PIK3CA Mutation Status in Japanese Esophageal Squamous Cell Carcinoma

Journal of Surgical Research 145, 320 –326 (2008) doi:10.1016/j.jss.2007.03.044

PIK3CA Mutation Status in Japanese Esophageal Squamous Cell Carcinoma Ryota Mori, M.D., Hideyuki Ishiguro, M.D., Ph.D.,1 Masahiro Kimura, M.D., Ph.D., Akira Mitsui, M.D., Ph.D., Hidefumi Sasaki, M.D., Ph.D., Keisuke Tomoda, M.D., Yoichiro Mori, M.D., Ryo Ogawa, M.D., Takeyasu Katada, M.D., Osamu Kawano, M.D., Koshiro Harada, M.D., Yoshitaka Fujii, M.D., Ph.D., and Yoshiyuki Kuwabara, M.D., Ph.D. Department of Surgery II, Nagoya City University Medical School, Nagoya, Japan Submitted for publication January 9, 2007

Background. A somatic mutation of the PIK3CA (phosphatidylinositol 3-kinase catalytic subunit) gene has been found in human cancer patients. However, this mutation has not yet been extensively studied in esophageal squamous cell carcinomas. Materials and methods. We analyzed a mutation of the PIK3CA gene in 88 Japanese cases of esophageal squamous cell carcinomas that had all undergone surgery at the Department of Surgery II, Nagoya City University Medical School, between 1996 and 2003. The TE and KYSE series of cell lines are human esophageal cancer cell lines. Two PIK3CA mutation hot spots (exon 9 and exon 20) were analyzed by a real time polymerase chain reaction (PCR)-based assay and the data were confirmed by direct sequencing. We performed a cell proliferation assay to determine the effects of a PI3K inhibitor LY294002. Result. In exon 9, a somatic mutation was found in two patients (2.2%) and in two cell lines. The mutations included three E545K (G1633A) mutations and one E545Q (G1633C) mutation. However, in exon 20, no mutation was observed in our esophageal cancer patients. PI3K inhibitor (LY294002) inhibited the growth of an esophageal cancer cell line with a PIK3CA mutation (E545K) in vitro. Conclusions. We found LY294002 to reduce the proliferation of the esophageal cancer cell line in vitro. Importantly, a cell line with a PIK3CA gene mutation was more susceptible to a PI3K inhibition than those without any such mutation. Further functional analyses of the PIK3CA mutations are war1

To whom correspondence and reprint requests should be addressed at Department of Surgery II, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan. E-mail: [email protected].

0022-4804/08 $34.00 © 2008 Elsevier Inc. All rights reserved.

ranted to determine whether or not they may be potentially useful targets of therapy for esophageal cancer. © 2008 Elsevier Inc. All rights reserved.

Key Words: PIK3CA; esophageal cancer; mutational analysis; PI3K inhibitor (LY294002).

INTRODUCTION

It is now well established that cancer is a genetic disease and that somatic mutation of the oncogenes or tumor suppressor genes are the initiator of the carcinogenic process [1]. The phosphatidylinositol 3-kinase signaling pathway has recently been suggested to play a pivotal role in the oncogenesis of human cancers [1]. Recently, high frequencies of somatic mutations in the PIK3CA gene have been reported in several cancer types, including cancer of the colon, brain, stomach, breast, and ovaries [2–7]. More than 75% of these mutations are clustered in the helical (exon 9) and kinase domains (exon 20) of the PIK3CA gene [2]. Mutations in the three mutation hotspots in PIK3CA (i.e., E542K, E545K, and H1047R) have been shown to elevate the lipid kinase activity and thereby leading to the activation of the downstream Akt signaling pathway [2, 8]. In a recent report, a PIK3CA mutation was identified in 4 of 35 esophageal squamous cell carcinomas and in 3 of 50 adenocarcinomas [9]. For these known mutations, real time polymerase chain reaction followed by melting curve analysis, using hybridization probes, has been demonstrated to be a highly sensitive, rapid, and an efficient approach to mutation detection [10 –12]. To determine the PIK3CA mutation status in Japanese esophageal cancer for screening and diagnostic purposes, we used this PCR-

320

MORI ET AL.: PIK3CA MUTATION IN ESOPHAGEAL CANCER

based screening method [13]. The PIK3CA gene was then sequenced to confirm the results of such screening.

