- Email: [email protected]
Pioglitazone downregulates Twist-1 expression in the kidney and protects renal function of Zucker diabetic fatty rats
Biomedicine & Pharmacotherapy 118 (2019) 109346
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Original article
Pioglitazone downregulates Twist-1 expression in the kidney and protects renal function of Zucker diabetic fatty rats Zijian Wanga, Qingbo Liua, Wendi Daid, Bing Huaa, Hongwei Lia,b,c, Weiping Lia,c,
T
⁎
a
Department of Cardiology, Cardiovascular Center, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, PR China Department of Internal Medicine, Medical Health Center, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, PR China c Beijing Key Laboratory of Metabolic Disorder Related Cardiovascular Disease, Beijing 100069, PR China d Department of Nephrology, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Diabetic nephropathy PPAR-γ Pioglitazone Twist-1 Renal fibrosis ZDF
Aims: Renal interstitial fibrosis and glomerulosclerosis are the characteristic presentation of diabetic nephropathy progression. Twist-1 overexpression contributes to renal fibrosis. Previous studies have demonstrated that pioglitazone (PIO), a PPAR-γ agonists, can ameliorate renal fibrosis and protect renal function. However, whether PIO attenuates renal fibrosis and delays diabetic nephropathy progression by regulating Twist-1 expression remains unclear. Methods: Male Zucker diabetic fatty (ZDF) rats were randomly divided into 3 groups: (1) ZDF group, (2) ZDF + PIO group treated with PIO for 10 weeks, (3) ZDF + PIO + GW9662 group treated with GW9662 (a PPAR-γ antagonist) and PIO for 10 weeks. Age-matched Zucker lean rats (ZL group) were used as a control group. Urinary albumin/creatinine ratio (UACR) and renal blood flow were measured. Renal histopathology and Twist-1 expression were determined by immunohistochemistry. The protein and mRNA levels of Twist-1 and PPAR-γ were analyzed by Western blot and qRT-PCR. Results: PIO considerably reduced UACR and improved renal blood flow. This was associated with amelioration of glomerulosclerosis and tubulointerstitial fibrosis evidenced by the expression decrease of collagen I, aquaporin 1, α-SMA, transforming growth factor β1 and nephrin, although glycaemia remained high. Moreover, Twist-1 protein and mRNA expression in kidney of ZDF rats were significantly increased compared with ZL rats and PIO significantly decreased Twist-1 levels. Conclusions: This study shows that PIO can downregulate Twist-1 expression in the kidney, inhibit renal fibrosis and protect renal function in ZDF rats. These PIO-mediated effects are independent of glycemic control.
1. Introduction Diabetic nephropathy is the main cause of end stage kidney disease and creates heavy healthcare burdens globally [1]. It is well known that renal interstitial fibrosis, particularly tubulointerstitial fibrosis, and glomerulosclerosis are the characteristic presentation of diabetic nephropathy progression and contributes substantially to renal function deterioration [2]. Therefore, effective control of renal fibrosis may be the key to prevent and manage diabetic nephropathy. Peroxisome-proliferator-activated receptors (PPARs) are nuclear receptors consisting of three PPAR isoforms: PPAR-α, PPAR-β, and PPAR-γ [3]. PPAR-γ is involved in regulating glucose and lipid metabolism. Mutations in PPAR-γ lead to abnormal lipid and glucose metabolism, which are related to type 2 diabetes mellitus and obesity [4].
PPAR-γ agonists, thiazolidinediones, such as pioglitazone (PIO) and rosiglitazone, are often used in patients with diabetes to prevent cardiovascular and renal complications [5]. A previous meta-analysis has found that P121A polymorphism in the PPAR-γ gene is closely associated with a reduced risk of albuminuria in patients with type 2 diabetes [6]. The beneficial effect of PPAR-γ agonist in diabetic nephropathy have been proved in multiple clinical trials and in vitro and in vivo studies [7–11]. However, the mechanisms underlying PPAR-γ agonist-mediated beneficial effects remain unclear. Furthermore, GW9662 (2-chloro-5-nitrobenzanilide) was identified from a high throughput screen of the corporate compound collection for PPAR-γ ligands and is a potent and selective antagonist of full length PPAR-γ. Scintillation proximity assays showed that GW9662 was 10-fold and 600-fold more potent at inhibiting radioligand binding to PPAR-γ
⁎ Corresponding author at: Department of Cardiology, Cardiovascular Center, Beijing Friendship Hospital, Capital Medical University, 95 Yongan Road, Xicheng, Beijing 100050, PR China. E-mail address: [email protected] (W. Li).
https://doi.org/10.1016/j.biopha.2019.109346 Received 4 June 2019; Received in revised form 25 July 2019; Accepted 7 August 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/).
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
nitrogen and stored at −80 °C for real-time RT-PCR and Western blot.
versus PPAR-α or PPAR-δ, respectively [12]. As the antagonistic activity of GW9662 toward PPAR-γ is retained in cell culture systems, this compound is thought to be a useful tool for elucidation of the role of PPAR-γ in biological processes. Twists (Twist-1 and Twist-2) were originally isolated from Drosophila, and Twist proteins are evolutionarily conserved from Drosophila to vertebrates [13]. A previous study has indicated that Twist-1 might be involved in many fibrotic diseases [14]. In the kidney of mice with unilateral ureteral obstruction (UUO), Twist expression is elevated in the tubular epithelium of the tubules and interstitial areas [15]. A recent study has shown that Twist-1 prolonged transforming growth factor-β1 (TGF-β1)-induced G2 arrest of tubular epithelial cells (TECs) and accelerated epithelial mesenchymal transition (EMT), and the deletion of Twist-1 gene in proximal TECs inhibited EMT and ameliorated renal interstitial fibrosis [16]. These findings suggest that Twist-1 may play a critical role in renal fibrosis development. To the best of our knowledge, few studies investigate renal Twist-1 expression in an animal model of type 2 diabetes and the effects of PIO on renal Twist-1 expression, although a recent report indicated a possible interaction between Twist-1 and PPAR-γ in 3T3-L1 mature adipocytes [17]. In the current study, we hypothesized that PIO, an agonist of PPARγ, might alleviate tubulointerstitial fibrosis and glomerulosclerosis, prevent diabetic nephropathy development, and preserve renal function through downregulation of Twist-1 expression in the kidneys of Zucker diabetic fatty (ZDF) rats, a popular animal model of obese type 2 diabetes.
2.3. Measurement of physiological parameters Systolic and diastolic blood pressure were measured in conscious animals at baseline and then weekly by tail-cuff plethysmography. For plasma glucose measurement, rat blood was withdrawn from the lateral tail vein after a 6-h fasting period. Twenty-four-hour urine was collected in metabolic cages at the end of experiment. The fasting blood glucose, urinary albumin, and urinary creatinine were measured using an automatic biochemistry analyzer (Siemens, Germany) in the laboratory of Beijing Friendship Hospital of Capital Medical University. Urinary albumin excretion was expressed as albumin/creatinine ratio (ACR). 2.4. Ultrasound imaging Rats were placed in a supine position on the ultrasound imaging system (VisualSonics, Canada). Depilatory was used to remove abdominal fur, and ultrasound acoustic gel was used as a coupling fluid between the real-time micro-visualization scanhead and the skin. Ultrasound imaging was performed using the Vevo Lab system (VisualSonics, Canada). The MS250 transducer (13–24 MHz) was positioned and fixed by a dedicated arm (VisualSonics, Canada). Renal blood flow was measured by a transversal scan of the right kidney using a color-Doppler in Vevo2100 Imaging System (FUJIFILM VisualSonic, United States). We used a PW-Doppler to measure systolic peak velocity of the renal artery. The angle correction was set between 30° and 60°. The waveforms have been optimized for the measurements using the lowest pulse repetition frequency without aliasing, the highest gain without obscuring background noise, and the lowest wall filter. A spectrum was considered if 3–5 consecutive similar-appearing waveforms were noted. The pulsatility index (PI) (peak systolic frequency shift–minimum diastolic frequency shift)/ mean frequency shift) or resistive index (RI) (peak systolic frequency shift–minimum diastolic frequency shift)/ peak systolic frequency shift) was determined for each rat. This ultrasound imaging method to measure renal blood flow of rats was reported previously [20].
2. Materials and methods 2.1. Animals and treatment Seven-eight-week old male ZDF rats (fa/fa) and age-matched Zucker lean rats (fa/-, ZL) were obtained from Charles River Laboratories (Beijing, China). A total of 24 rats were housed in the animal care facility at Beijing Friendship Hospital. The rats were maintained at 21 t 2 °C and 12-h day/night cycle and had free access to food and water at all times. The ZDF rats were fed with Purina 5008 chow (Richmond, USA) from the age of 8 weeks old to the age of 10–12 weeks old; and their blood glucose levels increased gradually. When their blood glucose levels reached ≥12 mmol/L, the rats were considered to be diabetic [18], and then they were fed with a regular chow (13 kcal% fat) diet until the end of the experiment. The ZL rats received a regular chow diet during the whole experiment. The ZDF rats were randomly divided into the following three groups: ZDF group (n = 6); ZDF + PIO group (PIO: a PPAR-γ agonists, 10 mg/kg/d by intragastric administration, n = 6); ZDF + PIO + GW9662 group (PIO: 10 mg/kg/d by intragastric administration; GW9662: a PPAR-γ antagonist, 1 mg/kg/d by intraperitoneal injection, n = 6) [19]. As we know, GW9662 is a full antagonist of PPAR-γ in cell-based reporter assays and often used to elucidate the role of PPAR-γ in biological processes We aimed to investigate whether the effects of PIO on ZDF rats are reversed when combined with GW9662 which greatly inhibit the activity of PPAR-γ. Treatment started after 2 weeks of acclimatization and lasted for 10 weeks. The study protocols were performed in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and approved by the Animal Care and Use Committee of Capital Medical University.
2.5. Immunohistochemistry Paraffin embedded tissue sections were subjected to immunohistochemical assays as the recent report [21]. The sections were probed with the primary antibodies against collagen I (sigma, United States), aquaporin 1 (AQP-1) (sigma, United States), α-smooth muscle actin (α-SMA) (Abcam, United Kingdom), TGF-β1 (sigma, United States), nephrin (sigma, United States), and Twist-1(sigma, United States). The secondary antibody was biotinylated goat anti-rabbit IgG. Images were captured and analyzed using the IMS imaging processing system (Shanghai Jierdun Biotech, China). Positively stained regions were identified. The sections were also stained with Masson’s trichrome and hematoxylin and eosin stain. We used the image analysis software Image-Pro Plus version 6.0 (Media Cybernetics, United States) to quantitively evaluate the stained tissue sections and assessed 20 randomly selected consecutive microscopic fields for each kidney tissue section. 2.6. Western blot analysis
2.2. Rat kidney specimen isolation and storage
Tissue pieces from the middle region of the frozen left kidney samples were used for Western blot analysis. Total tissue proteins were extracted. Protein samples (20–30 μg) were separated on 10% SDSPAGE gels and then transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were incubated with the primary antibodies against Twist-1 (sigma, United States), PPAR-γ (Santa Cruz, United States), and β-actin (sigma, United States) overnight at 4 °C,
Rats were anesthetized with an intraperitoneal injection of chloral hydrate (10%, 3 mL/kg). Under anesthesia, both kidneys from each rat were carefully removed. The right kidneys were fixed in 4% paraformaldehyde and embedded in paraffin for histochemical and immunohistochemical staining, and the left kidneys were frozen in liquid 2
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
ZDF + PIO and ZDF + PIO + GW9662 rats were significantly higher than that of ZL rats (All P < 0.05). Systolic and diastolic blood pressure were similar between ZDF and ZL rats. The ZDF rats had significantly higher fasting blood glucose levels than the ZL rats (22.1 ± 1.63 mmol/L vs. 6.8 ± 0.39 mmol/L, P < 0.05), while the fasting blood glucose levels showed no significant difference among ZDF, ZDF+PIO, and ZDF+PIO+GW9662 rats. ZDF rats had significantly higher UACR than ZL rats (402.1 ± 46.52 mg/g vs. 29.1 ± 3.22 mg/g, P < 0.05). Treatment with PIO significantly reduced UACR compared with ZDF (402.1 ± 46.52 mg/g vs. 85.9 ± 5.04 mg/g, P < 0.05). Higher RI and PI were observed in ZDF rats when compared with the ZL rats (P < 0.05). ZDF+PIO group had significantly lower RI and PI than ZDF group (P < 0.05), while RI and PI remained high after combined treatment with PIO and GW9662. These data indicate that PIO can improve renal blood flow and reduce albuminuria. These effects are independent of glycemic control.
