Piscroside C, a novel iridoid glycoside isolated from Pseudolysimachion rotundum var. subinegrum suppresses airway inflammation induced by cigarette smoke

Author's Accepted Manuscript

Piscroside C, a novel iridoid glycoside isolated from Pseudolysimachion rotundum var. subinegrum suppresses airway inflammation induced by cigarette smoke Hyuk-Hwan Song, In-Sik Shin, So Yeun Woo, Su Ui Lee, Min Hee Sung, Hyung Won Ryu, DooYoung Kim, Kyung-Seop Ahn, Hyeong-Kyu Lee, Dongho Lee, Sei-Ryang Oh www.elsevier.com/locate/jep

PII: DOI: Reference:

S0378-8741(15)00309-8 http://dx.doi.org/10.1016/j.jep.2015.04.043 JEP9486

To appear in:

Journal of Ethnopharmacology

Cite this article as: Hyuk-Hwan Song, In-Sik Shin, So Yeun Woo, Su Ui Lee, Min Hee Sung, Hyung Won Ryu, Doo-Young Kim, Kyung-Seop Ahn, Hyeong-Kyu Lee, Dongho Lee, Sei-Ryang Oh, Piscroside C, a novel iridoid glycoside isolated from Pseudolysimachion rotundum var. subinegrum suppresses airway inflammation induced by cigarette smoke, Journal of Ethnopharmacology, http: //dx.doi.org/10.1016/j.jep.2015.04.043 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Piscroside C, a novel iridoid glycoside isolated from Pseudolysimachion rotundum var. subinegrum suppresses airway inflammation induced by cigarette smoke

Hyuk-Hwan Song

a,†

, In-Sik Shin

b,†

, So Yeun Woo a,c, Su Ui Lee a, Min Hee Sunga, Hyung

Won Ryu a, Doo-Young Kim a, Kyung-Seop Ahn a, Hyeong-Kyu Lee a, Dongho Lee c, and Sei-Ryang Oh a,*

a

Natural Medicine Research Center, Korea Research Institute of Bioscience & Biotechnology,

30 Yeongudanji-ro, Ochang-eup, Cheongwon-gu, Cheong-ju, Chungbuk, 363-883, Republic of Korea b

College of Veterinary Medicine, Chonnam National University, 77 Yongbong-ro, Buk-gu,

Gwangju 500-757, Republic of Korea c

Department of Biosystems and Biotechnology, College of Life Sciences and Biotechnology,

Korea University, Seoul, 136-713, Republic of Korea

†

These authors contributed equally to this work

*Corresponding Author: Sei-Ryang Oh; Natural Medicine Research Center, Korea Research Institute of Bioscience & Biotechnology, 30 Yeongudanji-ro, Ochang-eup, Cheongwon-gu, Cheong-ju, Chungbuk 363883, Republic of Korea. Tel.: +82 43 240 6110; Fax: +82 43 240 6029. E-mail address: [email protected] (S.-R. Oh).

ABSTRACT Ethnopharmacological

relevance:

Pseudolysimachion

rotundum

var.

subintegrum

(Speedwell, Plantaginaceae) is used as a traditional herbal medicine for treating bronchitis, cough and asthma in Korea, China, Russia, and Europe. Aim of the study: In this study, we investigated the protective effects of the novel iridoid glycoside, piscroside C (compound 1) isolated from the methanolic extract of P. rotundum var. subintegrum against inflammatory responses using a cigarette smoke induced chronic obstructive pulmonary disease (COPD) and TNF-Į-stimulated human airway epithelial NCIH292 cells. Methods and Methods: The novel iridoid glycoside piscroside C was isolated from the methanolic extract of Pseudolysimachion rotundum var. subintegrum. The chemical structure was established by NMR, HRESIMS, and optical rotation. In in vivo experiment, the mice received 1 h of cigarette smoke for 3 days. Piscroside C was administered to mice by oral gavage 1 h before cigarette smoke exposure for 3 days. In in vitro experiment, we evaluated the effect of piscroside C on proinflammatory mediators in H292 cells stimulated with TNF-Į. Results: Piscroside C significantly reduced the neutrophil influx, reactive oxygen species production, IL-6, TNF-Į, and elastase activity in bronchoalveolar lavage fluid in COPD animals. In addition, piscroside C attenuated NF-țB and IțB phosphorylation, leading to reduced recruitment of inflammatory cells into the lung tissue. Consistent with the results of in vivo experiment, piscroside C significantly inhibited the expression of inflammatory cytokines (IL-6, IL-8 and IL-1ȕ) by inhibiting NF-țB activation, as resulting decrease in the phosphorylation of IKKȕ, IțBĮ and TAK1 in TNF-Į-stimulated H292 cells. Conclusion: These findings indicate that piscroside C effectively inhibits inflammatory responses, which is an important process in the development of COPD through suppression

of IKK/NF-țB activation. Our study suggest that piscroside C might represent a useful therapeutic for the treatment of inflammatory airway disease.

