene (16.5 kb upstream and 5 kb downstream). This vicinity in genomes between tissue-specific expressed genes and ubiquitously expressed genes has already been observed. Recently published data indicate that the chicken lysozyme gene is close to a ubiquitously expressed gene, and regulatory elements previously described are located within the newly described neighboring gene [24]. Similarly, the goat a-lactalbumin gene, which is specifically expressed in the mammary gland of lactating animals, is in
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
the vicinity of the cyclin T1 gene expressed in all cell types [25]. These observations are not fully compatible with the LCR concept. Some regulatory elements (insulators, chromatin openers) may locally maintain an active
11
chromatin configuration allowing neighbor genes, related or not, to be efficiently expressed if their own promoters and enhancers are activated by specific transcription factors [26].
12
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
The case of the pig WAP gene and its surrounding genes raises the question as to whether the three genes (RAMP3, WAP and CPR2) belong to one, two or three independent
chromatin domains. This implies that some regions acting as barriers or insulators may or may not be present between the three genes. We showed that the presence of the CPR2 gene
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
13
Fig. 4. Human potential WAP gene sequence. (A) Human sequence homologous to porcine WAP gene. The human RAMP3-CPR2 intergenic region (Genbank AC013416.4, position 34001 – 37000) is highly homologous to other known WAP genes already described. Sequences with upper case letters are homologous to the four exons of pig, rabbit, rat and mouse WAP genes. Sequences homologous to introns and flanking sequences are in lower case letters. The ATA in bold underlined letters is homologous to the translation start codon ATG of other known functional WAP genes. Important features of a functional WAP gene are missing from the human sequence (translation start codon ATG, polyadenylation signal AATAAA, the branch site of putative intron 2,. . .). (B) Alignments of human sequences homologous to other exons WAP sequences with exons of pig (AF320306), rabbit (X52564), rat (NM_042921) and mouse (NW_000035) WAP sequences. The translation start codon ATG and stop codon TGA and the polyadenylation signal AATAAA are indicated in bold in exons 1 and 4, respectively. In the human sequence, the lack of a translation start codon ATG in the exon1 sequence, the point deletion at the end of exon2, conservation of the translation stop codon TGA and the lack of a polyadenylation signal AATAAA in the exon4 sequence should be noted.
was not necessary to obtain perfectly regulated WAP gene expression in transgenic mice, because 5 kb downstream of the WAP gene were sufficient to protect the transgene from a position effect [14]. Experiments are in progress to identify potential insulator sequences in the 5V and 3V flanking regions of the WAP gene using transgenesis.
[9]
[10]
References [1] L.G. Hennighausen, A.E. Sippel, Mouse whey acidic protein is a novel member of the family of ‘four-disulfide core’ proteins, Nucleic Acids Res. 10 (1982) 2677 – 2684. [2] S.M. Campbell, J.M. Rosen, L.G. Hennighausen, U. Strech-Jurk, A.E. Sippel, Comparison of the whey acidic protein genes of the rat and mouse, Nucleic Acids Res. 12 (1984) 8685 – 8697. [3] E. Devinoy, C. Hubert, E. Schaerer, L.M. Houdebine, J.P. Kraehenbuhl, Sequence of the rabbit whey acidic protein cDNA, Nucleic Acids Res. 16 (1988) 8180. [4] H. Grabowski, D. Le Bars, N. Cheˆne, J. Attal, R. Malie´nou-Ngassa, C. Puissant, L.M. Houdebine, Rabbit whey acidic protein concentration in milk, serum, mammary gland extract, and culture medium, J. Dairy Sci. 74 (1991) 4143 – 4150. [5] O.U. Beg, H. Von Bahr-Lindstrom, Z.H. Zaidi, H. Jornvall, A camel milk whey protein rich in half-cystine. Primary structure, assessment of variations, internal repeat patterns, and relationships with neurophysin and other active polypeptides, Eur. J. Biochem. 