washed thoroughly, and then incubated with an HRP-conjugated secondary antibody at room temperature for 1 h. The protein bands were detected with a Western Blotting Imaging System (Clinx Science Instruments Co, China). 2.7. RNA extraction and real-time reverse transcription–polymerase chain reaction (real-time RT-PCR) Total RNA of kidney tissue samples was extracted by using Trizol reagent following the manufacturer’s instructions (Invitrogen, United States). Reverse transcription was performed using MMLV (GIBCO, United States) and 100 ng of total RNA sample from each rat kidney tissue specimen was used for the reverse transcription. PCR of samples in triplicate in 50 μL reaction volume was run in the ABI PRISM 5700 sequence detector system (Applied Bio systems, United States) at the following conditions: 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of 95 °C for 20 s and 60 °C for 30 s, followed by a melting curve stage of 95 °C for 15 s, 60 °C for 30 s and 95 °C for 15 s. The primer sequences used in this study are: Twist-1 5’ - GCATGCATTCTCAAGA GGT - 3’ and 5’- CAGTTTGATCCCAGCGTTTT - 3’, PPAR-γ 5’ - GACCA CTCCCATTCCTTTGA- 3’ and 5’ - AACCATTGGGTCAGCTTG - 3’, β-actin 5’ - CGTTGACATCCGTAAAGACC - 3’ and 5’ - CTAGGAGCCAGGGCAG TAATC - 3’. Melting curve analyses of all real-time RT-PCR products showed a single DNA duplex. Relative quantitation values were calculated using the 2(-Delta Delta C(T)) method. The amount of each target gene was subsequently divided by the amount of internal control gene β-actin to obtain a normalized value. Three different experiments were performed for each experimental condition.
3.2. Treatment with PIO reduces glomerulosclerosis and tubulointerstitial fibrosis in the ZDF rats Masson trichrome staining revealed that collagen deposition, which is an indicator of tubulointerstitial fibrosis, was substantially higher in the ZDF group than in the ZL group, and PIO significantly reduced the staining intensity, suggesting reduction in collagen deposition (Fig. 1). The additional treatment with GW9662 reversed this change. Moreover, we can see a similar trend among tubular atrophy and interstitial fibrosis (Fig. 1). Collagens I expression was evaluated by immunohistochemistry to further assess collagen deposition. Collagen I expression (Fig. 2A) was increased significantly in the ZDF group compared with the ZL group (30.12 ± 3.063% vs. 5.74 ± 1.872%, P < 0.05) and reduced significantly by PIO (30.12 ± 3.063% vs. 15.42 ± 1.175%, P < 0.05, Table 1). GW9662 significantly reversed the PIO-mediated reduction in collagen I expression (15.42 ± 1.175% vs 37.78 ± 5.332%, P < 0.05) (Table 1). AQP is closely associated with water balance disorder [22]. Inhibition of inflammation could attenuate renal AQP expression loss in rats [23]. In our study, we found that AQP-1 expression (Fig. 2B) was significantly higher in ZL rats than in ZDF rats (29.1 ± 4.591% vs. 4.7 ± 1.365%, P < 0.05, Table 1). PIO significantly increased AQP-1 levels (23.8 ± 2.897% vs. 4.7 ± 1.365%, P < 0.05) in ZDF rats to the similar levels of ZL rats (29.1 ± 4.591%), and additional GW9662 treatment significantly reversed the stimulatory effects of PIO on AQP-1 expression (9.6 ± 2.045% vs. 23.8 ± 2.897%, P < 0.05, Table 1) in
2.8. Statistical analysis All data were expressed as the mean ± standard deviation (SD) unless otherwise specified. Significant differences between groups were determined by one-way analysis of variance (ANOVA) for repeated measurements, followed by the Bonferroni multiple testing correction or the Dunn’s multiple comparison test by SPSS. P < 0.05 were considered statistically significant. 3. Results 3.1. Physiological parameters at the end of the study of each group As shown in Table 1, at 20 weeks of age, the body weight of ZDF,
Table 1 Physiological parameters and quantitative analysis of the immunohistochemical staining at end of the study. Group
ZL N=6
ZDF N=6
ZDF + PIO N=6
ZDF + PIO + GW9662 N=6
Body weight (g) Fasting blood glucose (mmol/L) SBP (mmHg) DBP (mmHg) UACR (mg/g) RI PI Col I (%)/cross section AQP-1 (%)/cross section α-SMA (%)/cross section TGF-β1 (%)/cross section Nephrin (%)/glomerulus
326.3 ± 3.93 6.8 ± 0.39 124.5 ± 3.22, 85.5 ± 1.962 29.1 ± 3.22 0.538 ± 0.0214 0.724 ± 0.0661 5.74 ± 1.872 29.1 ± 4.591 1.18 ± 0.342 4.23 ± 0.772 25.57 ± 3.888
417.5 ± 17.21* 22.1 ± 1.63* 130.2 ± 5.78 90.8 ± 3.851 402.1 ± 46.52* 0.758 ± 0.0737* 1.364 ± 0.2491* 30.12 ± 3.063* 4.7 ± 1.365* 13.51 ± 1.885* 27.27 ± 2.632* 8.72 ± 0.673*
405.1 ± 26.74* 19.1 ± 0.74* 112.3 ± 3.36# 72.8 ± 3.301# 85.9 ± 5.04# 0.538 ± 0.0387# 0.793 ± 0.0775# 15.42 ± 1.175*,# 23.8 ± 2.897# 7.56 ± 0.763*,# 8.33 ± 1.983# 20.81 ± 0.9063#
497.2 ± 10.76*,#,& 22.9 ± 1.63* 112.2 ± 4.21# 82.6 ± 4.088 210.2 ± 107.93* 0.795 ± 0.0419*,& 1.405 ± 0.1322*,& 37.78 ± 5.332*,& 9.6 ± 2.045*,& 17.35 ± 1.796*,& 21.31 ± 3.783*,& 8.51 ± 1.862*,&
Data are expressed as means ± SEM. Values are compared with each other using ANOVA followed by the Bonferroni multiple testing correction or the Dunn’s multiple comparison test by SPSS. SBP: systolic blood pressure; DBP: diastolic blood pressure; UACR: urinary albumin/creatinine ratio; RI: resistive index; PI: pulsatility index; Col I: collagen I; AQP-1: aquaporin 1; α-SMA: α-smooth muscle actin; TGF-β1: transforming growth factor β1. * P < 0.05, versus ZL group. # P < 0.05, versus ZDF group. & P < 0.05, versus ZDF+PIO group. 3
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
Fig. 1. Representative images of Masson’s trichrome staining. Kidney tissue sections were stained by Masson’s trichrome method. Single arrows indicate collagen deposition. Representative images of the ZDF, ZDF + PIO, ZDF + PIO + GW9662 and ZL groups are presented. We can see collagen deposition was substantially higher in the ZDF group than in the ZL group, and PIO significantly reduced the staining intensity. The additional treatment with GW9662 reversed this change. A similar trend was obsreved in tubular atrophy and interstitial fibrosis. Magnification: ×200. Bar =100 μm.
3.3. Pioglitazone reduced Twist-1 expression in the kidneys of ZDF rats
ZDF rats. We also found that α-SMA expression was increased significantly in the renal interstitium and periglomerular areas of the ZDF rats (Fig. 2C) compared with the ZL rats (13.51 ± 1.885% vs. 1.18 ± 0.342%, P < 0.05, Table 1). PIO treatment reduced α-SMA expression significantly compared with the ZDF rats (7.56 ± 0.763% vs. 13.51 ± 1.885%, P < 0.05), and GW9662 treatment reversed this PIO-mediated effects (17.35 ± 1.796% vs. 7.56 ± 0.763%, P < 0.05, Table1). TGF-β1 is one of the key profibrotic factors, particularly in chronic kidney disease. The TGF-β1 levels in the glomeruli, renal interstitium, and tubular epithelium were significantly lower in the ZL group than in the ZDF group (4.23 ± 0.772% vs. 27.27 ± 2.632%, P < 0.05, Table 1). PIO reduced TGF-β1 levels of the ZDF rats significantly (8.33 ± 1.983% vs. 27.27 ± 2.632%, P < 0.05, Table 1), and GW9662 reversed the PIO-mediated reduction in TGF-β1 levels (21.31 ± 3.783 vs. 8.33 ± 1.983%, P < 0.05) (Table 1 and Fig. 2D). Immunohistochemistry also revealed that nephrin expression was decreased significantly in the glomeruli of ZDF rats compared with the ZL rats (8.72 ± 0.673 vs. 25.57 ± 3.888, P < 0.05), while PIO treatment increased nephrin levels significantly (20.81 ± 0.9063 vs. 8.51 ± 1.862, P < 0.05). GW9662 treatment significantly reversed the effects of PIO and reduced the nephrin levels to those of the ZDF rats (Table1).
Twist-1 was sparsely expressed in the tubular of ZL rats, and no Twist-1 specific staining was detected in the Bowman's capsule (Fig. 3). However, in the ZDF group, Twist-1 expression was remarkably increased in the intertubular areas, and tubular areas, although sparsely distributed in the glomerulus and vascular wall. In these areas, fibroblast cells and TECs were intensely stained with anti-Twist-1 antibody, whereas we did not clearly identify Twist-1 expression in the glomerular cells. In the ZDF + PIO group, only a few TECs slightly expressed Twist-1 (Fig. 3). ZDF + PIO + GW9662 rats expressed high levels of Twist-1 in the interstitial and tubular areas (Fig. 3). To confirm PPAR-γ protein expression in the kidneys of ZDF rats, we performed Western blot. As shown in Fig. 4A and C, PPAR-γ expression was reduced significantly (P < 0.05) in the kidney tissues isolated from ZDF rats as well as in the kidney tissues from ZDF+PIO+GW9662 rats compared with ZL rats. In ZDF+PIO group, PPAR-γ expression was increased significantly compared with ZDF rats (P < 0.05). The results from real-time RT-PCR were consistent with the results of the Western blot analysis (Fig. 4D). Twist-1 protein expression in the kidney was significantly increased in the ZDF rats (Fig. 4B). PIO treatment significantly decreased Twist-1 levels by 57%. The additional treatment with GW9662 increased Twist1 expression by over 1.8-fold compared with ZDF + PIO group (Fig. 4B and C). We further analyzed Twist-1 mRNA levels of each group by real4
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
Fig. 2. Representative images of immunohistochemical staining for Collagen I, TGF-β1, AQP-1 and α-SMA. (A) Collagen I expression was increased significantly in the ZDF group compared with the ZL group and reduced significantly by PIO. GW9662 reversed the PIOmediated reduction in collagen I expression. (B) AQP-1 expression was significantly higher in ZL rats than in ZDF rats. PIO significantly increased AQP-1 levels in ZDF rats to the similar levels of ZL rats, and additional GW9662 treatment reversed the stimulatory effects of PIO on AQP-1 expression in ZDF rats. (C) α-SMA expression was increased significantly in the renal interstitium and periglomerular areas of the ZDF rats compared with the ZL rats. PIO reduced α-SMA expression, and GW9662 treatment reversed this PIO-mediated effects. (D) TGF-β1 levels in the glomeruli, renal interstitium, and tubular epithelium were significantly lower in the ZL group than in the ZDF group. PIO reduced TGF-β1 levels of the ZDF rats, and GW9662 reversed the PIO-mediated reduction in TGF-β1 levels. Single arrows show target protein positive cells or area. Representative pictures of tissue sections immunostained for each protein. (A) Collagen I, Magnification: × 100, Bar =200 μm; (B) TGFβ1, Magnification: × 400, Bar =50 μm; (C) AQP-1, Magnification: ×400, Bar =50 μm; (D) α-SMA, Magnification: × 400, Bar =50 μm.