321

Direct Sequencing

MATERIALS AND METHODS

Samples with positive results according to the PCR-based study were sequenced by means of the ABI prism 3100 analyzer (Applied Biosystems Japan Ltd., Tokyo, Japan) and then were analyzed using ABI prism Seq Scape Version 2. 1. 1.

Patients

Proliferation Assay

The study groups included 88 esophageal cancer patients who had undergone surgery at the Department of Surgery II, Nagoya City University Medical School between 1996 and 2003. All patients gave their written informed consent. The esophageal tumors were classified according to the general rules for clinical and pathological record of esophageal cancer in Japan. All tumor samples were immediately frozen and stored at ⫺80°C until assayed. The clinical and pathological characteristics of the 88 esophageal cancer patients are as follows; 12 cases at stage I, 13 at stage II, and 63 at stage III–IV. The mean age was 61.74 y (range, 43– 80) and all esophageal cancers were squamous cell carcinomas.

Cell Lines and Cell Culture The TE (obtained from the Institute of Development, Aging, and Cancer, Tohoku University) and KYSE (obtained from Japanese Collection Research Bioresources, Japan) series of cell lines are human esophageal cancer cell lines and were cultured in 5% CO 2 atmosphere at 37°C and in a medium supplemented with 10% fetal bovine serum. In some experiments, the cells were treated with the PI3K inhibitor (LY294002) (0.1–50 ␮M; Calbiochem, La Jolla, CA). Giemsa stain were performed at the indicated times to semiquantitate the cell proliferation.

PCR Assays for PIK3CA Total RNA was extracted from esophageal cancer tissues and adjacent nonmalignant esophageal tissues using an Isogen kit (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. The RNA concentration was determined by a spectrophotometer and adjusted to a concentration of 200 ng/mL. RNA (1 ␮g) was reverse transcribed by Superscript II enzyme (Life Technologies, Inc., Gaithersburg, MD) with 0.5 ␮g oligo (dT) 12–16 (Amersham Pharmacia Biotech Inc. Piscataway, NJ). The reaction mixture was incubated at 42°C for 50 min and then at 72°C for 15 min. We then used 1 ␮L of each DNA for LightCylcer analyses. The genotyping PCR reactions were performed using LightCycler DNA Master Hybridization probes kit (Roche Molecular Biochemicals, Mannheim, Germany) in a 20 ␮L reaction volume. The primer sequences for PIK3CA gene in exon 9 were as follows: the forward primer, 5-GAATTGGTCTGTATCCCGAG-3 and the reverse primer, 5-CGGGGATAGTTACACAATAGT-3 (200bp). For the exon 9 genotyping, sensor (LC Red 640-AGGATCTCGTGTAGAAATTGCTTTGAGCTGTTCTT-phoshate) and anchor (TTTCTCCTGCTCAGTGATTTCAGAGA-Fluorescein) probes were used. The cycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 58°C for 15 s, 72°C for 8 s. The primer sequences for PIK3CA gene in exon 20 were as follows: the forward primer, 5-CTCTGGAATGCCAGAACTAC-3 and the reverse primer, 5-ATGCTGTTTAATTGTGTGGAAG-3 (175bp). For the exon 20 genotyping, sensor (ACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTT-Fluorescein) and anchor (LC Red 640 GAGTATTTCATGAAACAAATGAATGCACATC) probes were used. The cycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 59°C for 15 s, 72°C for 7 s. The cDNA from HCT-116 colon cancer cell line was used as a positive control. This cell line has the H1047R (exon 20) mutation [14]. The primers for PIK3CA gene exon 9 were also used for direct sequencing.