159 (1986) 195 – 201. [6] K.J. Simpson, P. Bird, D. Shaw, K. Nicholas, Molecular characterisation and hormone-dependent expression of the porcine whey acidic protein gene, J. Mol. Endocrinol. 20 (1998) 27 – 35. [7] J. Demmer, S.J. Stasiuk, M.R. Grigor, K.J. Simpson, K.R. Nicholas, Differential expression of the whey acidic protein gene during lactation in the brushtail possum (Trichosurus vulpecula), Biochim. Biophys. Acta 1522 (2001) 187 – 194. [8] K.R. Nicholas, J.A. Fisher, E. Muths, J. Trott, P.A. Janssens, C. Reich, D.C. Shaw, Secretion of whey acidic protein and cystatin is down
[11]
[12]
[13]
[14]
[15] [16] [17]
[18]
regulated at mid-lactation in the red kangaroo (Macropus rufus), Comp. Biochem. Physiol., Part A Mol. Integr. Physiol. 129 (2001) 851 – 858. K.J. Simpson, S. Ranganathan, J.A. Fisher, P.A. Janssens, D.C. Shaw, K.R. Nicholas, The gene for a novel member of the whey acidic protein family encodes three four-disulfide core domains and is asynchronously expressed during lactation, J. Biol. Chem. 275 (2000) 23074 – 23081. C.W. Pittius, L. Hennighausen, E. Lee, H. Westphal, E. Nicols, J. Vitale, K. Gordon, A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice, Proc. Natl. Acad. Sci. U. S. A. 85 (1988) 5874 – 5878. C.W. Pittius, L. Sankaran, Y.J. Topper, L. Hennighausen, Comparison of the regulation of the whey acidic protein gene with that of a hybrid gene containing the whey acidic protein gene promoter in transgenic mice, Mol. Endocrinol. 2 (1988) 1027 – 1032. C. Puissant, M. Bayat-Sarmadi, E. Devinoy, L.M. Houdebine, Variation of transferrin mRNA concentration in the rabbit mammary gland during the pregnancy-lactation-weaning cycle and in cultured mammary cells. A comparison with the other major milk protein mRNAs, Eur. J. Endocrinol. 130 (1994) 522 – 529. S. Rival, J. Attal, C. Delville-Giraud, M. Yerle, P. Laffont, C. RogelGaillard, L. Houdebine, Cloning, transcription and chromosomal localization of the porcine whey acidic protein gene and its expression in HC11 cell line, Gene 267 (2001) 37 – 47. S. Rival-Gervier, C. Viglietta, C. Maeder, J. Attal, L.M. Houdebine, Position-independent and tissue-specific expression of porcine whey acidic protein gene from a bacterial artificial chromosome in transgenic mice, Mol. Reprod. Dev. 63 (2002) 161 – 167. Q. Li, S. Harju, K.R. Peterson, Locus control regions: coming of age at a decade plus, Trends Genet. 15 (1999) 403 – 408. A.G. West, M. Gaszner, G. Felsenfeld, Insulators: many functions, many mechanisms, Genes Dev. 16 (2002) 271 – 288. J.H. Chung, M. Whiteley, G. Felsenfeld, A 5Velement of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila, Cell 74 (1993) 505 – 514. M.N. Prioleau, P. Nony, M. Simpson, G. Felsenfeld, An insulator
14
[19]
[20]
[21]
[22]
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14 element and condensed chromatin region separate the chicken betaglobin locus from an independently regulated erythroid-specific folate receptor gene, EMBO J. 18 (1999) 4035 – 4048. L. Hennighausen, N.G. Copeland, N.A. Jenkins, Mapping of the Wap gene to mouse chromosome 11, MGI Direct Data Submission MGI: 1345755 (1999). C. Rogel-Gaillard, C. Zijlstra, A.A. Bosma, D. The´pot, M.L. Fontaine, E. Devinoy, P. Chardon, Assignment of the rabbit whey acidic protein gene (WAP) to rabbit chromosome 10 by in situ hybridization and description of a large region surrounding this gene, Cytogenet. Cell Genet. 89 (2000) 107 – 109. M.C. Edwards, N. Liegeois, J. Horecka, R.A. DePinho, G.F. Sprague Jr., M. Tyers, S.J. Elledge, Human CPR (cell cycle progression restoration) genes impart a Far-phenotype on yeast cells, Genetics 147 (1997) 1063 – 1076. L.M. McLatchie, N.J. Fraser, M.J. Main, A. Wise, J. Brown, N. Thompson, R. Solari, M.G. Lee, S.M. Foord, RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor, Nature 393 (1998) 333 – 339.