1. Introduction Iridoids represent a large group of cyclopenta[c]pyran monoterpenoids that are abundant in dicotyledonous plant families, and especially in sympetalous families, including Apocynaceae, Scrophulariaceae, Verbenaceae, Lamiaceae, Loganiaceae, and Plantaginaceae (Villaseñor, 2007). Some iridoid glucosides such as harpagoside, picroside II, and catalposide, isolated from these plants, have shown a wide range of pharmacological effects, including neuroprotective (Kim et al., 2002), anti-inflammatory, and immunomodulation activities (García et al., 1996; Kim et al., 2004; Li et al., 2010). Pseudolysimachion rotundum var. subintegrum (Plantaginaceae) is a perennial herb found in Korea, Japan, China, Russia, and Europe (He et al., 2009). P. linariifolium and related species (P. longifolium, P. rotundum var. subintegrum) have been used as traditional phytomedicine for the treatment of bronchitis, cough, and asthma (Kim, 1984). We previously reported that verproside, a catalpol derivative that is a main compound of these species, has anti-asthma activity (Oh et al., 2006). The prevalence of chronic obstructive pulmonary disease (COPD) has markedly increased worldwide and has become a significant health problem. COPD is characterized by airflow limitation and loss of lung function that is poorly reversible (Barnes, 2004) and can ultimately result in death. The development of COPD is associated with exposure to various risk factors and particularly cigarette smoke is considered the greatest risk factor for the development of COPD. Cigarette smoke contains toxic chemicals that induce lung inflammation by recruiting inflammatory cells into the airway and lung parenchyma (Terashima et al., 1997). Neutrophils release various mediators, including cytotoxic proteins,

free radicals, proinflammatory cytokines, chemokines, and proteolytic enzymes such as elastase (Hoenderdos and Condliffe, 2013; Profita et al., 2010). Increased numbers of neutrophils recruited following cigarette smoke exposure, aggravate airway inflammation resulting in structural damage via increased levels of proinflammatory mediators and elastase, which can lead to emphysema. Therefore, inhibiting the accumulation of neutrophils is a potential therapeutic target for treating COPD. TNF-Į is a potent cytokine associated with inflammatory disease of lung including COPD (Mukhopadhyay et al., 2006) and induce expression of proinflammatory cytokines including IL-6, IL-8 and IL-1ȕ (Matera et al., 2010) through activation of NF-țB transcription factor known as therapeutic target of asthma and COPD (Edwards et al., 2009). In particular, TNF-Į-overexpressed animal models show pathological features of COPD such as infiltration of the inflammatory cell, pulmonary fibrosis and emphysema (Lundblad et al., 2005). Moreover, TNF-Į inhibitors are considered to be potential new drug for asthma and COPD management (van der Vaart et al., 2005). Thus, TNF-Į/NF-țB signaling pathway is believed to play a central role to demonstrate pathological phenomena of COPD (Matera et al., 2010). Herein are reported the structural characteristics of piscroside C isolated from P. rotundum var. subintegrum and investigate its biological effects, which include neutrophil recruitment, increased reactive oxygen species, IL-6 and TNF-Į production, and elastase activity, in bronchoalveolar lavage fluid (BALF) from a COPD murine model. In addition, the effects of piscroside C were explored the expression levels of TNF-Į-induced inflammatory cytokines (IL-6, IL-8 and IL-1ȕ) in human airway epithelial NCI-H292 cells and tried to uncover the underlying mechanism.

2. Materials and methods 2.1. General experimental procedures Melting points were determined on a Kofler microhostage. Optical rotation was measured with a Jasco P-1020 polarimeter. UV data were obtained on UV-VIS 2450 spectrometer, and FT-IR spectra were taken using a Jasco FT/IR-4200. NMR spectra were recorded on a Varian UNITY 400 MHz FT-NMR spectrometer with tetramethylsilane as an internal standard. HRESIMS were performed on a Waters Q-TOF Premier spectrometer. Semiprepartive HPLC separation was conducted on a Gilson, pump 305 using a UV/VIS-155 detector. All solvents used for column chromatography were of analytical grade (SK Chemicals Co., Ltd. Seongnam-si, Korea), and solvents used for HPLC were of HPLC grade (SK Chemicals Co., Ltd.)