The cells were seeded at a density of 3 ⫻ 10 3/well in 96-well plates in complete culture medium. After 24 h of culture, the medium was added with or without LY294002 (0.1–50 ␮M). Control cultures received DMSO at corresponding concentrations. Cell proliferation was assessed 72 h later using and MTT assay (CellTiter 96; Promega, Madison, WI). Cell proliferation was determined as the ratio of the absorbance of treated cells to the density of the control untreated cells.

Statistical Methods Statistical analyses were done using the Mann-Whitney t-test for unpaired samples and Wilcoxon’s signed rank test for paired samples. The linear relationships between variables were determined by means of a simple linear regression. The correlation coefficients were determined by the rank correlation using Spearman’s test and the ␹ 2-test. All analyses were done using the Stat-View software package (Abacus Concepts Inc. Berkeley, CA), and the results were considered significant when the P-value was less than 0.05.

RESULTS Mutational Analysis of PIK3CA Exon 9 and Exon 20 in Esophageal Cancer

For the PCR-based mutation analysis of the exon 9 of PIK3CA, the anchor probe was matched for the wild type sequence. As shown in Fig. 1A, the wild type PCR product showed a melting curve with a single peak at 66°C, whereas the heterozygous products (mutant) showed an additional peak at 59°C. Among the 88 esophageal cancer patients, three patients had an additional peak (in two, the mutation was confirmed by sequencing; see below). Using the probe for exon 20, the homozygous wild type PCR product showed a single peak at 67°C in the PCR-based mutation analysis (Fig. 1B). No additional peak was detected in our assay in any of the esophageal cancer samples (Fig. 1B), thus suggesting that there was no mutation at exon 20. Among the 27 esophageal cancer cell lines, 2 (TE-5, KYSE510) showed an abnormal peak (Table 1). Direct Sequencing of the Exon 9 of PIK3CA

Using the exon 9 primer sets, a PCR product of 200 bp was obtained, which was then subjected to direct sequencing. Among the five samples that showed an additional peak in the PCR-based screening, four samples were confirmed as a mutant by direct sequencing. There were two types of mutations; E545K (G1633A) in one patient and two cell lines and E545Q (G1633C) in one patient (Fig. 2). Case 1 had an E545Q point mutation in the exon 9; case 2 had E545K. Both of these patients were male and had squamous cell carcinoma

322

JOURNAL OF SURGICAL RESEARCH: VOL. 145, NO. 2, APRIL 2008

FIG. 1. (A) Detection of a mutation in exon 9 of PIK3CA from esophageal cancer tissue specimens using a PCR based system. The negative derivative of the fluorescence (-dF/dT) versus temperature graph shows peaks with different Tm. Wild type samples showed a single peak at 64°C. One of the heterozygous mutant samples is shown here with an additional peak at 57°C. (B) Detection of mutation in exon 20 of PIK3CA. All of the esophageal cancer samples showed a single peak at 69°C, thus suggesting that there was no mutation in exon 20. Representative samples are shown here.

with moderately differentiated histological type (Table 2). The two cell lines, both with the E545K mutation, were derived from female patients. The DNA from matched normal esophageal tissue from the two patients with a PIK3CA mutation showed a wild type sequence (not shown), thus suggesting that the mutations were somatic. Effects of LY294002 on Esophageal Cancer Cells Proliferation

With an amino acid-substituting mutation in the PIK3CA gene, the TE-5 and KYSE510 cell lines may

have an altered response to the inhibition of thePI3K pathway. To determine the effects of a PI3K inhibitor LY 294002, TE-5 and KYSE510 cells were treated with different concentrations of LY294002. After 72 h of treatment, the number of TE-5 cells in 1, 5, 10, and 50 ␮M LY294002-treated wells was reduced by 8, 30, 57, and 93%, respectively, in comparison with the control culture. In contrast, KYSE510 cells did now show any appreciable inhibition of growth. The appearance of TE-5 cells in culture is shown in Fig. 3. LY294002 (5–50 ␮M) markedly inhibited the cell proliferation.