[23] R.K. Ball, R.R. Friis, C.A. Schoenenberger, W. Doppler, B. Groner, Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line, EMBO J. 7 (1988) 2089 – 2095. [24] S. Chong, A.D. Riggs, C. Bonifer, The chicken lysozyme chromatin domain contains a second, widely expressed gene, Nucleic Acids Res. 30 (2002) 463 – 467. [25] X. Mata, J.L. Vilotte, Ubiquitous expression of goat cyclin T1 in transgenic mice, Transgenic Res. 11 (2002) 65 – 68. [26] S.A. Krawetz, J.A. Kramer, J.R. McCarrey, Reprogramming the male gamete genome: a window to successful gene therapy, Gene 234 (1999) 1 – 9. [27] E. Pailhoux, P. Parma, J. Sundstrom, B. Vigier, N. Servel, T. Kuopio, A. Locatelli, L.J. Pelliniemi, C. Cotinot, Time course of female-tomale sex reversal in 38,XX fetal and postnatal pigs, Dev. Dyn. 222 (2001) 328 – 340.
Pig whey acidic protein gene is surrounded by two ubiquitously expressed genes Sylvie Rival-Gervier *, Dominique The´pot, Genevie`ve Jolivet, Louis-Marie Houdebine Laboratoire de biologie du de´veloppement et reproduction, Institut National de la Recherche Agronomique, INRA, 78350 Jouy-en-Josas, France Received 5 November 2002; received in revised form 3 March 2003; accepted 19 March 2003
Abstract A 140-kb pig DNA fragment containing the whey acidic protein (WAP) gene cloned in a bacterial artificial chromosome (BAC344H5) has been shown to contain all of the cis-elements necessary for position-independent, copy-dependent and tissue-specific expression in transgenic mice. The insert from this BAC was sequenced. This revealed the presence of two other genes with quite different expression patterns in pig tissues and in transfected HC11 mouse mammary cells. The RAMP3 gene is located 15 kb upstream of the WAP gene in reverse orientation. The CPR2 gene is located 5 kb downstream of the WAP gene in the same orientation. The same locus organization was found in the human genome. The region between RAMP3 and CPR2 in the human genome contains a WAP gene-like sequence with several points of mutation which may account for the absence of WAP from human milk. D 2003 Elsevier Science B.V. All rights reserved. Keywords: WAP; CPR2; RAMP3; Mammary gland; Bacterial artificial chromosome
Whey acidic protein (WAP) is the major protein found in the milk of rodents [1,2], rabbits [3,4] and camels [5]. It has also been identified in the milk of pigs [6] and of three marsupial species [7– 9]. The WAP gene is expressed at high levels and specifically in the mammary gland. Its expression is controlled by lactogenic hormones and the extracellular matrix. In mice and rabbits, the level of WAP mRNA increases several thousand fold between the virgin state and mid-lactation [10 –12]. It has been demonstrated that the pig WAP gene is regulated in the same way as the WAP gene of other species [6,13]. We have recently demonstrated that transgenic mice harboring a randomly integrated 140-kb pig genomic DNA fragment expressed the included porcine WAP gene in a copy number-dependent manner and at high levels, specifically in the mammary gland of lactating animals [14]. This finding led us to conclude that the pig genomic DNA region studied contained all the regulatory elements controlling WAP gene expression. A growing body of evidence indicates that genes included in long genomic DNA fragments are expressed
* Corresponding author. Tel.: +33-1-34-65-25-47; fax: +33-1-34-6522-41. E-mail address: [email protected] (S. Rival-Gervier).