2.2. Plant material The whole plant of P. rotundum var. subintegrum were collected at Eumsung, Chungbuk, Korea, in September 2011 and identified by Min-Ha Kim from National institute of biological resources. A voucher specimen (KRIB 0020697) was deposited at the Plant Extract Bank of KRIBB in Daejeon, Korea.

2.3. Extraction and isolation The dried stems and leaf of P. rotundum var. subintegrum (2.0 kg) were extracted with MeOH at room temperature three times to obtain 198.7 g of solid extract. The MeOH extract (20 g) was subjected to preparative reversephase chromatography (Zeoprep C18, 75 ȝm, 200 × 250 mm, Zeochem, Louisville, U.S.A) and was eluted isocratic using 25% MeOH in H2O solution. The fractions (f1-f4) were collected and concentrated on a rotary evaporator under reduced pressure. The f2 was chromatographed on medium pressure liquid chromatography

column of RP C-18 (Zeoprep C18, 10 ȝm, 20 × 250 mm, Zeochem) eluting with 25 % MeOH in H2O solution to yield compound 2 (135 mg). The f3 was chromatographed on MPLC column of RP C-18 (Zeoprep C18, 10 ȝm, 20 × 250 mm, Zeochem, Louisville, U.S.A) eluting with a gradient mixture of MeOH-water solution (2:8, 3:7, 4:6, 10:0) to yield five subfractions (f2a, f2b, f2c, f2d, and f2e). The fraction f2b was separated by semipreparative HPLC (Atlantis T3 5 ȝm ODS, 19 × 250 mm, Waters, Miliford, U.S.A., 18% MeCN in H2O) to afford compound 3 (6.8 mg), 4 (24.3 mg), and 6 (10.7 mg). Subfraction f2c was subjected to semipreparative HPLC (Synergy Polar-RP 4 ȝm, 21.2 × 250 mm, Phenomenex, Torrance, CA, U.S.A., 22% MeCN in H2O) to give 5 (3, 12.4 mg) and 1 (8.3 mg). Subfraction f2c was further separated by Sephadex LH-20 (90% MeOH in H2O) to give 7 (6.1 mg). Piscroside C (compound 1): light brownish amorphous powder; [Į]20D -30˚ (c 0.2, MeOH); UV (MeOH) Ȝmax (log ഍) 265 (6.42), 288 (6.45) nm; IR (KBr) Ȟmax 3412, 2941, 2860, 1692, 1607, 1228, 1077, 993 cm−1; 1H NMR (400 MHz) and 13C NMR (100 MHz) data (DMSO), see Tables 1; HRESIMS m/z 533.1035 [M–H]–(calcd for C22H26O13Cl, m/z 533.1062); obsd isotopic peak (3:1); purity >98% by HPLC analysis.

2.4. COPD mouse model Specific pathogen-free male C57BL/6N mice (6 weeks old, weight 20–25g) were purchased from Koatech Co. (Pyeongtaek, Republic of Korea) and used after a quarantine and acclimatization period of 2 weeks. Mice were provided with sterilized tap water and standard rodent chow. All experimental procedures were approved by the Institutional Animal Care and Use Committee of Korea Research Institute of Bioscience and Biotechnology. The mice were divided into five groups: normal control (NC), COPD (cigarette smoke with LPS intranasal instillation), Rof (10 mg/kg of roflumilast, p.o. + cigarette smoke with LPS intranasal instillation), and Pis-15 and 30 (15 mg/kg and 30 mg/kg

of piscroside C, p.o. + cigarette smoke with LPS intranasal instillation, respectively). The smoke was generated from 3R4F research cigarettes (Kentucky reference cigarette, University of Kentucky, USA), containing 11.0 mg of total particulate matter, 9.4 mg of tar, and 0.76 mg of nicotine per cigarette. Exposure of cigarette smoke (one puff/min, 35 mL puff volume over 2 s, every 60 s, 8 cigarettes per day) was conducted using a cigarette smoke generator (Daehan Biolink, Incheon, Republic of Korea). The mice received 1 h of cigarette smoke exposure in an exposure chamber (50 cm × 30 cm × 30 cm) for 3 days. Roflumilast and piscroside C were administered to mice by oral gavage 1 h before cigarette smoke exposure for 3 days. LPS was intranasally instilled (10 ȝg dissolved in 50 ȝL distilled water) under anesthesia 1 h after the final exposure to cigarette smoke.