distinct tubulointerstitial fibrosis and glomerulosclerosis. PIO, a PPAR-γ agonist, significantly inhibited renal fibrosis, improved renal blood flow and rapidly reduced albuminuria. These beneficial effects may be due to PIO-mediated downregulation of Twist-1 expression. Our results support that PPAR-γ activation could prevent or slow down the progression of diabetic nephropathy, particularly at early stage. The pathology of type 2 diabetes-associated nephropathy is characterized by excessive extracellular matrix deposition, glomerular basement membrane thickening, vessel proliferative changes, and tubular atrophy, ultimately resulting in interstitial fibrosis and glomerulosclerosis [24]. Numerous molecular and cellular mechanisms are associated with these pathological changes in the kidney, such as oxidative stress, inflammation, release of profibrotic factors especially TGF-β1, collagen cross-linking, and EMT [25]. Nevertheless, the exact
time RT-PCR. Consistent with the results from Western blot, ZDF rats expressed significantly higher mRNA levels than ZL rats (Fig. 4E). Treatment with PIO significantly decreased Twist-1 mRNA expression to the levels of ZL rats. The combination of PIO and GW9662 reversed the effects of PIO on Twist-1 mRNA expression (Fig. 4E). 4. Discussion Albuminuria and renal fibrosis are the two main features of incipient diabetic nephropathy. In this study, we investigated the involvement of Twist-1 and PPAR-γ pathway in the development of diabetic nephropathy in ZDF rat, a popular animal model of type 2 diabetes. Our main findings demonstrated that Twist-1 expression was significantly increased in the kidney of ZDF rat accompanied with 5
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
Fig. 3. Immunohistochemical staining for Twist-1. (A) Twist-1 was sparsely expressed in the tubular of ZL rats, and was not Twist-1 specific staining was detected in the Bowman's capsule. However, in the ZDF group, Twist-1 expression was remarkably increased in the Bowman’s capsule, intertubular areas, and tubular areas, although sparsely distributed in the vascular wall. Single arrows show Twist-positive cells in tubular areas. Double arrows show Twist-positive cells in Bowman’s capsule. In the ZDF + PIO group, only a few tubular epithelial cells slightly expressed Twist1. ZDF + PIO + GW9662 rats expressed high levels of Twist-1 in the interstitial and tubular areas. Magnification: × 400, Bar =50 μm. (B) IOD/area of Twist-1 was determined by Quantitative image analysis of the immunohistochemistry.
contribute to the initiation and the progression of diabetic nephropathy [38]. PPAR-γ activation can remarkably protected against aldosteroneinduced podocyte injury via restoration of mitochondrial function [39]. Several in vivo and in vitro studies illustrated the beneficial effects of PPAR-γ agonist in diabetic nephropathy [7–11]. The decreasing trend of glucose was observed after 10 weeks of PIO treatment in our study, however, the effect was not significant. The reason for this could be due to the dosage and time of PIO treatment. For the insulin-resistant nature of the type 2 diabetic rats, obtaining tight glucose control was rather difficult. The main action of PIO, as with other TZDs, is the reconstitution of fatty tissue, so its effects on glycemia occur slowly [40]. Eom used higher dose of PIO (30 mg/kg/d) in ZDF group. From week 2 to week 5, blood glucose levels were found to be significantly lower than in the untreated groups [41]. In a recent study, ZDF rats receiving 5 weeks of the same dose of PIO were also poorly controlled [42]. Despite the maintainance of hyperglycaemia, we still found that PIO reduced UACR, improved renal perfusion, protected renal function, and suppressed renal fibrosis, indicating that all these benefits of PIO were independent of glycemic control. To clarify the underlying mechanism, we investigated the impact of PIO on Twist-1 expression in ZDF rats. As a result, our study showed that PIO downregulated Twist-1 protein and gene expression, and additional treatment with GW9662, a PPAR-γ antagonist, reversed the PIO-mediated inhibition on Twist-1 expression and suppression on diabetic nephropathy progression. Notably, our results are inconsistent with the findings from a previous study. Ren found that PIO upregulated Twist-1 expression and a PPAR-γ antagonist (T0070907) downregulated Twist-1 expression in 3T3-L1 mature adipocytes [17]. The opposite effects of PIO on Twist-1 could be related to possible diverse functions of PPAR-γ and Twist-1 in different types of tissues and cells, such as preadipocytes and adipocytes. Moreover, we found that Twist-1 was abundantly expressed in TECs, but only minimally expressed in glomerular cells of ZDF rats. Otherwise, Yujiro reported the expression level of Twist was remarkably increased in the intertubular areas and the Bowman’s capsule and many cells in glomerulus also expressed Twist in UUO model [15]. The discrepancy between the two studies seemed to be mainly related to the different models investigated. In addition to, ZDF rats fed with regular chow in our study didn’t have very high blood glucose and were at early stage of diabetic nephropathy. Hempe reported that ZDF rats at 35 weeks of age fed with Purina 5008 diet showed moderate to marked pathological changes in glomeruli and tubuli similar to those seen in human diabetic nephropathy [43]. Up to now, the underlying signaling pathway of PIO-mediated downregulation of Twist-1 expression in
mechanism underlying diabetic nephropathy is still not fully elucidated. A recent study found the involvement of Twist-1 in renal fibrosis [16]. Twist-1 is a member of the Twist family of basic helix–loop–helix transcription factors and was originally found in Drosophila [13]. Apart from serving as a master regulator of embryonic morphogenesis, Twist1 contributes to the EMT process and plays essential roles in metastasis and fibrosis. A growing number of studies have demonstrated that Twist-1 is involved in many fibrotic diseases, including pulmonary, oral submucous, peritoneal membrane tissues and biliary fibrosis [26–30]. More recently, the role of Twist-1 in renal fibrosis has attracted considerable attention. In 2007, Kida Y first reported that Twist-1 expression was elevated in the kidney of UUO mouse models and mainly expressed in the tubular epithelia of the expanded tubules and interstitial areas. This study showed that Twist-1 is related to tubular EMT, myofibroblast proliferation and subsequent fibrosis in obstructed kidneys [15]. Furthermore, in mouse models of UUO-induced renal fibrosis, conditional deletion of Twist-1 in proximal TECs resulted in inhibition of the EMT program and the maintenance of TEC integrity, while also restoring cell proliferation, dedifferentiation-associated repair and regeneration of the kidney parenchyma and attenuating interstitial fibrosis. The underlying molecular mechanism is likely that Twist1 promotes prolonged TGF-β1-induced G2 arrest of TECs, limiting the repair and regeneration of TECs. In addition, a few studies have demonstrated that Twist-1 plays an critical role in hypoxia-induced EMT in a HIF-1α-dependent manner in renal fibrosis [31–33]. However, the expression of Twist-1 in kidney of ZDF rat is still unclear. In our current study, we found that Twist-1 was sparsely expressed in the tubular and no specific staining of Twist-1 was detected in the Bowman's capsule of ZL rats. In ZDF rats, Twist-1 was distributed in the renal arteriole wall and was remarkably overexpressed in the Bowman’s capsule, intertubular and tubular areas. Moreover, the Twist-1 overexpression was accompanied by obvious tubulointerstitial fibrosis and glomerulosclerosis in ZDF rats. Our results indicate that Twist-1 might participate in the development of diabetic nephropathy. PIO can selectively bind to and activate PPAR-γ and belongs to the thiazolidinedione (TZD) family. It has been commonly used as an adjunctive therapy to diet, exercise, and other medications to manage type 2 diabetes [34]. Despite many limitations, such as weight gain, increased risk for chronic edema or heart failure and elevated risk in bone fracture [35,36], PIO is an important antihyperglycemic agent to directly attenuate insulin resistance [37]. Mitochondrial dysfunction in the kidneys, especially in podocytes of patients with diabetes, may
6
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
Fig. 4. Protein and mRNA expression of Twist-1 and PPAR-γ in the kidney. (A, C) Compared to ZL rats, PPAR-γ expression was reduced significantly in ZDF rats and ZDF + PIO + GW9662 rats. PIO significantly increased PPAR-γ expression. (D) The results from real-time RT-PCR were consistent with the results of the Western blot analysis. (B, C) Twist-1 protein expression was significantly increased in the ZDF rats. PIO significantly decreased Twist-1 levels by 57%. The additional treatment with GW9662 increased expression by over 1.8-fold. (E) Real-time RT-PCR showed the similar results. The ZDF rats expressed significantly higher mRNA levels of Twist-1 than ZL rats while PIO significantly decreased Twist-1 expression to the levels of ZL rats. The combination of PIO and GW9662 reversed the effects of PIO on Twist-1 mRNA expression. The data are shown as means ± standard deviation (n = 6). *P < 0.05, versus ZL group; #P < 0.05, versus ZDF group; &P < 0.05, versus ZDF+PIO group.
7
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
kidney remains unclarified and requires further investigations.