in a reliable manner in transgenic animals [15]. This has led some authors to define the concept of insulators [16]. Insulators are relatively large regions which most likely contain numerous regulatory elements with different and complementary functions. One of the systems studied in most detail is the h-globin locus which is bordered by locus control regions (LCRs), insulating the globin genes of the locus and allowing their specific and high expression. The 5VLCR of the chicken h-globin locus has been shown to contain an insulator defined by its capacity to block the action of globin gene enhancers [17]. This element and others also insulate the h-globin locus from neighboring genes, namely the olfactive receptor genes [18]. In the case of the WAP gene, the chromosomal location has been determined in several species [13,19,20]. However, it is not known whether the WAP gene is surrounded or not by genes preferentially expressed in the mammary gland. We carried out the present experiments to tentatively identify in the 140-kb pig BAC (BAC344H5) other genes surrounding the pig WAP gene and to point out regions which may play a determinant role in the regulation of WAP gene expression, as is the case for the hglobin gene locus. For this purpose, we recently performed the partial sequencing of BAC344H5, which has been described
0167-4781/03/$ - see front matter D 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0167-4781(03)00051-4
8
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
elsewhere [13]. This sequence was used in a BLASTN search of the National Center for Biotechnology Information (NCBI) database. The WAP gene sequence was easily identified. Moreover, a high percentage of identity with the human cycle progression protein 2 (CPR2) gene (Genbank accession number 18565717) was also found in several discrete sequences in the 3Vflanking region of the porcine WAP gene. The finding that each region of homology corresponded to some individual human CPR2 exons suggested that we had identified the porcine orthologue of this gene (Genbank accession number AY231133 to AY231143). Specific analysis of this region by FASTA highlighted the first eight exons of the CPR2 gene (exon1, 72% identity over 68 bp; exon2, 76% identity over 467 bp; exon3, 80% identity over 317 bp; exon4, 81% identity over 111 bp; exon5, 87% identity over 145 bp; exon6, 84% identity over 246 bp; exon7, 78% identity over 112 bp; exon8, 85% identity over 115 bp). The closest sequence with homology to human CPR2 was located solely 5 kb downstream of the polyadenylation signal of the WAP gene and corresponds to the first exon. The coding regions of the WAP and CPR2 genes are both in the same DNA strand (Fig. 1). No sequence from BAC344H5 showed any homology with exon9 of human
CPR2. We cloned the 3Vend of pig CPR2 mRNA using 3V RACE performed with the 5V/3V RACE kit (Roche Diagnostics). Complementary DNAs were synthesized using oligo(dT) and AMV reverse transcriptase from mRNA extracted from the lung of a pig. The specific 3Vends of CPR2 cDNA were amplified by PCR using the CPR2exon2b primer (5VCCAGCCGAGACTCACCCGGGGA 3V) associated with the PCR anchor primer. The PCR products were cloned in the pGEM-T easy vector (Promega). Both strands of the clone were sequenced by the dideoxymethod with fluorescent primers. Sequencing of this fragment showed a ninth exon which presents 76% identity over 234 bp with the human CPR2 exon9. The presence of this exon in BAC344H5 and BAC905F9 was determined using specific PCR with CPR2-exon9-5V(5VGTACTACGAGTG GCTGGAACTC 3V) and CPR2-exon9-3V (5V GCCACCACCCCACTTCCAAC 3V) primers. It was found in BAC905F9 but not in BAC344H5. Human CPR2 is one of 13 cell proliferation regulators identified so far [21]. The CPR genes control a variety of biochemical functions involved in cell proliferation. The CPR2 gene encodes a leucine-rich protein containing multiple putative leucine zipper domains characteristic of transcription factors. It has been suggested that this
Fig. 1. WAP gene locus organization. n indicates the location of the four exons of the porcine WAP gene. 5 indicates the location of the entire porcine WAP gene. A: AscI; X: XhoI; E: EcoRI; N: NotI. Position and orientation of RAMP3, WAP and CPR2 genes are represented by arrows. The pWAPpXhoI encompasses the WAP gene surrounded by 1 and 2.4 kb upstream and downstream of the transcribed region, respectively. The BAC905F9 contains 70 kb upstream and 50 kb downstream of the WAP gene. The BAC344H5 encompasses 130 kb upstream of the cap site of the WAP gene.