2.5. Inflammatory cell count in bronchoalveolar lavage fluid (BALF) Twenty-four hours after LPS intranasal instillation, the mice were sacrificed by intraperitoneal injection of pentobarbital (50 mg/kg; Hanlim Pharm. Co., Seoul, Korea) and a tracheostomy was performed. To obtain the BALF, briefly, ice-cold PBS (0.5 mL) was infused into the lung and withdrawn via tracheal cannulation three times (total volume 1.5 mL). To determine differential cell counts, cytospins of BALF were generated by centrifuging 100 ȝL of BALF onto slides using a Cytospin (Hanil Science Industrial, Seoul, Korea) (200 × g, 4°C, 10 min). The slides were dried, and the cells were fixed and stained using Diff-Quik® staining reagent (B4132-1A; IMEB Inc., Deerfield, IL), according to the manufacturer’s instructions. The supernatant obtained from the BALF was stored at -70°C until further biochemical analysis.

2.6. Analysis of BALF The induction of oxidative stress was monitored using 2’,7’-dichloroflurorescein

diacetate (DCF-DA, Sigma-Aldrich, Carlsbad, CA), which is converted into the highly fluorescent DCF by cellular peroxides, including hydrogen peroxide. Briefly, BALF cells were washed with PBS, and the total cell (5 × 103) counts were determined. The BALF cells were treated with 20 ȝM DCF-DA for 10 min at 37°C. Intracellular ROS activity was measured by measuring the fluorescence at 488 nm excitation and 525 nm emission on a fluorescence plate reader (Perkin–Elmer, Waltham, MA). To measure neutrophil elastase activity, BALF was reacted with N-succinyl-(Ala)3-p-nitroanilide (Sigma-Aldrich) at 37°C for 90 min, as previously described.30 The absorbance was measured at 405 nm using an ELISA reader (Molecular Devices, Sunnyvale, CA). In addition, BALF contents were evaluated using a protein assay kit (Bradford assay, Bio-Rad, Hercules, CA). The absorbance was measured at 595 nm using an ELISA reader (Molecular Devices). The levels of IL-6 and TNF-Į (Invitrogen, Carlsbad, CA) in the BALF were quantified by ELISA according to the manufacturer’s protocols. The absorbance was measured at 450 nm using an ELISA reader (Molecular Devices).

2.7. Histological examination After the BALF samples were obtained, lung tissue was fixed in 10% (v/v) neutral buffered formalin. The tissues were embedded in paraffin, sectioned at 4-ȝm thickness, and stained with hematoxylin and eosin solution to allow estimation of the inflammatory response. Photomicrographs were obtained using a Photometric Quantix digital camera running a Windows program, and montages were assembled in Adobe Photoshop 7.0. The images were corrected for brightness and contrast, but were not otherwise manipulated. Quantitative analysis for airway inflammation was determined using Image analyzer (Molecular Devices, Sunnyvale, CA).

2.8. Cell preparation and culture NCI-H292 cells (CRL-1848), a human airway epithelial cell line, were purchased from the American Type Culture Collection. NCI-H292 cells were grown in growth medium [GM; RPMI 1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Hyclone) and 100 units/ml penicillin plus 100µg/ml streptomycin] at 37

in a humidified 5% CO2

atmosphere. For treatment of piscroside C, NCI-H292 cells (1×104 cells/1 cm2 well) were seeded in GM and incubated for 16 h, and then the medium was changed into RPMI supplemented with 0.1% fetal bovine serum (Hyclone) and 100 units/ml penicillin plus 100µg/ml streptomycin for 16 h. TNF-Į was purchased from the Peprotech (Rocky Hill, NJ, USA).

2.9. Immunoblotting Lung tissue was homogenized (1/10 [w/v]) using a homogenizer with a tissue lysis/extraction reagent (Sigma-Aldrich) containing a protease inhibitor cocktail (SigmaAldrich). NCI-H292 cells were seeded and cultured on 6 well plates for treatment of piscroside C. Cells were pretreated with corresponding concentration of piscroside C for 2 h and then were treated with TNF-Į (20 ng/mL) for 0.5 h. Proteins prepared and loaded as described in “materials and methods” of reference (Lee et al., 2014). The following primary antibodies and dilutions were used: anti-ȕ-actin (1:3000 dilution; Cell Signaling, Denver, MA), anti-p-p65 (1:1000 dilution; Cell signaling), anti-p65 (1:1000 dilution; Cell Signaling), anti-p-IțB (1:1000 dilution; Santa Cruz, Dallas, TX), anti-IțB (1:1000 dilution; Santa Cruz), anti-p-IKKĮ/ȕ(1:1000 dilution; Cell signaling), anti-p-TAK-1(1:1000 dilution; Cell signaling), anti-TAK-1(1:1000 dilution; Cell signaling), anti-GAPDH(1:1000 dilution; Santa Cruz) and anti-C23(1:1000 dilution; Santa Cruz). Immunoreactive bands were visualized using an enhanced chemiluminescence kit (Thermo Scientific, Waltham, MA). To determine

the relative ratio of protein expression, we measured densitometric band values using Multi Gauge software version 3.0.