Res. 15 (1987) 3439–3453. [14] Q.Q. Zhu, C. Ma, Q. Wang, Y. Song, T. Lv, The role of TWIST1 in epithelial-mesenchymal transition and cancers, Tumour Biol. 37 (2016) 185–197. [15] Y. Kida, K. Asahina, H. Teraoka, I. Gitelman, T. Sato, Twist relates to tubular epithelial-mesenchymal transition and interstitial fibrogenesis in the obstructed kidney, J. Histochem. Cytochem. 55 (2007) 661–673. [16] S. Lovisa, V.S. LeBleu, B. Tampe, H. Sugimoto, K. Vadnagara, J.L. Carstens, C.C. Wu, Y. Hagos, B.C. Burckhardt, T. Pentcheva-Hoang, H. Nischal, J.P. Allison, M. Zeisberg, R. Kalluri, Epithelial-to-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis, Nat. Med. 21 (2015) 998–1009. [17] R. Ren, Z. Chen, X. Zhao, T. Sun, Y. Zhang, J. Chen, S. Lu, W. Ma, A possible regulatory link between Twist 1 and PPARgamma gene regulation in 3T3-L1 adipocytes, Lipids Health Dis. 15 (2016) 189. [18] L. Cai, W. Li, G. Wang, L. Guo, Y. Jiang, Y.J. Kang, Hyperglycemia-induced apoptosis in mouse myocardium: mitochondrial cytochrome C-mediated caspase-3 activation pathway, Diabetes 51 (2002) 1938–1948. [19] P. Paragomi, R. Rahimian, M.H. Kazemi, M.H. Gharedaghi, A. Khalifeh-Soltani, S. Azary, A.N. Javidan, K. Moradi, S. Sakuma, A.R. Dehpour, Antinociceptive and antidiarrheal effects of pioglitazone in a rat model of diarrhoea-predominant irritable bowel syndrome: role of nitric oxide, Clin. Exp. Pharmacol. Physiol. 41 (2014) 118–126. [20] F. Iacobellis, T. Segreto, D. Berritto, F. Nettuno, S. Cozzolino, D. Di Napoli, M. Montella, R. Natella, S. Cappabianca, L. Brunese, R. Grassi, A rat model of acute kidney injury through systemic hypoperfusion evaluated by micro-US, color and PW-Doppler, Radiol. Med. (2018). [21] J.E. Toblli, G. DeRosa, G. Cao, P. Piorno, P. Pagano, ACE inhibitor and angiotensin type I receptor antagonist in combination reduce renal damage in obese Zucker rats, Kidney Int. 65 (2004) 2343–2359. [22] S.S. Adiyanti, T. Loho, Acute kidney injury (AKI) biomarker, Acta Med. Indones. 44 (2012) 246–255. [23] G. Yu, Q. Liu, X. Dong, K. Tang, B. Li, C. Liu, W. Zhang, Y. Wang, Y. Jin, Inhibition of inflammation using diacerein markedly improved renal function in endotoxemic acute kidney injured mice, Cell. Mol. Biol. Lett. 23 (2018) 38. [24] K. Umanath, J.B. Lewis, Update on diabetic nephropathy: core curriculum 2018, Am. J. Kidney Dis. 71 (2018) 884–895. [25] Y. Li, Y.S. Kang, C. Dai, L.P. Kiss, X. Wen, Y. Liu, Epithelial-to-mesenchymal transition is a potential pathway leading to podocyte dysfunction and proteinuria, Am. J. Pathol. 172 (2008) 299–308. [26] J. Yang, S.A. Mani, J.L. Donaher, S. Ramaswamy, R.A. Itzykson, C. Come, P. Savagner, I. Gitelman, A. Richardson, R.A. Weinberg, Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis, Cell 117 (2004) 927–939. [27] V. Pozharskaya, E. Torres-Gonzalez, M. Rojas, A. Gal, M. Amin, S. Dollard, J. Roman, A.A. Stecenko, A.L. Mora, Twist: a regulator of epithelial-mesenchymal transition in lung fibrosis, PLoS One 4 (2009) e7559. [28] R.S. Bridges, D. Kass, K. Loh, C. Glackin, A.C. Borczuk, S. Greenberg, Gene expression profiling of pulmonary fibrosis identifies Twist1 as an antiapoptotic molecular "rectifier" of growth factor signaling, Am. J. Pathol. 175 (2009) 2351–2361. [29] Y.H. Lee, L.C. Yang, F.W. Hu, C.Y. Peng, C.H. Yu, C.C. Yu, Elevation of Twist expression by arecoline contributes to the pathogenesis of oral submucous fibrosis, J. Formos. Med. Assoc. 115 (2016) 311–317. [30] L. He, M. Che, J. Hu, S. Li, Z. Jia, W. Lou, C. Li, J. Yang, S. Sun, H. Wang, X. Chen, Twist contributes to proliferation and epithelial-to-mesenchymal transition-induced fibrosis by regulating YB-1 in human peritoneal mesothelial cells, Am. J. Pathol. 185 (2015) 2181–2193. [31] S. Sun, X. Ning, Y. Zhang, Y. Lu, Y. Nie, S. Han, L. Liu, R. Du, L. Xia, L. He, D. Fan, Hypoxia-inducible factor-1alpha induces Twist expression in tubular epithelial cells subjected to hypoxia, leading to epithelial-to-mesenchymal transition, Kidney Int. 75 (2009) 1278–1287. [32] W. Bechtel, M. Zeisberg, Twist: a new link from hypoxia to fibrosis, Kidney Int. 75 (2009) 1255–1256. [33] M.H. Yang, D.S. Hsu, H.W. Wang, H.J. Wang, H.Y. Lan, W.H. Yang, C.H. Huang, S.Y. Kao, C.H. Tzeng, S.K. Tai, S.Y. Chang, O.K. Lee, K.J. Wu, Bmi1 is essential in Twist1-induced epithelial-mesenchymal transition, Nat. Cell Biol. 12 (2010) 982–992. [34] A.J. Garber, M.J. Abrahamson, J.I. Barzilay, L. Blonde, Z.T. Bloomgarden, M.A. Bush, S. Dagogo-Jack, R.A. DeFronzo, D. Einhorn, V.A. Fonseca, J.R. Garber, W.T. Garvey, G. Grunberger, Y. Handelsman, I.B. Hirsch, P.S. Jellinger, J.B. McGill, J.I. Mechanick, P.D. Rosenblit, G.E. Umpierrez, Consensus statement by the American Association of Clinical Endocrinologists and American College of Endocrinology on the comprehensive type 2 diabetes management algorithm – 2019 executive summary, Endocr. Pract. 25 (2019) 69–100. [35] S. Bolen, L. Feldman, J. Vassy, L. Wilson, H.C. Yeh, S. Marinopoulos, C. Wiley, E. Selvin, R. Wilson, E.B. Bass, F.L. Brancati, Systematic review: comparative effectiveness and safety of oral medications for type 2 diabetes mellitus, Ann. Intern. Med. 147 (2007) 386–399. [36] A.V. Schwartz, D.E. Sellmeyer, E. Vittinghoff, L. Palermo, B. Lecka-Czernik, K.R. Feingold, E.S. Strotmeyer, H.E. Resnick, L. Carbone, B.A. Beamer, S.W. Park, N.E. Lane, T.B. Harris, S.R. Cummings, Thiazolidinedione use and bone loss in older diabetic adults, J. Clin. Endocrinol. Metab. 91 (2006) 3349–3354. [37] R.A. DeFronzo, D. Tripathy, D.C. Schwenke, M. Banerji, G.A. Bray, T.A. Buchanan, S.C. Clement, R.R. Henry, H.N. Hodis, A.E. Kitabchi, W.J. Mack, S. Mudaliar, R.E. Ratner, K. Williams, F.B. Stentz, N. Musi, P.D. Reaven, A.N. Study, Pioglitazone for diabetes prevention in impaired glucose tolerance, N. Engl. J. Med. 364 (2011) 1104–1115. [38] N. Stieger, K. Worthmann, B. Teng, S. Engeli, A.M. Das, H. Haller, M. Schiffer,
5. Conclusions In conclusion, we showed that Twist-1 was overexpressed significantly in the kidney of ZDF rats. PIO, a PPAR-γ agonist, decreased Twist-1 expression, rapidly reduced albuminuria, and partially suppressed renal fibrosis of ZDF rats. The renal protective effects of PIO were independent of glycemic control and may be associated with PIOmediated downregulation of Twist-1 expression. Our study suggests that PPAR-γ activation and subsequent inhibition of Twist-1 represents a potential anti-fibrosis therapy and might prevent diabetic nephropathy progression. Grants/Funding This research was supported by grants from the National Natural Science Foundation of China (Grant number: 81670315, 81300161) and the Beijing Municipal Administration of Hospital Incubating Program (Grant number: PX2018002). Declaration of Competing Interest The authors declared they do not have anything to disclose regarding conflict of interest with respect to the manuscript. Acknowledgements The authors would like to thank Min Cong (Department of hepatology, Beijing Friendship Hospital, Capital Medical University School) for her technical support, and Qing Xu (School of Biomedical Engineering, Capital Medical University School) for her support of Ultrasound. References [1] R. Rabkin, Diabetic nephropathy, Clin. Cornerstone 5 (2003) 1–11. [2] Y. Qian, E. Feldman, S. Pennathur, M. Kretzler, F.C. Brosius, 3rd, from fibrosis to sclerosis: mechanisms of glomerulosclerosis in diabetic nephropathy, Diabetes 57 (2008) 1439–1445. [3] S. Khurana, L.A. Bruggeman, H.Y. Kao, Nuclear hormone receptors in podocytes, Cell Biosci. 2 (2012) 33. [4] S. Swaminathan, S.V. Shah, Novel approaches targeted toward oxidative stress for the treatment of chronic kidney disease, Curr. Opin. Nephrol. Hypertens. 17 (2008) 143–148. [5] R.E. Buckingham, Thiazolidinediones: pleiotropic drugs with potent anti-inflammatory properties for tissue protection, Hepatol. Res. 33 (2005) 167–170. [6] S. De Cosmo, S. Prudente, O. Lamacchia, E. Lapice, E. Morini, R. Di Paola, M. Copetti, P. Ruggenenti, G. Remuzzi, O. Vaccaro, M. Cignarelli, V. Trischitta, PPARgamma2 P12A polymorphism and albuminuria in patients with type 2 diabetes: a meta-analysis of case-control studies, Nephrol. Dial. Transplant. 26 (2011) 4011–4016. [7] J.E. Toblli, M.G. Ferrini, G. Cao, D. Vernet, M. Angerosa, N.F. Gonzalez-Cadavid, Antifibrotic effects of pioglitazone on the kidney in a rat model of type 2 diabetes mellitus, Nephrol. Dial. Transplant. 24 (2009) 2384–2391. [8] Y.J. Lee, H.J. Han, Troglitazone ameliorates high glucose-induced EMT and dysfunction of SGLTs through PI3K/Akt, GSK-3beta, Snail1, and beta-catenin in renal proximal tubule cells, Am. J. Physiol. Renal Physiol. 298 (2010) F1263–1275. [9] T. Okada, J. Wada, K. Hida, J. Eguchi, I. Hashimoto, M. Baba, A. Yasuhara, K. Shikata, H. Makino, Thiazolidinediones ameliorate diabetic nephropathy via cell cycle-dependent mechanisms, Diabetes 55 (2006) 1666–1677. [10] Y.J. Liang, J.H. Jian, C.Y. Chen, C.Y. Hsu, C.Y. Shih, J.G. Leu, L-165,041, troglitazone and their combination treatment to attenuate high glucose-induced receptor for advanced glycation end products (RAGE) expression, Eur. J. Pharmacol. 715 (2013) 33–38. [11] J. Yang, Y. Zhou, Y. Guan, PPARgamma as a therapeutic target in diabetic nephropathy and other renal diseases, Curr. Opin. Nephrol. Hypertens. 21 (2012) 97–105. [12] L.M. Leesnitzer, D.J. Parks, R.K. Bledsoe, J.E. Cobb, J.L. Collins, T.G. Consler, R.G. Davis, E.A. Hull-Ryde, J.M. Lenhard, L. Patel, K.D. Plunket, J.L. Shenk, J.B. Stimmel, C. Therapontos, T.M. Willson, S.G. Blanchard, Functional consequences of cysteine modification in the ligand binding sites of peroxisome proliferator activated receptors by GW9662, Biochemistry 41 (2002) 6640–6650. [13] B. Thisse, M. el Messal, F. Perrin-Schmitt, The twist gene: isolation of a Drosophila zygotic gene necessary for the establishment of dorsoventral pattern, Nucleic Acids
8
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
K.W. Kim, K. Lee, B.J. Kim, Protective effects of vildagliptin against pioglitazoneinduced bone loss in type 2 diabetic rats, PLoS One 11 (2016) e0168569. [42] M.P. Rodriguez, Z.M. Emond, Z. Wang, J. Martinez, Q. Jiang, M.R. Kibbe, Role of metabolic environment on nitric oxide mediated inhibition of neointimal hyperplasia in type 1 and type 2 diabetes, Nitric Oxide 36 (2014) 67–75. [43] J. Hempe, R. Elvert, H.L. Schmidts, W. Kramer, A.W. Herling, Appropriateness of the Zucker Diabetic Fatty rat as a model for diabetic microvascular late complications, Lab Anim. 46 (2012) 32–39.