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
protein may act at the level of the transcription of cyclin genes (CLN1 and CLN2) or the stability of their transcripts. The human CPR2 gene is widely expressed in the placenta, in the infant brain, muscle, heart, spleen, skin epidermis, white blood cells, in fetal heart, brain, liver, spleen, in 12-week-old brain and retina and in tumoral tissues derived from ovary, trachea and skin. We then studied the expression pattern of endogenous CPR2 and WAP genes in a range of porcine tissues (lung, liver, kidney, spleen, heart, stomach and mammary gland of lactating animals) by RT-PCR analyses. The results are shown in Fig. 2. WAP mRNA was only detected in the mammary gland of a 9-day lactating pig. Furthermore, all the tissues tested were positive for CPR2 mRNAs. The concentration of CPR2 mRNA appeared to be quite similar in all tissues. Human CPR2 gene was initially located at 7p11 –p13. The closest gene identified on the 5V side of the human CPR2 gene was the receptor (calcitonin)-activity modifying protein 3 (RAMP3) gene (NCBI human database). We then looked for this gene in our sequence using FASTA analysis. Sequences with homologies to human exons (Genbank, accession number AJ001016) were easily identified (exon1, Genbank, accession number AY236153, 81% identity over 61 bp; exon2, Genbank, accession
9
number AY236154, 78% identity over 133 bp; exon3, Genbank, accession number AY236155, 82% identity over 265 bp). Porcine RAMP3 exon1 was located 16,600 bp upstream of the WAP gene. WAP and RAMP3 genes were situated in the opposite direction (Fig. 1). Human RAMP3 is a member of the RAMP family which is required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. In the presence of RAMP3, CRLR acts as an adrenomedullin receptor. The human RAMP3 gene is expressed in a wide range of human tissues (heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas) [22]. We then studied the expression pattern of endogenous RAMP3 gene by RT-PCR analyses. The results are shown in Fig. 2. Likewise, we observed its constitutive expression in a range of porcine tissues (lung, liver, kidney, spleen, heart, stomach and mammary gland of lactating animals). However, this expression was more or less intense, depending on the tissues tested. Mammary gland appeared to express the RAMP3 gene at the lowest level. WAP, RAMP3 and CPR2 gene sequences were in close vicinity, but their expression patterns were very different. The data given above indicate that the WAP gene is specifically expressed in the mammary gland of lactating animals, whereas CPR2 and RAMP3 genes are expressed
Fig. 2. WAP, RAMP3 and CPR2 gene transcription in different tissues of pig. Tissue samples were collected from a non-lactating pig (lung, liver, kidney, spleen, heart, stomach) or from a 9-day lactating pig (mammary gland). Total RNAs were prepared using the SV total RNA isolation system (Promega), according to the manufacturer’s recommendations. The first strand of cDNA was synthesized (in a final volume of 20 Al) with the AMV reverse transcriptase (RT+) according to the manufacturer’s recommendations (first strand cDNA synthesis kit for RT-PCR, Roche Diagnostics Boehringer Mannheim Corp., Indianapolis, USA), using 1 Ag of total RNA and the oligo(dT) primer. The absence of DNA was verified by performing a RT reaction without reverse transcriptase (RT ). PCR was then performed using 1 Al of 20 Al of material obtained after reverse transcription with different sets of primer corresponding to each gene. To detect CPR2 mRNA, CPR2-5V(5VGCGATGCACGTGCCTCCTGAGAGA 3V) in exon2 and CPR2-3V(5VGCCAGGAAGGCCAGGTGCTTGTAC3V) in exon3 were used. For RAMP3 mRNA, RAMP3-exon1-3V(5VTGGCTAGCCATGGAGGCGACAGC3V) in exon1 and RAMP3-exon3c (5VAG GGTCAGCAGGATGGGCACCA 3V) in exon3 were used. The WAP mRNA was detected using the WAP primer set described previously [13]. To normalize RT-PCR amplification, the endogenous pig actin cDNA was amplified from the same RT products, as previously described [27].
10
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
relatively ubiquitously. It appeared interesting to determine whether a BAC containing the three entire genes was able to direct the expression of these genes when it was transfected into mammary cells. The HC11 cell line was derived from spontaneously immortalized COMMA1D cells isolated from the mammary gland of a mid-pregnant mouse [23]. In this cell line, endogenous h-casein and WAP gene expressions are regulated by lactogenic hormones (insulin, hydrocortisone and prolactin) and by cell – extracellular matrix interactions. We have already shown that the expression of the WAP gene from BAC905F9 was detectable by RT-PCR in transfected HC11 cells [13]. The BAC905F9 encompasses RAMP3, WAP and CPR2 fulllength genes (Fig. 1). In addition, the pWAPpXhoI plasmid (Fig. 1) contains the WAP gene only. It was therefore necessary to determine whether the RAMP3 and CPR2 genes were also expressed from the BAC905F9 in HC11 cells. Specific CPR2 and RAMP3 PCRs were performed on reverse transcripts, as described previously. Fig. 3 shows that WAP mRNA was detectable in cells transfected with the pWAPpXhoI plasmid or with BAC905F9. No CPR2 and RAMP3 mRNAs were detectable in cells transfected by plasmid pWAPpXhoI. On the other hand, specific
Fig. 3. Porcine WAP, CPR2 and RAMP3 gene expression in mouse epithelial cell line (HC11). HC11 cells were cotransfected with the RSVneo and pWAPpXhoI or BAC905F9. Pools of clones were selected by G418 (150 Ag/ml). The culture of mouse mammary HC11 cells transfected or not by BAC905F9 and pWAPpXoI and the conditions of WAP gene induction have been described in a previous work as well as WAP and GAPDH mRNA detection by RT-PCR [13]. Specific porcine WAP RT-PCR (A), CPR2 RT-PCR (B) and RAMP3 RT-PCR (C) were performed on nontransfected HC11 cell lines (HC11 NT), pWAPpXhoI pool (pWAPpXhoI) and BAC905F9 pool (BAC905F9). Reverse transcription and PCR were performed as described in the legend to Fig. 2. PCR products were electrophoresed on agarose gel and the BET pictures are presented (A, B and C). RAMP3 RT-PCR products were blotted on nylon membrane and hybridized with labeled porcine cDNA RAMP3 exon3 probe (D).