2.10. Cell viability assay NCI-H292 cells were plated in 96-well plates in GM at a density of 5 × 103 cells/well. After 16 h, the cells were changed to medium including 0.1 % FBS for 16 h, cells were incubated with piscroside C for 24 h. Cell viability was then measured in triplicate by using a Cell Counting Kit-8 (Dojindo Molecular Technologies, ML) according to the manufacturer’s protocol. Absorbance was measured by using a VERSA max microplate reader (Molecular Devices, USA) and the measured absorbance was converted to a percentage (%) to control value.

2.11. Evaluation of mRNA expression level Total RNA was isolated with TRIzol reagent (invitrogen) according to manufacturer’s protocol. The first strand cDNA was synthesized 2 ȝg of total RNA and 1 ȝM Oligo-dT18 primer using Omniscript Reverse Transcriptase (Qiagen, CA). SYBR green-based quantitative PCR amplification was performed using the S1000 Thermal cycler real-time PCR system(Bio-rad, USA) and iQ SYBR Green supermix (Bio-Rad, USA) with first-strand cDNA diluted 1:25 and 20 pmol of primers according to the manufacturer’s protocols. The set of primers were used to amplify human specific products: IL-8 (forward) 5’ATGACTTCCAAGCTGGCCGTGGCT

-3’

and

(reverse)

5’-

TTATGAATTCTCAGCCCTCTTCAAAAA-3’; IL-6(forward) 5’-ATGCAATAACCACC CCTGAC-3’ and (reverse) 5’-ATCTGAGGTGCCCATGCTAC-3’; IL-1ȕ (forward) 5’AGCCAGGACAGTCAGCTC TC-3’ and (reverse) 5’-ACTTCTTGCCCCCTTTGAAT-3’. As quantitative controls, primers for human GAPDH were used: (forward) 5’- CAA AAG

GGT CAT CAT CTC TG -3’ and (reverse) 5’- CCT GCT TCA CCA CCT TCT TG -3’. The PCR conditions consisted of three segments (Kim et al., 2008). All reactions were run in triplicate, and data were analyzed by the 2−ǻǻCT method. Significance was determined by using two-tailed Student's t-test (P<0.05*; P<0.01**and P<0.001***).

2.12. Cytokine production by ELISA The NCI-H292 cells were plated in 24-well plates in GM at a density of 5 × 104 cells/well. After 16 h, the cells were changed to medium including 0.1 % FBS for 16 h, cells were incubated with piscroside C for 24 h. The supernatants were harvested and were determined cytokines levels with a commercially available human IL-6(BD Biosciences), IL8(BD Biosciences), and IL-1ȕ ELISA kit (R&D Systems). All procedures were performed according to the manufacturer's instructions.

2.13. Statistical analysis The data are expressed as the means ± standard error of the mean (SEM). Statistical significance was determined using analysis of variance (ANOVA) followed by a multiple comparison test with Dunnett adjustment. The P value < 0.05 was considered significant. In in vitro experiment, the significance was determined by using two-tailed Student's t-test.

3. Results and discussion A 100% methanol extract of P. rotundum var. subintegrum was subjected to a series of chromatographic procedures. One new compound was isolated and identified as a chlorinated iridoidal glucoside with seven catalpol derivatives; verproside (2), longifolioside A (3), catalposide (4), picroside II (5), isovanillyl catalpol (6), 6-O-veratroly catalpol (7) (Ahn et al., 2014; Jensen et al., 2010; Oh et al., 2006).

Piscroside C (compound 1) was derived as a light brownish powder, [Į]20D -30.0˚ (c 0.2, MeOH). The molecular formula was C22H26ClO13 as deduced from the quasimolecular 3:1 ion cluster obtained by HRESIMS (observed m/z 533.1035 [M-H]-). The IR spectrum of piscroside C displayed absorption bands of a hydroxy group at 3412 cm-1 and Į,ȕ-unsaturated ester carbonyl at 1692 cm-1. The

13

C and DEPT NMR spectra of piscroside C displayed 22

signals, of which nine were assigned to the C9-type iridoid aglycone moiety, the remaining 13 signals corresponded to a hexose sugar residue and a 3,4-dihydroxybenzoic acid group. The 1