Impact of high glucose and transforming growth factor-beta on bioenergetic profiles in podocytes, Metabolism 61 (2012) 1073–1086. [39] C. Zhu, S. Huang, Y. Yuan, G. Ding, R. Chen, B. Liu, T. Yang, A. Zhang, Mitochondrial dysfunction mediates aldosterone-induced podocyte damage: a therapeutic target of PPARgamma, Am. J. Pathol. 178 (2011) 2020–2031. [40] T. Yamanouchi, Concomitant therapy with pioglitazone and insulin for the treatment of type 2 diabetes, Vasc. Health Risk Manag. 6 (2010) 189–197. [41] Y.S. Eom, A.R. Gwon, K.M. Kwak, J.Y. Kim, S.H. Yu, S. Lee, Y.S. Kim, I.B. Park,
9
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Original article
Pioglitazone downregulates Twist-1 expression in the kidney and protects renal function of Zucker diabetic fatty rats Zijian Wanga, Qingbo Liua, Wendi Daid, Bing Huaa, Hongwei Lia,b,c, Weiping Lia,c,
T
⁎
a
Department of Cardiology, Cardiovascular Center, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, PR China Department of Internal Medicine, Medical Health Center, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, PR China c Beijing Key Laboratory of Metabolic Disorder Related Cardiovascular Disease, Beijing 100069, PR China d Department of Nephrology, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Diabetic nephropathy PPAR-γ Pioglitazone Twist-1 Renal fibrosis ZDF
Aims: Renal interstitial fibrosis and glomerulosclerosis are the characteristic presentation of diabetic nephropathy progression. Twist-1 overexpression contributes to renal fibrosis. Previous studies have demonstrated that pioglitazone (PIO), a PPAR-γ agonists, can ameliorate renal fibrosis and protect renal function. However, whether PIO attenuates renal fibrosis and delays diabetic nephropathy progression by regulating Twist-1 expression remains unclear. Methods: Male Zucker diabetic fatty (ZDF) rats were randomly divided into 3 groups: (1) ZDF group, (2) ZDF + PIO group treated with PIO for 10 weeks, (3) ZDF + PIO + GW9662 group treated with GW9662 (a PPAR-γ antagonist) and PIO for 10 weeks. Age-matched Zucker lean rats (ZL group) were used as a control group. Urinary albumin/creatinine ratio (UACR) and renal blood flow were measured. Renal histopathology and Twist-1 expression were determined by immunohistochemistry. The protein and mRNA levels of Twist-1 and PPAR-γ were analyzed by Western blot and qRT-PCR. Results: PIO considerably reduced UACR and improved renal blood flow. This was associated with amelioration of glomerulosclerosis and tubulointerstitial fibrosis evidenced by the expression decrease of collagen I, aquaporin 1, α-SMA, transforming growth factor β1 and nephrin, although glycaemia remained high. Moreover, Twist-1 protein and mRNA expression in kidney of ZDF rats were significantly increased compared with ZL rats and PIO significantly decreased Twist-1 levels. Conclusions: This study shows that PIO can downregulate Twist-1 expression in the kidney, inhibit renal fibrosis and protect renal function in ZDF rats. These PIO-mediated effects are independent of glycemic control.
1. Introduction Diabetic nephropathy is the main cause of end stage kidney disease and creates heavy healthcare burdens globally [1]. It is well known that renal interstitial fibrosis, particularly tubulointerstitial fibrosis, and glomerulosclerosis are the characteristic presentation of diabetic nephropathy progression and contributes substantially to renal function deterioration [2]. Therefore, effective control of renal fibrosis may be the key to prevent and manage diabetic nephropathy. Peroxisome-proliferator-activated receptors (PPARs) are nuclear receptors consisting of three PPAR isoforms: PPAR-α, PPAR-β, and PPAR-γ [3]. PPAR-γ is involved in regulating glucose and lipid metabolism. Mutations in PPAR-γ lead to abnormal lipid and glucose metabolism, which are related to type 2 diabetes mellitus and obesity [4].
PPAR-γ agonists, thiazolidinediones, such as pioglitazone (PIO) and rosiglitazone, are often used in patients with diabetes to prevent cardiovascular and renal complications [5]. A previous meta-analysis has found that P121A polymorphism in the PPAR-γ gene is closely associated with a reduced risk of albuminuria in patients with type 2 diabetes [6]. The beneficial effect of PPAR-γ agonist in diabetic nephropathy have been proved in multiple clinical trials and in vitro and in vivo studies [7–11]. However, the mechanisms underlying PPAR-γ agonist-mediated beneficial effects remain unclear. Furthermore, GW9662 (2-chloro-5-nitrobenzanilide) was identified from a high throughput screen of the corporate compound collection for PPAR-γ ligands and is a potent and selective antagonist of full length PPAR-γ. Scintillation proximity assays showed that GW9662 was 10-fold and 600-fold more potent at inhibiting radioligand binding to PPAR-γ
⁎ Corresponding author at: Department of Cardiology, Cardiovascular Center, Beijing Friendship Hospital, Capital Medical University, 95 Yongan Road, Xicheng, Beijing 100050, PR China. E-mail address: [email protected] (W. Li).
https://doi.org/10.1016/j.biopha.2019.109346 Received 4 June 2019; Received in revised form 25 July 2019; Accepted 7 August 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/).
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
nitrogen and stored at −80 °C for real-time RT-PCR and Western blot.
versus PPAR-α or PPAR-δ, respectively [12]. As the antagonistic activity of GW9662 toward PPAR-γ is retained in cell culture systems, this compound is thought to be a useful tool for elucidation of the role of PPAR-γ in biological processes. Twists (Twist-1 and Twist-2) were originally isolated from Drosophila, and Twist proteins are evolutionarily conserved from Drosophila to vertebrates [13]. A previous study has indicated that Twist-1 might be involved in many fibrotic diseases [14]. In the kidney of mice with unilateral ureteral obstruction (UUO), Twist expression is elevated in the tubular epithelium of the tubules and interstitial areas [15]. A recent study has shown that Twist-1 prolonged transforming growth factor-β1 (TGF-β1)-induced G2 arrest of tubular epithelial cells (TECs) and accelerated epithelial mesenchymal transition (EMT), and the deletion of Twist-1 gene in proximal TECs inhibited EMT and ameliorated renal interstitial fibrosis [16]. These findings suggest that Twist-1 may play a critical role in renal fibrosis development. To the best of our knowledge, few studies investigate renal Twist-1 expression in an animal model of type 2 diabetes and the effects of PIO on renal Twist-1 expression, although a recent report indicated a possible interaction between Twist-1 and PPAR-γ in 3T3-L1 mature adipocytes [17]. In the current study, we hypothesized that PIO, an agonist of PPARγ, might alleviate tubulointerstitial fibrosis and glomerulosclerosis, prevent diabetic nephropathy development, and preserve renal function through downregulation of Twist-1 expression in the kidneys of Zucker diabetic fatty (ZDF) rats, a popular animal model of obese type 2 diabetes.
2.3. Measurement of physiological parameters Systolic and diastolic blood pressure were measured in conscious animals at baseline and then weekly by tail-cuff plethysmography. For plasma glucose measurement, rat blood was withdrawn from the lateral tail vein after a 6-h fasting period. Twenty-four-hour urine was collected in metabolic cages at the end of experiment. The fasting blood glucose, urinary albumin, and urinary creatinine were measured using an automatic biochemistry analyzer (Siemens, Germany) in the laboratory of Beijing Friendship Hospital of Capital Medical University. Urinary albumin excretion was expressed as albumin/creatinine ratio (ACR). 2.4. Ultrasound imaging Rats were placed in a supine position on the ultrasound imaging system (VisualSonics, Canada). Depilatory was used to remove abdominal fur, and ultrasound acoustic gel was used as a coupling fluid between the real-time micro-visualization scanhead and the skin. Ultrasound imaging was performed using the Vevo Lab system (VisualSonics, Canada). The MS250 transducer (13–24 MHz) was positioned and fixed by a dedicated arm (VisualSonics, Canada). Renal blood flow was measured by a transversal scan of the right kidney using a color-Doppler in Vevo2100 Imaging System (FUJIFILM VisualSonic, United States). We used a PW-Doppler to measure systolic peak velocity of the renal artery. The angle correction was set between 30° and 60°. The waveforms have been optimized for the measurements using the lowest pulse repetition frequency without aliasing, the highest gain without obscuring background noise, and the lowest wall filter. A spectrum was considered if 3–5 consecutive similar-appearing waveforms were noted. The pulsatility index (PI) (peak systolic frequency shift–minimum diastolic frequency shift)/ mean frequency shift) or resistive index (RI) (peak systolic frequency shift–minimum diastolic frequency shift)/ peak systolic frequency shift) was determined for each rat. This ultrasound imaging method to measure renal blood flow of rats was reported previously [20].
2. Materials and methods 2.1. Animals and treatment Seven-eight-week old male ZDF rats (fa/fa) and age-matched Zucker lean rats (fa/-, ZL) were obtained from Charles River Laboratories (Beijing, China). A total of 24 rats were housed in the animal care facility at Beijing Friendship Hospital. The rats were maintained at 21 t 2 °C and 12-h day/night cycle and had free access to food and water at all times. The ZDF rats were fed with Purina 5008 chow (Richmond, USA) from the age of 8 weeks old to the age of 10–12 weeks old; and their blood glucose levels increased gradually. When their blood glucose levels reached ≥12 mmol/L, the rats were considered to be diabetic [18], and then they were fed with a regular chow (13 kcal% fat) diet until the end of the experiment. The ZL rats received a regular chow diet during the whole experiment. The ZDF rats were randomly divided into the following three groups: ZDF group (n = 6); ZDF + PIO group (PIO: a PPAR-γ agonists, 10 mg/kg/d by intragastric administration, n = 6); ZDF + PIO + GW9662 group (PIO: 10 mg/kg/d by intragastric administration; GW9662: a PPAR-γ antagonist, 1 mg/kg/d by intraperitoneal injection, n = 6) [19]. As we know, GW9662 is a full antagonist of PPAR-γ in cell-based reporter assays and often used to elucidate the role of PPAR-γ in biological processes We aimed to investigate whether the effects of PIO on ZDF rats are reversed when combined with GW9662 which greatly inhibit the activity of PPAR-γ. Treatment started after 2 weeks of acclimatization and lasted for 10 weeks. The study protocols were performed in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and approved by the Animal Care and Use Committee of Capital Medical University.
2.5. Immunohistochemistry Paraffin embedded tissue sections were subjected to immunohistochemical assays as the recent report [21]. The sections were probed with the primary antibodies against collagen I (sigma, United States), aquaporin 1 (AQP-1) (sigma, United States), α-smooth muscle actin (α-SMA) (Abcam, United Kingdom), TGF-β1 (sigma, United States), nephrin (sigma, United States), and Twist-1(sigma, United States). The secondary antibody was biotinylated goat anti-rabbit IgG. Images were captured and analyzed using the IMS imaging processing system (Shanghai Jierdun Biotech, China). Positively stained regions were identified. The sections were also stained with Masson’s trichrome and hematoxylin and eosin stain. We used the image analysis software Image-Pro Plus version 6.0 (Media Cybernetics, United States) to quantitively evaluate the stained tissue sections and assessed 20 randomly selected consecutive microscopic fields for each kidney tissue section. 2.6. Western blot analysis
2.2. Rat kidney specimen isolation and storage
Tissue pieces from the middle region of the frozen left kidney samples were used for Western blot analysis. Total tissue proteins were extracted. Protein samples (20–30 μg) were separated on 10% SDSPAGE gels and then transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were incubated with the primary antibodies against Twist-1 (sigma, United States), PPAR-γ (Santa Cruz, United States), and β-actin (sigma, United States) overnight at 4 °C,
Rats were anesthetized with an intraperitoneal injection of chloral hydrate (10%, 3 mL/kg). Under anesthesia, both kidneys from each rat were carefully removed. The right kidneys were fixed in 4% paraformaldehyde and embedded in paraffin for histochemical and immunohistochemical staining, and the left kidneys were frozen in liquid 2
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
ZDF + PIO and ZDF + PIO + GW9662 rats were significantly higher than that of ZL rats (All P < 0.05). Systolic and diastolic blood pressure were similar between ZDF and ZL rats. The ZDF rats had significantly higher fasting blood glucose levels than the ZL rats (22.1 ± 1.63 mmol/L vs. 6.8 ± 0.39 mmol/L, P < 0.05), while the fasting blood glucose levels showed no significant difference among ZDF, ZDF+PIO, and ZDF+PIO+GW9662 rats. ZDF rats had significantly higher UACR than ZL rats (402.1 ± 46.52 mg/g vs. 29.1 ± 3.22 mg/g, P < 0.05). Treatment with PIO significantly reduced UACR compared with ZDF (402.1 ± 46.52 mg/g vs. 85.9 ± 5.04 mg/g, P < 0.05). Higher RI and PI were observed in ZDF rats when compared with the ZL rats (P < 0.05). ZDF+PIO group had significantly lower RI and PI than ZDF group (P < 0.05), while RI and PI remained high after combined treatment with PIO and GW9662. These data indicate that PIO can improve renal blood flow and reduce albuminuria. These effects are independent of glycemic control.