MORI ET AL.: PIK3CA MUTATION IN ESOPHAGEAL CANCER

TABLE 1 PIK3CA Mutation in Esophageal Cancer Cell Lines PIK3CA mutation Cell line

exon 9

exon 20

TE-1 TE-2 TE-3 TE-4 TE-5 TE-6 TE-7 TE-8 TE-9 TE-10 TE-11 TE-12 TE-13 TE-14 TE-15 KYSE30 KYSE50 KYSE70 KYSE110 KYSE140 KYSE150 KYSE180 KYSE270 KYSE410 KYSE450 KYSE510 KYSE520

wt wt wt wt E545K wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt E545K wt

wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt

323

ported to be around 32% in colon cancer [2], from 4% to 25% in gastric cancer [2, 15], from 8% to 40% in breast cancer [2–5], from 5% to 27% in brain cancer [2, 6], from 4% to 7% in ovarian cancer [2, 5, 7], 4% in lung cancer [2], and 8.2% in esophageal cancer [9]. This report by Phillips et al. on esophageal cancer investigated 35 squamous cell carcinomas and 50 adenocarcinomas using single strand conformation polymorphism. In the present study, we screened 88 esophageal squamous cell carcinomas and used direct sequencing to confirm the results and thereby identified a 2.2% mutation rate. This figure was somewhat lower than that in the report of Phillips et al., which found a PIK3CA gene mutation in 12% of esophageal squamous cell carcinomas [9].

wt ⫽ wild type.

The sensitivity of esophageal cancer cell lines to LY294002 was determined by an MTT assay. The percentage of viable cells is shown relative to the untreated controls. IC 50 was determined from these dose–response curves using the Graphcel software program created by T. Kobo in Japan (Table 3). TE-5 cells that have a PIK3CA gene mutation tend to be more sensitive to LY294002 than TE-2 or KYSE 150, which do not have the PIK3CA gene mutation (Fig. 4). The growth of KYSE510 cells with the same mutation was not inhibited. DISCUSSION

In the experiments reported in this paper, we found that 2.2% (2/88) of the esophageal cancer patients and 7.4% (2/27) of the esophageal cancer cell lines harbored a somatic mutation in the exon 9 of the PIK3CA gene (Tables 1 and 2, Fig. 2). No exon 20 mutation was found. We specifically examined exon 9 and 20 of PIK3CA genes because a previous study on a large number of colon cancers reported that four-fifths of the observed mutations were clustered in these two exons [2]. The mutation frequency of PIK3CA has been re-

FIG. 2. Four mutations detected in PIK3CA by direct sequencing. Case 1 had a G to C single nucleotide change resulting in E545Q (G1633C). Case 2 also had a single nucleotide change resulting in E545K (G1633A). Among the cells lines, TE-5 and KYSE-510 had an E545K mutation. (Color version of figure is available online.)

324

JOURNAL OF SURGICAL RESEARCH: VOL. 145, NO. 2, APRIL 2008

TABLE 2 Clinicopathological Data About 2 PIK3CA Mutant Patients Case

Age

Gender

pT

pN

pStage

Pathology

PIK3CA mutation

99–09 01–01

76 69

Male Male

4 3

3 0

IVa II

SCC (mod) SCC (mod)

E545Q E545K

SCC ⫽ squamous cell carcinoma; mod, moderately differentiated.