H-NMR spectrum of piscroside C displayed an ABX system assigned to a 1,2,4-

trisubstituted aromatic ring [į 7.39 (1H, d, J=2.1 Hz, H-2"), 6.83 (1H, d, J=8.0 Hz, H-4"), 7.37 (1H, dd, J=2.1, 8.0 Hz, H-5")], two acetal protons [į 5.55 (1H, d, J=1.6 Hz, H-1), 5.30 (1H, d, J=2.4 Hz, H-3)], and an anomeric proton [į 4.50 (1H, d, J=7.6 Hz, H-1')]. The sugar moiety was identified as ȕ-D-glucopyranose with chemical shifts for H-1' and C-1' at įH 4.50 (J=7.6 Hz), įC 96.8. Their linkage position (C-3) was confirmed on the basis of chemical shifts of the anomeric protons. As shown in Fig. 1A, the 1H-1H COSY spectrum showed obvious W form long range coupling (J4=1.3) between H-7 (į 4.54) and H-10Į (į 3.56) and also a coupling (J4=1.0) between H-9 (į 2.55) and H-10ȕ (į 3.86), indicating that H-7 could be in the ȕ position. The acetyl linkage between C-3 and C-10 was confirmed by HMBC correlation (Fig. 1A) between H-10a, b (į 3.56, 3.86) and C-3 (į 93.5). Moreover, the HMBC correlations between H-1 (į 5.55) and C-1' (į 96.8) of glucose, as well as between H-6 (į 4.96) and C=O (į 165.6), indicated that the glucose should be attached to C-1 and the 3,4dihydroxybenzoic acid group to C-6 of the aglycone. The NOESY spectrum of piscroside C showed significant correlations between H-7 (į 4.54) and the ȕ-positioned H-9 (į 2.55) and also between H-3 (į 5.30) and H-7, which were both in the ȕ-position (Fig. 1B). The 1H and 13

C spectra of piscroside C were similar to those of piscroside A isolated from Neopicrorhiza

scrophulariiflora (Wang et al., 2006), except for the methoxyl group attached at the C-3", which was substituted by a hydroxy group. Neutrophils are key mediators in the development of COPD, and toxic compounds present in cigarette smoke cause their infiltration into the airways, which eventually induce pathophysiological alterations in the lung tissue (Stampfli and Takahashi, 2009). Indeed, increased neutrophil counts have been observed in sputum from COPD patients (Barnes, 2004). In the present study, mice with a COPD-like phenotype had a markedly increased number of neutrophil in bronchoalveolar lavage fluid (BALF). However, piscroside C-treated mice had significantly lower neutrophil influx in BALF compared with the COPD-induced mice (Fig. 2). These results suggest that piscroside C effectively suppressed the recruitment of neutrophils induced by cigarette smoke. Neutrophils secrete various stimulatory mediators, including reactive oxygen spices (ROS), proinflammatory cytokines, chemokines, and tissue lysis enzymes, resulting in aggravation of airway inflammation (Quint and Wedzicha, 2007). In particular, excess ROS production accelerated the development of COPD through activation of inflammatory signaling pathways such as those involving NF-țB (Bowler et al., 2004), and elastase secreted by neutrophils resulted in the destruction of normal alveolar structure, causing an emphysema-like phenotype (Vlahos et al., 2012). Piscroside C-treated mice significantly suppressed the elevated ROS production, BALF contents, and elastase activity induced by cigarette smoke (Fig. 3A–C). In addition, COPD mice had markedly increased levels of IL-6 and TNF-Į, whereas these cytokines were significantly reduced in piscroside C-treated mice compared with the COPD-induced mice. These results are consistent with those of studies using proinflammatory cytokines such as IL-6 and TNF-Į as indicators of chronic inflammation that exacerbate airway inflammation induced by cigarette smoke via activation of inflammatory pathways (Lundblad et al., 2005; Metcalfe et al., 2014). These results were

also supported by histological analysis for lung tissue. In this study, extensive inflammatory cell infiltration was observed in the lung tissue of COPD-induced mice. By contrast, treatment with piscroside C effectively suppressed the inflammatory cell infiltration compared with that observed 14in COPD mice (Fig. 4A and B). NF-țB is a transcription factor involved in acute and chronic inflammatory responses, which has a critical role in the expression of many proinflammatory genes (Baldwin, 2001). NF-țB is activated by a number of stimuli, including physical and chemical stimuli, oxidative stress, lipopolysaccharide (LPS), and proinflammatory cytokines (Li and Verma, 2002). These stimuli cause IțB phosphorylation, resulting in its degradation and the phosphorylation of NF-țB. Phosphorylated NF-țB translocates to the nucleus where it binds to promoter regions of proinflammatory genes, thus inducing the transcription of various inflammatory mediators (Edwards et al., 2009). Cigarette smoke is act as a potent stimulator of NF-țB signaling in the lungs and provokes severe inflammation induced by NF-țB-dependent production of cytokines, including TNF-Į and IL-6, and recruitment of neutrophils to the lung tissue, causing acute lung injury or emphysema (Metcalfe et al., 2014; Zhao et al., 2013). Against this background, modulation of NF-țB signaling is considered to be an important therapeutic target for neutrophilic airway inflammation induced by cigarette smoke (Edwards et al., 2009). In this study, piscroside C treatment effectively suppressed the elevated phosphorylation of NF-țB induced by cigarette smoke with a concomitant the reduction in IțB phosphorylation in lung tissue (Fig. 5A and B). Thus, inhibition of NF-țB activation caused by piscroside C led to reduced neutrophilic inflammation and the subsequent decrease in the levels of proinflammatory mediators. These findings indicate that the protective effects of piscroside C on COPD symptoms are closely related with the suppression of NF-țB activation.