washed thoroughly, and then incubated with an HRP-conjugated secondary antibody at room temperature for 1 h. The protein bands were detected with a Western Blotting Imaging System (Clinx Science Instruments Co, China). 2.7. RNA extraction and real-time reverse transcription–polymerase chain reaction (real-time RT-PCR) Total RNA of kidney tissue samples was extracted by using Trizol reagent following the manufacturer’s instructions (Invitrogen, United States). Reverse transcription was performed using MMLV (GIBCO, United States) and 100 ng of total RNA sample from each rat kidney tissue specimen was used for the reverse transcription. PCR of samples in triplicate in 50 μL reaction volume was run in the ABI PRISM 5700 sequence detector system (Applied Bio systems, United States) at the following conditions: 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of 95 °C for 20 s and 60 °C for 30 s, followed by a melting curve stage of 95 °C for 15 s, 60 °C for 30 s and 95 °C for 15 s. The primer sequences used in this study are: Twist-1 5’ - GCATGCATTCTCAAGA GGT - 3’ and 5’- CAGTTTGATCCCAGCGTTTT - 3’, PPAR-γ 5’ - GACCA CTCCCATTCCTTTGA- 3’ and 5’ - AACCATTGGGTCAGCTTG - 3’, β-actin 5’ - CGTTGACATCCGTAAAGACC - 3’ and 5’ - CTAGGAGCCAGGGCAG TAATC - 3’. Melting curve analyses of all real-time RT-PCR products showed a single DNA duplex. Relative quantitation values were calculated using the 2(-Delta Delta C(T)) method. The amount of each target gene was subsequently divided by the amount of internal control gene β-actin to obtain a normalized value. Three different experiments were performed for each experimental condition.
3.2. Treatment with PIO reduces glomerulosclerosis and tubulointerstitial fibrosis in the ZDF rats Masson trichrome staining revealed that collagen deposition, which is an indicator of tubulointerstitial fibrosis, was substantially higher in the ZDF group than in the ZL group, and PIO significantly reduced the staining intensity, suggesting reduction in collagen deposition (Fig. 1). The additional treatment with GW9662 reversed this change. Moreover, we can see a similar trend among tubular atrophy and interstitial fibrosis (Fig. 1). Collagens I expression was evaluated by immunohistochemistry to further assess collagen deposition. Collagen I expression (Fig. 2A) was increased significantly in the ZDF group compared with the ZL group (30.12 ± 3.063% vs. 5.74 ± 1.872%, P < 0.05) and reduced significantly by PIO (30.12 ± 3.063% vs. 15.42 ± 1.175%, P < 0.05, Table 1). GW9662 significantly reversed the PIO-mediated reduction in collagen I expression (15.42 ± 1.175% vs 37.78 ± 5.332%, P < 0.05) (Table 1). AQP is closely associated with water balance disorder [22]. Inhibition of inflammation could attenuate renal AQP expression loss in rats [23]. In our study, we found that AQP-1 expression (Fig. 2B) was significantly higher in ZL rats than in ZDF rats (29.1 ± 4.591% vs. 4.7 ± 1.365%, P < 0.05, Table 1). PIO significantly increased AQP-1 levels (23.8 ± 2.897% vs. 4.7 ± 1.365%, P < 0.05) in ZDF rats to the similar levels of ZL rats (29.1 ± 4.591%), and additional GW9662 treatment significantly reversed the stimulatory effects of PIO on AQP-1 expression (9.6 ± 2.045% vs. 23.8 ± 2.897%, P < 0.05, Table 1) in
2.8. Statistical analysis All data were expressed as the mean ± standard deviation (SD) unless otherwise specified. Significant differences between groups were determined by one-way analysis of variance (ANOVA) for repeated measurements, followed by the Bonferroni multiple testing correction or the Dunn’s multiple comparison test by SPSS. P < 0.05 were considered statistically significant. 3. Results 3.1. Physiological parameters at the end of the study of each group As shown in Table 1, at 20 weeks of age, the body weight of ZDF,
Table 1 Physiological parameters and quantitative analysis of the immunohistochemical staining at end of the study. Group
ZL N=6
ZDF N=6
ZDF + PIO N=6
ZDF + PIO + GW9662 N=6
Body weight (g) Fasting blood glucose (mmol/L) SBP (mmHg) DBP (mmHg) UACR (mg/g) RI PI Col I (%)/cross section AQP-1 (%)/cross section α-SMA (%)/cross section TGF-β1 (%)/cross section Nephrin (%)/glomerulus
326.3 ± 3.93 6.8 ± 0.39 124.5 ± 3.22, 85.5 ± 1.962 29.1 ± 3.22 0.538 ± 0.0214 0.724 ± 0.0661 5.74 ± 1.872 29.1 ± 4.591 1.18 ± 0.342 4.23 ± 0.772 25.57 ± 3.888
417.5 ± 17.21* 22.1 ± 1.63* 130.2 ± 5.78 90.8 ± 3.851 402.1 ± 46.52* 0.758 ± 0.0737* 1.364 ± 0.2491* 30.12 ± 3.063* 4.7 ± 1.365* 13.51 ± 1.885* 27.27 ± 2.632* 8.72 ± 0.673*
405.1 ± 26.74* 19.1 ± 0.74* 112.3 ± 3.36# 72.8 ± 3.301# 85.9 ± 5.04# 0.538 ± 0.0387# 0.793 ± 0.0775# 15.42 ± 1.175*,# 23.8 ± 2.897# 7.56 ± 0.763*,# 8.33 ± 1.983# 20.81 ± 0.9063#
497.2 ± 10.76*,#,& 22.9 ± 1.63* 112.2 ± 4.21# 82.6 ± 4.088 210.2 ± 107.93* 0.795 ± 0.0419*,& 1.405 ± 0.1322*,& 37.78 ± 5.332*,& 9.6 ± 2.045*,& 17.35 ± 1.796*,& 21.31 ± 3.783*,& 8.51 ± 1.862*,&
Data are expressed as means ± SEM. Values are compared with each other using ANOVA followed by the Bonferroni multiple testing correction or the Dunn’s multiple comparison test by SPSS. SBP: systolic blood pressure; DBP: diastolic blood pressure; UACR: urinary albumin/creatinine ratio; RI: resistive index; PI: pulsatility index; Col I: collagen I; AQP-1: aquaporin 1; α-SMA: α-smooth muscle actin; TGF-β1: transforming growth factor β1. * P < 0.05, versus ZL group. # P < 0.05, versus ZDF group. & P < 0.05, versus ZDF+PIO group. 3
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
Fig. 1. Representative images of Masson’s trichrome staining. Kidney tissue sections were stained by Masson’s trichrome method. Single arrows indicate collagen deposition. Representative images of the ZDF, ZDF + PIO, ZDF + PIO + GW9662 and ZL groups are presented. We can see collagen deposition was substantially higher in the ZDF group than in the ZL group, and PIO significantly reduced the staining intensity. The additional treatment with GW9662 reversed this change. A similar trend was obsreved in tubular atrophy and interstitial fibrosis. Magnification: ×200. Bar =100 μm.
3.3. Pioglitazone reduced Twist-1 expression in the kidneys of ZDF rats
ZDF rats. We also found that α-SMA expression was increased significantly in the renal interstitium and periglomerular areas of the ZDF rats (Fig. 2C) compared with the ZL rats (13.51 ± 1.885% vs. 1.18 ± 0.342%, P < 0.05, Table 1). PIO treatment reduced α-SMA expression significantly compared with the ZDF rats (7.56 ± 0.763% vs. 13.51 ± 1.885%, P < 0.05), and GW9662 treatment reversed this PIO-mediated effects (17.35 ± 1.796% vs. 7.56 ± 0.763%, P < 0.05, Table1). TGF-β1 is one of the key profibrotic factors, particularly in chronic kidney disease. The TGF-β1 levels in the glomeruli, renal interstitium, and tubular epithelium were significantly lower in the ZL group than in the ZDF group (4.23 ± 0.772% vs. 27.27 ± 2.632%, P < 0.05, Table 1). PIO reduced TGF-β1 levels of the ZDF rats significantly (8.33 ± 1.983% vs. 27.27 ± 2.632%, P < 0.05, Table 1), and GW9662 reversed the PIO-mediated reduction in TGF-β1 levels (21.31 ± 3.783 vs. 8.33 ± 1.983%, P < 0.05) (Table 1 and Fig. 2D). Immunohistochemistry also revealed that nephrin expression was decreased significantly in the glomeruli of ZDF rats compared with the ZL rats (8.72 ± 0.673 vs. 25.57 ± 3.888, P < 0.05), while PIO treatment increased nephrin levels significantly (20.81 ± 0.9063 vs. 8.51 ± 1.862, P < 0.05). GW9662 treatment significantly reversed the effects of PIO and reduced the nephrin levels to those of the ZDF rats (Table1).
Twist-1 was sparsely expressed in the tubular of ZL rats, and no Twist-1 specific staining was detected in the Bowman's capsule (Fig. 3). However, in the ZDF group, Twist-1 expression was remarkably increased in the intertubular areas, and tubular areas, although sparsely distributed in the glomerulus and vascular wall. In these areas, fibroblast cells and TECs were intensely stained with anti-Twist-1 antibody, whereas we did not clearly identify Twist-1 expression in the glomerular cells. In the ZDF + PIO group, only a few TECs slightly expressed Twist-1 (Fig. 3). ZDF + PIO + GW9662 rats expressed high levels of Twist-1 in the interstitial and tubular areas (Fig. 3). To confirm PPAR-γ protein expression in the kidneys of ZDF rats, we performed Western blot. As shown in Fig. 4A and C, PPAR-γ expression was reduced significantly (P < 0.05) in the kidney tissues isolated from ZDF rats as well as in the kidney tissues from ZDF+PIO+GW9662 rats compared with ZL rats. In ZDF+PIO group, PPAR-γ expression was increased significantly compared with ZDF rats (P < 0.05). The results from real-time RT-PCR were consistent with the results of the Western blot analysis (Fig. 4D). Twist-1 protein expression in the kidney was significantly increased in the ZDF rats (Fig. 4B). PIO treatment significantly decreased Twist-1 levels by 57%. The additional treatment with GW9662 increased Twist1 expression by over 1.8-fold compared with ZDF + PIO group (Fig. 4B and C). We further analyzed Twist-1 mRNA levels of each group by real4
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
Fig. 2. Representative images of immunohistochemical staining for Collagen I, TGF-β1, AQP-1 and α-SMA. (A) Collagen I expression was increased significantly in the ZDF group compared with the ZL group and reduced significantly by PIO. GW9662 reversed the PIOmediated reduction in collagen I expression. (B) AQP-1 expression was significantly higher in ZL rats than in ZDF rats. PIO significantly increased AQP-1 levels in ZDF rats to the similar levels of ZL rats, and additional GW9662 treatment reversed the stimulatory effects of PIO on AQP-1 expression in ZDF rats. (C) α-SMA expression was increased significantly in the renal interstitium and periglomerular areas of the ZDF rats compared with the ZL rats. PIO reduced α-SMA expression, and GW9662 treatment reversed this PIO-mediated effects. (D) TGF-β1 levels in the glomeruli, renal interstitium, and tubular epithelium were significantly lower in the ZL group than in the ZDF group. PIO reduced TGF-β1 levels of the ZDF rats, and GW9662 reversed the PIO-mediated reduction in TGF-β1 levels. Single arrows show target protein positive cells or area. Representative pictures of tissue sections immunostained for each protein. (A) Collagen I, Magnification: × 100, Bar =200 μm; (B) TGFβ1, Magnification: × 400, Bar =50 μm; (C) AQP-1, Magnification: ×400, Bar =50 μm; (D) α-SMA, Magnification: × 400, Bar =50 μm.