CPR2 and RAMP3 RT-PCR were positive in cells transfected with BAC905F9, which harbors the three genes. However, RAMP3 gene expression was particularly weak because we needed to hybridize the RT-PCR product to visualize unambiguously the amplified sequence. This low expression level in transfected HC11 cells may be due to the fact that some regulatory elements of the RAMP3 gene are missing from the 5Vend of the BAC. More likely, this reflects the natural situation. Indeed, the RAMP3 gene is very weakly expressed in the mammary gland of lactating pig (Fig. 2). In the NCBI database, RAMP3 and CPR2 genes are positioned on human chromosome 7 (7p13 – p12 and 7p14– p13, respectively). Localization of the porcine WAP gene on porcine chromosome 18 has been reported previously [13]. These findings were consistent with other studies which demonstrated, using the FISH technique, that porcine chromosome 18 displayed homologies with human chromosomal segments 7p15.2 – p12 and 7q31.3 – qter7 (http:// www.toulouse.inra.fr/lgc/pig/compare/SSCHTML/SSC18S. HTM). In the mouse genome, according to the MGSC database (http://www.ensembl.org/Mus _musculus/), the three murine genes (CPR2, RAMP3 and WAP) are newly colocalized on chromosome 11, in close proximity and in similar respective positions. Whey acidic protein has not been found in human milk, and its gene has not been described in the human genome. The synteny observed in the RAMP3 – CPR2 region between humans and pigs raised the question as to whether a human WAP gene is present in the RAMP3 – CPR2 intergenic region. FASTA analysis revealed the presence of a sequence highly homologous to other known WAP genes in this region. However, close examination of this homologous sequence showed that some important features (position of ATG and stop codons) of a functional WAP gene are missing (Fig. 4). Despite strong homology at the DNA level, if the human WAP-like sequence is transcribed, it does not encode a WAP protein after translation. However, we do not know whether this mutated gene is transcribed or not. All these facts support the hypothesis that the human homologous sequence of the porcine WAP gene is present between the RAMP3 and CPR2 genes but the existence of a transcript from this WAP-like sequence has not been investigated so far. The most unexpected result of this study is that the WAP gene is surrounded by two genes which are constitutively expressed and located in very close proximity to the WAP gene (16.5 kb upstream and 5 kb downstream). This vicinity in genomes between tissue-specific expressed genes and ubiquitously expressed genes has already been observed. Recently published data indicate that the chicken lysozyme gene is close to a ubiquitously expressed gene, and regulatory elements previously described are located within the newly described neighboring gene [24]. Similarly, the goat a-lactalbumin gene, which is specifically expressed in the mammary gland of lactating animals, is in
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
the vicinity of the cyclin T1 gene expressed in all cell types [25]. These observations are not fully compatible with the LCR concept. Some regulatory elements (insulators, chromatin openers) may locally maintain an active
11
chromatin configuration allowing neighbor genes, related or not, to be efficiently expressed if their own promoters and enhancers are activated by specific transcription factors [26].