Consistent with this result of in vivo, piscroside C pretreatment in the concentration range between 2.5 and 20 µM that had no effect on growth of human airway epithelial NCIH292 cell (Fig. 6A), suppressed mRNA and protein levels of TNF-Į-induced proinflammatory ctyokines including IL-6, IL-8 and IL-1ȕ (Fig. 6B and 6C). Moreover, piscoside C represses TNF-Į-induced NF-țB activation, as resulting decrease of the phosphorylation of IKKȕ, IțBĮ and TAK1 in NCI-H292 cells (Fig. 7A and 7B). These results indicate that piscroside C significantly inhibited the expression of TNF-Į-induced inflammatory cytokines by blocking the IKK/NF-țB activation pathway in H292 cells. Taken together, these results suggest that piscroside C obtained from P. rotundum var. subintegrum effectively suppressed the increased neutrophil count and activation of proinflammatory mediators in BALF and ameliorated inflammatory cell infiltration into lung tissue in cigarette smoke and LPS-induced COPD mice. These effects of piscroside C were possibly caused by reduced levels of NF-țB activation. In conclusion, these results suggest that piscroside C may have therapeutic potential for the suppression of neutrophilic inflammation, which is a crucial step in the development of COPD.

Acknowledgments This work was supported by the KRIBB Research Initiative Program (KGM1221413) and MOTIE (Ministry of Trade, Industry, and Energy) R&D program (TGC3241313).

References Baldwin, A.S.Jr., 2001. Series introduction: the transcription factor NF-țB and human disease. Journal of Clinical Investigation 107, 3-6. Barnes, P.J., 2004. Mediators of chronic obstructive pulmonary disease. Pharmacological Reviews 56, 515-548. Bowler, R.P., Barnes, P.J., Crapo, J.D., 2004. The role of oxidative stress in chronic obstructive pulmonary disease. COPD 1, 255-277. Edwards, M.R., Bartlett, N.W., Clarke, D., Birrell, M., Belvisi, M., Johnston, S.L., 2009. Targeting the NF-țB pathway in asthma and chronic obstructive pulmonary disease. Pharmacology & Therapeutics 121, 1-13. He, L.J., Liang, M., Hou, F.F., Guo, Z.J., Xie, D., Zhang, X., 2009. Ethanol extraction of Picrorhiza scrophulariiflora prevents renal injury in experimental diabetes via antiinflammation action. Journal of Endocrinology. 200, 347-355. Hoenderdos, K., Condliffe, A., 2013. The neutrophil in chronic obstructive pulmonary disease. American Journal of Respiratory Cell and Molecular Biology 48, 531-539. Jensen, S.R., Gotfredsen, C.H., Sebnem Harput, U., Saracoglu, I., 2010. Chlorinated iridoid glucosides from Veronica longifolia and their antioxidant activity. Journal of Natural Products 73, 1593-1596. Kim, J.K., 1984. Illustrated natural drugs encyclopedia. Namsandang, Seoul. p.141. Kim, J.M., Lee, S.U., Kim, Y.S., Min, Y.K., Kim, S.H., 2008. Baicalein stimulates osteoblast differentiation via coordinating activation of MAP kinases and transcription factors. Journal of Cellular Biochemistry. 104, 1906-1917. Kim, S.R., Lee, K.Y., Koo, K.A., Sung S.H., Lee, N.G., Kim, J., Kim, Y.C., 2002. Four new neuroprotective iridoid glycosides from Scrophylaria buergeriana roots. Journal of Natural Products 65, 1696-1699.