distinct tubulointerstitial fibrosis and glomerulosclerosis. PIO, a PPAR-γ agonist, significantly inhibited renal fibrosis, improved renal blood flow and rapidly reduced albuminuria. These beneficial effects may be due to PIO-mediated downregulation of Twist-1 expression. Our results support that PPAR-γ activation could prevent or slow down the progression of diabetic nephropathy, particularly at early stage. The pathology of type 2 diabetes-associated nephropathy is characterized by excessive extracellular matrix deposition, glomerular basement membrane thickening, vessel proliferative changes, and tubular atrophy, ultimately resulting in interstitial fibrosis and glomerulosclerosis [24]. Numerous molecular and cellular mechanisms are associated with these pathological changes in the kidney, such as oxidative stress, inflammation, release of profibrotic factors especially TGF-β1, collagen cross-linking, and EMT [25]. Nevertheless, the exact
time RT-PCR. Consistent with the results from Western blot, ZDF rats expressed significantly higher mRNA levels than ZL rats (Fig. 4E). Treatment with PIO significantly decreased Twist-1 mRNA expression to the levels of ZL rats. The combination of PIO and GW9662 reversed the effects of PIO on Twist-1 mRNA expression (Fig. 4E). 4. Discussion Albuminuria and renal fibrosis are the two main features of incipient diabetic nephropathy. In this study, we investigated the involvement of Twist-1 and PPAR-γ pathway in the development of diabetic nephropathy in ZDF rat, a popular animal model of type 2 diabetes. Our main findings demonstrated that Twist-1 expression was significantly increased in the kidney of ZDF rat accompanied with 5
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
Fig. 3. Immunohistochemical staining for Twist-1. (A) Twist-1 was sparsely expressed in the tubular of ZL rats, and was not Twist-1 specific staining was detected in the Bowman's capsule. However, in the ZDF group, Twist-1 expression was remarkably increased in the Bowman’s capsule, intertubular areas, and tubular areas, although sparsely distributed in the vascular wall. Single arrows show Twist-positive cells in tubular areas. Double arrows show Twist-positive cells in Bowman’s capsule. In the ZDF + PIO group, only a few tubular epithelial cells slightly expressed Twist1. ZDF + PIO + GW9662 rats expressed high levels of Twist-1 in the interstitial and tubular areas. Magnification: × 400, Bar =50 μm. (B) IOD/area of Twist-1 was determined by Quantitative image analysis of the immunohistochemistry.
contribute to the initiation and the progression of diabetic nephropathy [38]. PPAR-γ activation can remarkably protected against aldosteroneinduced podocyte injury via restoration of mitochondrial function [39]. Several in vivo and in vitro studies illustrated the beneficial effects of PPAR-γ agonist in diabetic nephropathy [7–11]. The decreasing trend of glucose was observed after 10 weeks of PIO treatment in our study, however, the effect was not significant. The reason for this could be due to the dosage and time of PIO treatment. For the insulin-resistant nature of the type 2 diabetic rats, obtaining tight glucose control was rather difficult. The main action of PIO, as with other TZDs, is the reconstitution of fatty tissue, so its effects on glycemia occur slowly [40]. Eom used higher dose of PIO (30 mg/kg/d) in ZDF group. From week 2 to week 5, blood glucose levels were found to be significantly lower than in the untreated groups [41]. In a recent study, ZDF rats receiving 5 weeks of the same dose of PIO were also poorly controlled [42]. Despite the maintainance of hyperglycaemia, we still found that PIO reduced UACR, improved renal perfusion, protected renal function, and suppressed renal fibrosis, indicating that all these benefits of PIO were independent of glycemic control. To clarify the underlying mechanism, we investigated the impact of PIO on Twist-1 expression in ZDF rats. As a result, our study showed that PIO downregulated Twist-1 protein and gene expression, and additional treatment with GW9662, a PPAR-γ antagonist, reversed the PIO-mediated inhibition on Twist-1 expression and suppression on diabetic nephropathy progression. Notably, our results are inconsistent with the findings from a previous study. Ren found that PIO upregulated Twist-1 expression and a PPAR-γ antagonist (T0070907) downregulated Twist-1 expression in 3T3-L1 mature adipocytes [17]. The opposite effects of PIO on Twist-1 could be related to possible diverse functions of PPAR-γ and Twist-1 in different types of tissues and cells, such as preadipocytes and adipocytes. Moreover, we found that Twist-1 was abundantly expressed in TECs, but only minimally expressed in glomerular cells of ZDF rats. Otherwise, Yujiro reported the expression level of Twist was remarkably increased in the intertubular areas and the Bowman’s capsule and many cells in glomerulus also expressed Twist in UUO model [15]. The discrepancy between the two studies seemed to be mainly related to the different models investigated. In addition to, ZDF rats fed with regular chow in our study didn’t have very high blood glucose and were at early stage of diabetic nephropathy. Hempe reported that ZDF rats at 35 weeks of age fed with Purina 5008 diet showed moderate to marked pathological changes in glomeruli and tubuli similar to those seen in human diabetic nephropathy [43]. Up to now, the underlying signaling pathway of PIO-mediated downregulation of Twist-1 expression in
mechanism underlying diabetic nephropathy is still not fully elucidated. A recent study found the involvement of Twist-1 in renal fibrosis [16]. Twist-1 is a member of the Twist family of basic helix–loop–helix transcription factors and was originally found in Drosophila [13]. Apart from serving as a master regulator of embryonic morphogenesis, Twist1 contributes to the EMT process and plays essential roles in metastasis and fibrosis. A growing number of studies have demonstrated that Twist-1 is involved in many fibrotic diseases, including pulmonary, oral submucous, peritoneal membrane tissues and biliary fibrosis [26–30]. More recently, the role of Twist-1 in renal fibrosis has attracted considerable attention. In 2007, Kida Y first reported that Twist-1 expression was elevated in the kidney of UUO mouse models and mainly expressed in the tubular epithelia of the expanded tubules and interstitial areas. This study showed that Twist-1 is related to tubular EMT, myofibroblast proliferation and subsequent fibrosis in obstructed kidneys [15]. Furthermore, in mouse models of UUO-induced renal fibrosis, conditional deletion of Twist-1 in proximal TECs resulted in inhibition of the EMT program and the maintenance of TEC integrity, while also restoring cell proliferation, dedifferentiation-associated repair and regeneration of the kidney parenchyma and attenuating interstitial fibrosis. The underlying molecular mechanism is likely that Twist1 promotes prolonged TGF-β1-induced G2 arrest of TECs, limiting the repair and regeneration of TECs. In addition, a few studies have demonstrated that Twist-1 plays an critical role in hypoxia-induced EMT in a HIF-1α-dependent manner in renal fibrosis [31–33]. However, the expression of Twist-1 in kidney of ZDF rat is still unclear. In our current study, we found that Twist-1 was sparsely expressed in the tubular and no specific staining of Twist-1 was detected in the Bowman's capsule of ZL rats. In ZDF rats, Twist-1 was distributed in the renal arteriole wall and was remarkably overexpressed in the Bowman’s capsule, intertubular and tubular areas. Moreover, the Twist-1 overexpression was accompanied by obvious tubulointerstitial fibrosis and glomerulosclerosis in ZDF rats. Our results indicate that Twist-1 might participate in the development of diabetic nephropathy. PIO can selectively bind to and activate PPAR-γ and belongs to the thiazolidinedione (TZD) family. It has been commonly used as an adjunctive therapy to diet, exercise, and other medications to manage type 2 diabetes [34]. Despite many limitations, such as weight gain, increased risk for chronic edema or heart failure and elevated risk in bone fracture [35,36], PIO is an important antihyperglycemic agent to directly attenuate insulin resistance [37]. Mitochondrial dysfunction in the kidneys, especially in podocytes of patients with diabetes, may
6
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
Fig. 4. Protein and mRNA expression of Twist-1 and PPAR-γ in the kidney. (A, C) Compared to ZL rats, PPAR-γ expression was reduced significantly in ZDF rats and ZDF + PIO + GW9662 rats. PIO significantly increased PPAR-γ expression. (D) The results from real-time RT-PCR were consistent with the results of the Western blot analysis. (B, C) Twist-1 protein expression was significantly increased in the ZDF rats. PIO significantly decreased Twist-1 levels by 57%. The additional treatment with GW9662 increased expression by over 1.8-fold. (E) Real-time RT-PCR showed the similar results. The ZDF rats expressed significantly higher mRNA levels of Twist-1 than ZL rats while PIO significantly decreased Twist-1 expression to the levels of ZL rats. The combination of PIO and GW9662 reversed the effects of PIO on Twist-1 mRNA expression. The data are shown as means ± standard deviation (n = 6). *P < 0.05, versus ZL group; #P < 0.05, versus ZDF group; &P < 0.05, versus ZDF+PIO group.
7
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
kidney remains unclarified and requires further investigations.