This difference may be due to ethnicity, the histological type, or some other unknown reasons. Qiu et al. investigated the PIK3CA mutation status of the head and neck squamous cell carcinoma (HNSCC) [15]; 11% of HNSCC had PIK3CA mutations [15]. Interestingly, a PIK3CA mutation was detected in only 11.8% of the esophageal squamous cell carcinomas and in less (6%) in the adenocarcinomas [9]. These findings may imply that the PIK3CA gene mutation occurs more frequently in squamous cell carcinoma than in adenocarcinoma. A mutation analysis by PCR using a LightCycler was found to be both effective and easy to use. The frequency of a mutation of PIK3CA in the ESCC cell lines (7.4%) was not substantially lower than that reported in a previous study of various other

cancers. To have a confirmed mutation in two examples (2.2%) in 88 of gullet squamous cell carcinoma is thus considered to be indicative of a low frequency. However, the possibility of a regional difference among Westerners, who tend to demonstrate various frequencies of esophageal adenocarcinoma, is thus considered to exist. As a result, the accumulation of further examples in the future is considered to be necessary. Japanese esophageal cancers tend to most frequently be squamous cell carcinomas and we could not identify any difference in the PIK3CA mutation between the histological types. Recent developments in fast PCR and real time detection of products make a more sensitive detection of mutations possible [10 –13, 16, 17]. We have optimized the mutation detection method using the LightCycler. The use of labeled probes homologous to the PCR product permits a specific identification of the PCR products [12, 17]. The advantages of this strategy include the fact that the hybridization of the probe is not restricted to the temperature range required for Taq polymerase to remove a base [18, 19]. Mutations covered by the probe can be detected by a shift in the melting temperature. In our study, four of five cases with an additional peak in the melting curve were confirmed to have a base substituting mutation in the direct sequencing; one case had an additional peak in the melting curve, but it was not confirmed by direct sequencing. Whether this indicates a false positive of the melting curve analysis or false negative of the direct sequencing analysis remains unknown. The PIK3CA gene codes for the catalytic subunit p110␣ of class IA phosphatidylinositol 3-kinases TABLE 3 IC50 Values of PI3K Inhibitor (LY294002) in the Cell Lines

FIG. 3. The appearance of cultured TE-5 cells with or without PI3K inhibitor (LY294002). TE-5 cells were cultured for 72 h in RPMI with 10% fetal bovine serum without PI3K inhibitor (A) or 1 (B), 5 (C), 10 (D), or 50 (E) ␮M of LY294002.

Cell lines

PIK3CA

IC50 LY294002 (uM)

TE-5 TE-2 KYSE150 KYSE510

E545K wt wt E545K

8.4 17.4 17.7 24.0

wt ⫽ wild type.

MORI ET AL.: PIK3CA MUTATION IN ESOPHAGEAL CANCER

FIG. 4. The effect of PI3K inhibitor (LY294002) on the growth of esophageal carcinoma cell lines. The appearance of cultured TE-2, TE-5, KYSE150, and KYSE510 cells cultured with or without 10 ␮M LY294002. TE-5 cells that have a PIK3CA mutation are more sensitive to LY294002 than TE-2 and KYSE150 without such a PIK3CA mutation. KYSE510 cells with the same mutation as the TE-5 cells were not sensitive to LY294002. Control cultures received DMSO at the same concentration as the LY294002 treated wells. Magnification ⫻50.

(PI3Ks) [20]. The cancer specific point mutations of p110␣ confers a gain of function resulting in an increased lipid kinase activity [2, 21–23]. The expression of p110␣ mutants activates the Aktsignaling pathway in the absence of growth factor while inducing the oncogenic cellular transformation of both chicken embryo fibroblasts and NIH3T3 cells [21, 23]. The PIK3CA gene is located on chromosome 3q26. A common amplification encompassing the chromosome region 3q26 has been identified by comparative genomic hybridization (CGH) analyses in a variety of tumors, including the cervix, ovary, endometrium, lung, head, and neck [24]. Especially in squamous cell carcinoma of the lung, the chromosome 3q26 region is frequently amplified [25, 26], and the PIK3CA gene is therefore considered to be one of the candidate genes responsible for the effect of such amplification [27].