12
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
The case of the pig WAP gene and its surrounding genes raises the question as to whether the three genes (RAMP3, WAP and CPR2) belong to one, two or three independent
chromatin domains. This implies that some regions acting as barriers or insulators may or may not be present between the three genes. We showed that the presence of the CPR2 gene
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14
13
Fig. 4. Human potential WAP gene sequence. (A) Human sequence homologous to porcine WAP gene. The human RAMP3-CPR2 intergenic region (Genbank AC013416.4, position 34001 – 37000) is highly homologous to other known WAP genes already described. Sequences with upper case letters are homologous to the four exons of pig, rabbit, rat and mouse WAP genes. Sequences homologous to introns and flanking sequences are in lower case letters. The ATA in bold underlined letters is homologous to the translation start codon ATG of other known functional WAP genes. Important features of a functional WAP gene are missing from the human sequence (translation start codon ATG, polyadenylation signal AATAAA, the branch site of putative intron 2,. . .). (B) Alignments of human sequences homologous to other exons WAP sequences with exons of pig (AF320306), rabbit (X52564), rat (NM_042921) and mouse (NW_000035) WAP sequences. The translation start codon ATG and stop codon TGA and the polyadenylation signal AATAAA are indicated in bold in exons 1 and 4, respectively. In the human sequence, the lack of a translation start codon ATG in the exon1 sequence, the point deletion at the end of exon2, conservation of the translation stop codon TGA and the lack of a polyadenylation signal AATAAA in the exon4 sequence should be noted.
was not necessary to obtain perfectly regulated WAP gene expression in transgenic mice, because 5 kb downstream of the WAP gene were sufficient to protect the transgene from a position effect [14]. Experiments are in progress to identify potential insulator sequences in the 5V and 3V flanking regions of the WAP gene using transgenesis.
[9]
[10]
References [1] L.G. Hennighausen, A.E. Sippel, Mouse whey acidic protein is a novel member of the family of ‘four-disulfide core’ proteins, Nucleic Acids Res. 10 (1982) 2677 – 2684. [2] S.M. Campbell, J.M. Rosen, L.G. Hennighausen, U. Strech-Jurk, A.E. Sippel, Comparison of the whey acidic protein genes of the rat and mouse, Nucleic Acids Res. 12 (1984) 8685 – 8697. [3] E. Devinoy, C. Hubert, E. Schaerer, L.M. Houdebine, J.P. Kraehenbuhl, Sequence of the rabbit whey acidic protein cDNA, Nucleic Acids Res. 16 (1988) 8180. [4] H. Grabowski, D. Le Bars, N. Cheˆne, J. Attal, R. Malie´nou-Ngassa, C. Puissant, L.M. Houdebine, Rabbit whey acidic protein concentration in milk, serum, mammary gland extract, and culture medium, J. Dairy Sci. 74 (1991) 4143 – 4150. [5] O.U. Beg, H. Von Bahr-Lindstrom, Z.H. Zaidi, H. Jornvall, A camel milk whey protein rich in half-cystine. Primary structure, assessment of variations, internal repeat patterns, and relationships with neurophysin and other active polypeptides, Eur. J. Biochem. 159 (1986) 195 – 201. [6] K.J. Simpson, P. Bird, D. Shaw, K. Nicholas, Molecular characterisation and hormone-dependent expression of the porcine whey acidic protein gene, J. Mol. Endocrinol. 20 (1998) 27 – 35. [7] J. Demmer, S.J. Stasiuk, M.R. Grigor, K.J. Simpson, K.R. Nicholas, Differential expression of the whey acidic protein gene during lactation in the brushtail possum (Trichosurus vulpecula), Biochim. Biophys. Acta 1522 (2001) 187 – 194. [8] K.R. Nicholas, J.A. Fisher, E. Muths, J. Trott, P.A. Janssens, C. Reich, D.C. Shaw, Secretion of whey acidic protein and cystatin is down
[11]
[12]
[13]
[14]
[15] [16] [17]
[18]