Res. 15 (1987) 3439–3453. [14] Q.Q. Zhu, C. Ma, Q. Wang, Y. Song, T. Lv, The role of TWIST1 in epithelial-mesenchymal transition and cancers, Tumour Biol. 37 (2016) 185–197. [15] Y. Kida, K. Asahina, H. Teraoka, I. Gitelman, T. Sato, Twist relates to tubular epithelial-mesenchymal transition and interstitial fibrogenesis in the obstructed kidney, J. Histochem. Cytochem. 55 (2007) 661–673. [16] S. Lovisa, V.S. LeBleu, B. Tampe, H. Sugimoto, K. Vadnagara, J.L. Carstens, C.C. Wu, Y. Hagos, B.C. Burckhardt, T. Pentcheva-Hoang, H. Nischal, J.P. Allison, M. Zeisberg, R. Kalluri, Epithelial-to-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis, Nat. Med. 21 (2015) 998–1009. [17] R. Ren, Z. Chen, X. Zhao, T. Sun, Y. Zhang, J. Chen, S. Lu, W. Ma, A possible regulatory link between Twist 1 and PPARgamma gene regulation in 3T3-L1 adipocytes, Lipids Health Dis. 15 (2016) 189. [18] L. Cai, W. Li, G. Wang, L. Guo, Y. Jiang, Y.J. Kang, Hyperglycemia-induced apoptosis in mouse myocardium: mitochondrial cytochrome C-mediated caspase-3 activation pathway, Diabetes 51 (2002) 1938–1948. [19] P. Paragomi, R. Rahimian, M.H. Kazemi, M.H. Gharedaghi, A. Khalifeh-Soltani, S. Azary, A.N. Javidan, K. Moradi, S. Sakuma, A.R. Dehpour, Antinociceptive and antidiarrheal effects of pioglitazone in a rat model of diarrhoea-predominant irritable bowel syndrome: role of nitric oxide, Clin. Exp. Pharmacol. Physiol. 41 (2014) 118–126. [20] F. Iacobellis, T. Segreto, D. Berritto, F. Nettuno, S. Cozzolino, D. Di Napoli, M. Montella, R. Natella, S. Cappabianca, L. Brunese, R. Grassi, A rat model of acute kidney injury through systemic hypoperfusion evaluated by micro-US, color and PW-Doppler, Radiol. Med. (2018). [21] J.E. Toblli, G. DeRosa, G. Cao, P. Piorno, P. Pagano, ACE inhibitor and angiotensin type I receptor antagonist in combination reduce renal damage in obese Zucker rats, Kidney Int. 65 (2004) 2343–2359. [22] S.S. Adiyanti, T. Loho, Acute kidney injury (AKI) biomarker, Acta Med. Indones. 44 (2012) 246–255. [23] G. Yu, Q. Liu, X. Dong, K. Tang, B. Li, C. Liu, W. Zhang, Y. Wang, Y. Jin, Inhibition of inflammation using diacerein markedly improved renal function in endotoxemic acute kidney injured mice, Cell. Mol. Biol. Lett. 23 (2018) 38. [24] K. Umanath, J.B. Lewis, Update on diabetic nephropathy: core curriculum 2018, Am. J. Kidney Dis. 71 (2018) 884–895. [25] Y. Li, Y.S. Kang, C. Dai, L.P. Kiss, X. Wen, Y. Liu, Epithelial-to-mesenchymal transition is a potential pathway leading to podocyte dysfunction and proteinuria, Am. J. Pathol. 172 (2008) 299–308. [26] J. Yang, S.A. Mani, J.L. Donaher, S. Ramaswamy, R.A. Itzykson, C. Come, P. Savagner, I. Gitelman, A. Richardson, R.A. Weinberg, Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis, Cell 117 (2004) 927–939. [27] V. Pozharskaya, E. Torres-Gonzalez, M. Rojas, A. Gal, M. Amin, S. Dollard, J. Roman, A.A. Stecenko, A.L. Mora, Twist: a regulator of epithelial-mesenchymal transition in lung fibrosis, PLoS One 4 (2009) e7559. [28] R.S. Bridges, D. Kass, K. Loh, C. Glackin, A.C. Borczuk, S. Greenberg, Gene expression profiling of pulmonary fibrosis identifies Twist1 as an antiapoptotic molecular "rectifier" of growth factor signaling, Am. J. Pathol. 175 (2009) 2351–2361. [29] Y.H. Lee, L.C. Yang, F.W. Hu, C.Y. Peng, C.H. Yu, C.C. Yu, Elevation of Twist expression by arecoline contributes to the pathogenesis of oral submucous fibrosis, J. Formos. Med. Assoc. 115 (2016) 311–317. [30] L. He, M. Che, J. Hu, S. Li, Z. Jia, W. Lou, C. Li, J. Yang, S. Sun, H. Wang, X. Chen, Twist contributes to proliferation and epithelial-to-mesenchymal transition-induced fibrosis by regulating YB-1 in human peritoneal mesothelial cells, Am. J. Pathol. 185 (2015) 2181–2193. [31] S. Sun, X. Ning, Y. Zhang, Y. Lu, Y. Nie, S. Han, L. Liu, R. Du, L. Xia, L. He, D. Fan, Hypoxia-inducible factor-1alpha induces Twist expression in tubular epithelial cells subjected to hypoxia, leading to epithelial-to-mesenchymal transition, Kidney Int. 75 (2009) 1278–1287. [32] W. Bechtel, M. Zeisberg, Twist: a new link from hypoxia to fibrosis, Kidney Int. 75 (2009) 1255–1256. [33] M.H. Yang, D.S. Hsu, H.W. Wang, H.J. Wang, H.Y. Lan, W.H. Yang, C.H. Huang, S.Y. Kao, C.H. Tzeng, S.K. Tai, S.Y. Chang, O.K. Lee, K.J. Wu, Bmi1 is essential in Twist1-induced epithelial-mesenchymal transition, Nat. Cell Biol. 12 (2010) 982–992. [34] A.J. Garber, M.J. Abrahamson, J.I. Barzilay, L. Blonde, Z.T. Bloomgarden, M.A. Bush, S. Dagogo-Jack, R.A. DeFronzo, D. Einhorn, V.A. Fonseca, J.R. Garber, W.T. Garvey, G. Grunberger, Y. Handelsman, I.B. Hirsch, P.S. Jellinger, J.B. McGill, J.I. Mechanick, P.D. Rosenblit, G.E. Umpierrez, Consensus statement by the American Association of Clinical Endocrinologists and American College of Endocrinology on the comprehensive type 2 diabetes management algorithm – 2019 executive summary, Endocr. Pract. 25 (2019) 69–100. [35] S. Bolen, L. Feldman, J. Vassy, L. Wilson, H.C. Yeh, S. Marinopoulos, C. Wiley, E. Selvin, R. Wilson, E.B. Bass, F.L. Brancati, Systematic review: comparative effectiveness and safety of oral medications for type 2 diabetes mellitus, Ann. Intern. Med. 147 (2007) 386–399. [36] A.V. Schwartz, D.E. Sellmeyer, E. Vittinghoff, L. Palermo, B. Lecka-Czernik, K.R. Feingold, E.S. Strotmeyer, H.E. Resnick, L. Carbone, B.A. Beamer, S.W. Park, N.E. Lane, T.B. Harris, S.R. Cummings, Thiazolidinedione use and bone loss in older diabetic adults, J. Clin. Endocrinol. Metab. 91 (2006) 3349–3354. [37] R.A. DeFronzo, D. Tripathy, D.C. Schwenke, M. Banerji, G.A. Bray, T.A. Buchanan, S.C. Clement, R.R. Henry, H.N. Hodis, A.E. Kitabchi, W.J. Mack, S. Mudaliar, R.E. Ratner, K. Williams, F.B. Stentz, N. Musi, P.D. Reaven, A.N. Study, Pioglitazone for diabetes prevention in impaired glucose tolerance, N. Engl. J. Med. 364 (2011) 1104–1115. [38] N. Stieger, K. Worthmann, B. Teng, S. Engeli, A.M. Das, H. Haller, M. Schiffer,
5. Conclusions In conclusion, we showed that Twist-1 was overexpressed significantly in the kidney of ZDF rats. PIO, a PPAR-γ agonist, decreased Twist-1 expression, rapidly reduced albuminuria, and partially suppressed renal fibrosis of ZDF rats. The renal protective effects of PIO were independent of glycemic control and may be associated with PIOmediated downregulation of Twist-1 expression. Our study suggests that PPAR-γ activation and subsequent inhibition of Twist-1 represents a potential anti-fibrosis therapy and might prevent diabetic nephropathy progression. Grants/Funding This research was supported by grants from the National Natural Science Foundation of China (Grant number: 81670315, 81300161) and the Beijing Municipal Administration of Hospital Incubating Program (Grant number: PX2018002). Declaration of Competing Interest The authors declared they do not have anything to disclose regarding conflict of interest with respect to the manuscript. Acknowledgements The authors would like to thank Min Cong (Department of hepatology, Beijing Friendship Hospital, Capital Medical University School) for her technical support, and Qing Xu (School of Biomedical Engineering, Capital Medical University School) for her support of Ultrasound. References [1] R. Rabkin, Diabetic nephropathy, Clin. Cornerstone 5 (2003) 1–11. [2] Y. Qian, E. Feldman, S. Pennathur, M. Kretzler, F.C. Brosius, 3rd, from fibrosis to sclerosis: mechanisms of glomerulosclerosis in diabetic nephropathy, Diabetes 57 (2008) 1439–1445. [3] S. Khurana, L.A. Bruggeman, H.Y. Kao, Nuclear hormone receptors in podocytes, Cell Biosci. 2 (2012) 33. [4] S. Swaminathan, S.V. Shah, Novel approaches targeted toward oxidative stress for the treatment of chronic kidney disease, Curr. Opin. Nephrol. Hypertens. 17 (2008) 143–148. [5] R.E. Buckingham, Thiazolidinediones: pleiotropic drugs with potent anti-inflammatory properties for tissue protection, Hepatol. Res. 33 (2005) 167–170. [6] S. De Cosmo, S. Prudente, O. Lamacchia, E. Lapice, E. Morini, R. Di Paola, M. Copetti, P. Ruggenenti, G. Remuzzi, O. Vaccaro, M. Cignarelli, V. Trischitta, PPARgamma2 P12A polymorphism and albuminuria in patients with type 2 diabetes: a meta-analysis of case-control studies, Nephrol. Dial. Transplant. 26 (2011) 4011–4016. [7] J.E. Toblli, M.G. Ferrini, G. Cao, D. Vernet, M. Angerosa, N.F. Gonzalez-Cadavid, Antifibrotic effects of pioglitazone on the kidney in a rat model of type 2 diabetes mellitus, Nephrol. Dial. Transplant. 24 (2009) 2384–2391. [8] Y.J. Lee, H.J. Han, Troglitazone ameliorates high glucose-induced EMT and dysfunction of SGLTs through PI3K/Akt, GSK-3beta, Snail1, and beta-catenin in renal proximal tubule cells, Am. J. Physiol. Renal Physiol. 298 (2010) F1263–1275. [9] T. Okada, J. Wada, K. Hida, J. Eguchi, I. Hashimoto, M. Baba, A. Yasuhara, K. Shikata, H. Makino, Thiazolidinediones ameliorate diabetic nephropathy via cell cycle-dependent mechanisms, Diabetes 55 (2006) 1666–1677. [10] Y.J. Liang, J.H. Jian, C.Y. Chen, C.Y. Hsu, C.Y. Shih, J.G. Leu, L-165,041, troglitazone and their combination treatment to attenuate high glucose-induced receptor for advanced glycation end products (RAGE) expression, Eur. J. Pharmacol. 715 (2013) 33–38. [11] J. Yang, Y. Zhou, Y. Guan, PPARgamma as a therapeutic target in diabetic nephropathy and other renal diseases, Curr. Opin. Nephrol. Hypertens. 21 (2012) 97–105. [12] L.M. Leesnitzer, D.J. Parks, R.K. Bledsoe, J.E. Cobb, J.L. Collins, T.G. Consler, R.G. Davis, E.A. Hull-Ryde, J.M. Lenhard, L. Patel, K.D. Plunket, J.L. Shenk, J.B. Stimmel, C. Therapontos, T.M. Willson, S.G. Blanchard, Functional consequences of cysteine modification in the ligand binding sites of peroxisome proliferator activated receptors by GW9662, Biochemistry 41 (2002) 6640–6650. [13] B. Thisse, M. el Messal, F. Perrin-Schmitt, The twist gene: isolation of a Drosophila zygotic gene necessary for the establishment of dorsoventral pattern, Nucleic Acids
8
Biomedicine & Pharmacotherapy 118 (2019) 109346
Z. Wang, et al.
K.W. Kim, K. Lee, B.J. Kim, Protective effects of vildagliptin against pioglitazoneinduced bone loss in type 2 diabetic rats, PLoS One 11 (2016) e0168569. [42] M.P. Rodriguez, Z.M. Emond, Z. Wang, J. Martinez, Q. Jiang, M.R. Kibbe, Role of metabolic environment on nitric oxide mediated inhibition of neointimal hyperplasia in type 1 and type 2 diabetes, Nitric Oxide 36 (2014) 67–75. [43] J. Hempe, R. Elvert, H.L. Schmidts, W. Kramer, A.W. Herling, Appropriateness of the Zucker Diabetic Fatty rat as a model for diabetic microvascular late complications, Lab Anim. 46 (2012) 32–39.
Impact of high glucose and transforming growth factor-beta on bioenergetic profiles in podocytes, Metabolism 61 (2012) 1073–1086. [39] C. Zhu, S. Huang, Y. Yuan, G. Ding, R. Chen, B. Liu, T. Yang, A. Zhang, Mitochondrial dysfunction mediates aldosterone-induced podocyte damage: a therapeutic target of PPARgamma, Am. J. Pathol. 178 (2011) 2020–2031. [40] T. Yamanouchi, Concomitant therapy with pioglitazone and insulin for the treatment of type 2 diabetes, Vasc. Health Risk Manag. 6 (2010) 189–197. [41] Y.S. Eom, A.R. Gwon, K.M. Kwak, J.Y. Kim, S.H. Yu, S. Lee, Y.S. Kim, I.B. Park,
9