325

Although we did not study the amplification of 3q26 in our patients, those with an amplification of PIK3CA may be targets of therapy that modifies the PI3K pathway. Previous studies have indicated that LY294002 completely abolished PI3K activity in several cell types, including neutrophils, endothelial cells, breast cancer cells, and ovarian cancer cells [28]. We found that LY294002 reduced the proliferation of the esophageal cancer cell line in vitro. Importantly, a cell line with a PIK3CA gene mutation was more susceptible to a PI3K inhibition than those without any such mutation. LY294002 inhibits PI3K directly, but not Akt. Two mechanisms may explain the inhibitory effects of LY294002 on cancer cell proliferation. One is that LY294002 inhibits the cell cycle progression, thus inducing specific G1 arrest, leading to an inhibition of cell proliferation [28]. The second possibility is that LY294002 increases apoptosis of esophageal cancer. Ras was found to protect cells from apoptosis through the activation of protein kinase B/Akt via PI3K, LY294002, by inhibiting the PI3K activity, thereby blocking the signal transduction pathway, which in turn may inhibit Ras-mediated protection from apoptosis in esophageal cancer [29]. Despite the potential value of inhibiting Akt and concerted efforts by industry and academia to develop Akt inhibitors, no small Akt inhibitors have yet been established. These findings indicate that the PI3K-Akt pathway may have a pivotal role in tumor progression, and it may thus be associated with other pathways (MAPK pathway, caspase cascade, etc.) The pan-PI3K inhibitor LY294002 completely inhibited PI3K activity associated with IRS complexes. The Foukas study results demonstrated an unexpected specificity in IRS signaling, with the selective recruitment and activation of p110␣ to IRS complexes in metabolic tissues. The existence of major signaling cassette composed of p110␣ and IRS proteins in both growth factor and metabolic signaling may account for the observation that only p110␣ is commonly mutated or overexpressed in cancer cell lines, thus passively leading to the selective activation of the pathways involved in cell growth and metabolism [30]. Collectively, our present study suggests that the PI3K pathway maybe a target for the treatment of esophageal squamous cell carcinoma with an alteration in the PIK3CA gene. ACKNOWLEDGMENTS The authors thank Ms. Shinobu Makino for her excellent technical assistance. This work was supported by the Grant-in-aid for Science Research (No. 19790949) from the Ministry of Education, Culture, Sports, Science and Technology.

REFERENCES 1.

Karakas B, Bachman KE, Park BH. Mutation of the PIK3CA oncogene in human cancers. Br J Cancer 2006;94:455.

326

JOURNAL OF SURGICAL RESEARCH: VOL. 145, NO. 2, APRIL 2008

2.

Samuels Y, Wang Z, Bardelli A, et al. High frequency of mutations of the PIK3CA gene in human cancers. Science 2004;304.

highly sensitive and fast TaqMan PCR assay. Lung Cancer 2005;50:375.

3.

Bachman KE, Argani P, Samuels Y, et al. The PIK3CA gene is mutated with high frequency in human breast cancers. Cancer Biol Ther 2004;3:772.

17.

Sasaki H, Endo K, Konishi A, et al. EGFR mutation status in Japanese lung cancer patients: Genotyping analysis using LightCycler. Clin Cancer Res 2005;11:2924.

4.

Lee JW, Soung YH, Kim SY, et al. PIK3CA gene is frequently mutated in breast carcinomas and hepatocellular carcinomas. Oncogene 2005;24:1477.

18.

Pals G, Young C, Mao HS, et al. Detection of a single base substitution in a single cell using the LightCycler. J Biochem Biophys Methods 2001;47:121.

5.

Campbell IG, Russell SE, Choong DY, et al. Mutation of the PIK3CA gene in ovarian and breast cancer. Cancer Res 2004; 64:7678.

19.

Heid CA, Stevens J, William PM. Real time quantitative PCR. Genome Res 1996;6:986.

20.

6.

Broderick DK, Di C, Parrett TJ, et al. Mutations of PIK3CA gene in anaplastic oligodendrogliomas, high-grade astrocytomas, and medulloblastomas. Cancer Res 2004;64:5048.