regulated at mid-lactation in the red kangaroo (Macropus rufus), Comp. Biochem. Physiol., Part A Mol. Integr. Physiol. 129 (2001) 851 – 858. K.J. Simpson, S. Ranganathan, J.A. Fisher, P.A. Janssens, D.C. Shaw, K.R. Nicholas, The gene for a novel member of the whey acidic protein family encodes three four-disulfide core domains and is asynchronously expressed during lactation, J. Biol. Chem. 275 (2000) 23074 – 23081. C.W. Pittius, L. Hennighausen, E. Lee, H. Westphal, E. Nicols, J. Vitale, K. Gordon, A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice, Proc. Natl. Acad. Sci. U. S. A. 85 (1988) 5874 – 5878. C.W. Pittius, L. Sankaran, Y.J. Topper, L. Hennighausen, Comparison of the regulation of the whey acidic protein gene with that of a hybrid gene containing the whey acidic protein gene promoter in transgenic mice, Mol. Endocrinol. 2 (1988) 1027 – 1032. C. Puissant, M. Bayat-Sarmadi, E. Devinoy, L.M. Houdebine, Variation of transferrin mRNA concentration in the rabbit mammary gland during the pregnancy-lactation-weaning cycle and in cultured mammary cells. A comparison with the other major milk protein mRNAs, Eur. J. Endocrinol. 130 (1994) 522 – 529. S. Rival, J. Attal, C. Delville-Giraud, M. Yerle, P. Laffont, C. RogelGaillard, L. Houdebine, Cloning, transcription and chromosomal localization of the porcine whey acidic protein gene and its expression in HC11 cell line, Gene 267 (2001) 37 – 47. S. Rival-Gervier, C. Viglietta, C. Maeder, J. Attal, L.M. Houdebine, Position-independent and tissue-specific expression of porcine whey acidic protein gene from a bacterial artificial chromosome in transgenic mice, Mol. Reprod. Dev. 63 (2002) 161 – 167. Q. Li, S. Harju, K.R. Peterson, Locus control regions: coming of age at a decade plus, Trends Genet. 15 (1999) 403 – 408. A.G. West, M. Gaszner, G. Felsenfeld, Insulators: many functions, many mechanisms, Genes Dev. 16 (2002) 271 – 288. J.H. Chung, M. Whiteley, G. Felsenfeld, A 5Velement of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila, Cell 74 (1993) 505 – 514. M.N. Prioleau, P. Nony, M. Simpson, G. Felsenfeld, An insulator
14
[19]
[20]
[21]
[22]
S. Rival-Gervier et al. / Biochimica et Biophysica Acta 1627 (2003) 7–14 element and condensed chromatin region separate the chicken betaglobin locus from an independently regulated erythroid-specific folate receptor gene, EMBO J. 18 (1999) 4035 – 4048. L. Hennighausen, N.G. Copeland, N.A. Jenkins, Mapping of the Wap gene to mouse chromosome 11, MGI Direct Data Submission MGI: 1345755 (1999). C. Rogel-Gaillard, C. Zijlstra, A.A. Bosma, D. The´pot, M.L. Fontaine, E. Devinoy, P. Chardon, Assignment of the rabbit whey acidic protein gene (WAP) to rabbit chromosome 10 by in situ hybridization and description of a large region surrounding this gene, Cytogenet. Cell Genet. 89 (2000) 107 – 109. M.C. Edwards, N. Liegeois, J. Horecka, R.A. DePinho, G.F. Sprague Jr., M. Tyers, S.J. Elledge, Human CPR (cell cycle progression restoration) genes impart a Far-phenotype on yeast cells, Genetics 147 (1997) 1063 – 1076. L.M. McLatchie, N.J. Fraser, M.J. Main, A. Wise, J. Brown, N. Thompson, R. Solari, M.G. Lee, S.M. Foord, RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor, Nature 393 (1998) 333 – 339.
[23] R.K. Ball, R.R. Friis, C.A. Schoenenberger, W. Doppler, B. Groner, Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line, EMBO J. 7 (1988) 2089 – 2095. [24] S. Chong, A.D. Riggs, C. Bonifer, The chicken lysozyme chromatin domain contains a second, widely expressed gene, Nucleic Acids Res. 30 (2002) 463 – 467. [25] X. Mata, J.L. Vilotte, Ubiquitous expression of goat cyclin T1 in transgenic mice, Transgenic Res. 11 (2002) 65 – 68. [26] S.A. Krawetz, J.A. Kramer, J.R. McCarrey, Reprogramming the male gamete genome: a window to successful gene therapy, Gene 234 (1999) 1 – 9. [27] E. Pailhoux, P. Parma, J. Sundstrom, B. Vigier, N. Servel, T. Kuopio, A. Locatelli, L.J. Pelliniemi, C. Cotinot, Time course of female-tomale sex reversal in 38,XX fetal and postnatal pigs, Dev. Dyn. 222 (2001) 328 – 340.