Li VS, Wong CW, Chan TL, et al. Mutations of PIK3CA in gastric adenocarcinoma. BMC Cancer 2005;5:29.

21.

Ikenoue T, Kanai F, Hikiba Y, et al. Functional analysis of PIK3CA gene mutations in human colorectal cancer. Cancer Res 2005;65:4562.

7.

Wang Y, Helland A, Holm R, et al. PIK3CA mutation in advanced ovarian carcinomas. Hum Mutant 2005;25:322.

22.

8.

Kang S, Bader AG, Vogt PK. Phosphatidylinositol 3-kinase mutations identified in human cancer are oncogenic. Proc Natl Acad Sci USA 2005;102:802.

Kang S, Bader AG, Vogt PK. Phosphatidylinositol 3-kinase mutations identified in human cancer are oncogenic. Proc Natl Acad Sci USA 2005;102:802.

23.

9.

Phillips WA, Russell SE, Ciavarell ML, et al. Mutation analysis of PIK3CA and PIK3CB in esophageal cancer and Barrett’s esophagus. Int J Cancer 2006;118:2644.

Samuel Y, Dia LA, Jr., Schmidt-Kittler N. Mutant PIK3CA promote cell growth and invasion of human cancer cells. Cancer Cell 2005;7:561.

24.

10.

Wittwer CT, Herrmann MG, Moss AA, et al. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 1997;22:130.

Bader AG, Kang S, Vogt PK. Cancer-specific mutations in PIK3CA are oncogenic in vivo. Proc Natl Acad Sci USA 2006; 103:1475.

25.

11.

Wittwer CT, Reed GB, Ririe KM. Rapid cycle amplification. In: The Polymerase Chain Reaction. Mullis KB, Ferre F, Gibbs RA, Eds. Boston: Birkhauser, 1994;174.

Sugita M, Tanaka N, Davidson S, et al. Molecular definition of a small amplification domain within 3q26 in tumors of cervix, ovary, and lung. Cancer Genet Cytogenet 2000;117:9.

26.

12.

Pals G, Pindolia K, Worsham MJ. A rapid and sensitive approach to mutation detection using real-time polymerase chain reaction and melting curve analyses, using BRCA1 as an example. Mol Diagn 1999;4:241.

Chujo M, Noguchi M, Miura T, et al. Comparative genomic hybridization analysis detected frequent overrepresentation of chromosome 3q in squamous cell carcinoma of the lung. Lung Cancer 2002;38:23.

27.

13.

Wittwer CT, Ririe M, Andrew V, et al. The LightCycler: A microvolume multi-sample fluorimeter with rapid temperature control. Biotechniques 1997;22:176.

Racz A, Brass N, Heckel D, et al. Expression analysis of genes at 3q26-q27 involved in frequent amplification in squamous cell lung carcinoma. Eur J Cancer 1999;35:641.

28.

14.

Whyte DB, Holbeck SL. Correlation of PIK3CA mutations with gene expression and drug sensitivity in NCI-60 cell lines. Biochem Biophys Res Commun 2006;340:469.

Limin Hu, Charles Zaloudek, et al. In vivo and in vitro ovarian carcinoma growth inhibition by a phosphatidylinositol 3-kinase inhibitor (LY294002). Clin Cancer Res 2000;6:880.

29.

15.

Qiu W, Schönleben F, Li X, et al. PIK3CA mutations in head and neck squamous cell carcinoma. Clin Cancer Res 2006;12:1441.

Downward J. Ras signaling and apoptosis. Curr Opin Genet Dev 1988;1:49.

30.

16.

Endo K, Konishi A, Sasaki H, et al. Epidermal growth factor receptor gene mutation in non-small cell lung cancer using

Foukas LC, Claret M, Pearce W, et al. Critical role for the p110␣ phosphoinositide-3-OH kinase in growth and metabolic regulation. Nature 2006;441:366 –70.