Kim, S.W., Choi, S.C., Choi, E.Y., Kim, K.S., Oh, J.M., Lee, H.J., Oh, H.M., Kim, S., Oh, B.S., Kim, K.C., Lee, M.H., Seo, G.S., Kim, T.H., Oh, H.C., Woo, W.H., Kim, Y.S., Pae, H.O., Park, D.S., Chung, H.T., Jun, C.D., 2004. Catalposide, a compound isolated from Catalpa ovata, attenuates induction of interstinal epithelial proinflammatory gene expression and reduces the severity of trinitrobenzene sulfonic acid-induced colitis in mice. Inflammatory Bowel Diseases 10, 564-572. Lee, S.U., Ahn, K.S., Sung, M.H., Park, J.W., Ryu, H.W., Lee, H.J., Hong, S.T., Oh, S.R., 2014. Indacaterol inhibits tumor cell invasiveness and MMP-9 expression by suppressing IKK/NF-țB activation. Molecules and cells. 37, 585-591. Lee, Y.N., Yoo, J.S., Shin, D.H., Ryoo, B.H. Ahn, K.S., Oh, S.R., Lee, H.K., Shin, I.S., Kim, D.Y., Kwon, O.K., Song, H.H., Kim, S.H., Lee, S.U., 2014. The composition comprising a purified extract isolated from Psudolysimachion rotundum var. subintegrum containing abundant amount of active ingredient or the compounds isolated therefrom, as an active ingredient for preventing or treating chronic obstructive pulmonary disease and the use thereof. PCT Patent PCT/KR2014/003080. Li, Q., Li, Z., Xu, X.Y., Guo, Y.L., Du, F., 2010. Neuroprotective properties of picroside II in a rat model of focal cerebral ischemia. 2010. International Journal of Molecular sciences. 11, 4580-4590. Li, Q., Verma, I.M., 2002. NF-țB regulation in the immune system. Nature Reviews Immunology 2, 725-734. Lundblad, L.K., Thompson-Figueroa, J., Leclair, T., Sullivan, M.J., Poynter, M.E., Irvin, C.G., Bates, J.H., 2005. Tumor necrosis factor-alpha overexpression in lung disease: a single cause behind a complex phenotype. American Journal of Respiratory and Critical Care Medicine 171, 1363-1370.

Matera, M.G., Calzetta, L., Cazzola, M., 2010. TNF-alpha inhibitors in asthma and COPD: we must not throw the baby out with the bath water. Pulmonary Pharmacology & Therapeutics 23, 121-128. Metcalfe, H.J., Lea, S., Hughes, D., Khalaf, R., Abbott-Banner, K., Singh, D., 2014. Effects of cigarette smoke on Toll-like receptor (TLR) activation of chronic obstructive pulmonary disease (COPD) macrophages. Clinical and Experimental Immunology 176, 461-472. Mukhopadhyay, S., Hoidal, J.R., Mukherjee T.K., 2006. Role of TNFĮ in pulmonary pathophysiology. Respiratory Research 7, 125. Oh, S.R., Lee, M.Y., Ahn, K., Park, B.Y., Kwon, O.K., Joung, H., Lee, J., Kim, D.Y., Lee, S., Kim, J.H., Lee, H.K., 2006. Suppressive effect of verproside isolated from Pseudolysimachion logifolium on airway inflammation in a mouse model of allergic asthma. International Immunopharmacology 6, 978-986. Profita, M., Sala, A., Bonanno, A., Riccobono, L., Ferraro, M., La Grutta, S., Albano, G.D., Montalbano, A.M., Gjomarkaj, M., 2010. Chronic obstructive pulmonary disease and neutrophil infiltration: role of cigarette smoke and cyclooxygenase products. American Journal of Physiology: Lung Cellular and Molecular Physiology 298, L262-L269. Quint, J.K., Wedzicha, J.A., 2007. The neutrophil in chronic obstructive pulmonary disease. Journal of Allergy and Clinical Immunology 119, 1065-1071. Stampfli, M.R., Takahashi, K., 2009. How cigarette smoke skews immune responses to promote infection, lung disease and cancer. Nature Reviews Immunology 9, 377-384. Terashima, T., Wiggs, B., English, D., Hogg, J.C., van Eden, S.F., 1997. Phagocytosis of small carbon particles (PM10) by alveolar macrophages stimulates the release of polymorphomuclear leukocytes from bone marrow. American Journal of Respiratory and Critical Care Medicine. 155, 1441-1447.

van der Vaart, H., Koëter, G.H., Postma, D.S. Kauffman, H.F., Ten Hacken, N.H., 2005. First study of infliximab treatment in patients with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 172, 465–469. Villaseñor, I.M., 2007. Bioactivities of iridoids. Anti-inflammatory & Anti-Allergy Agents in Medicinal Chemistry 6, 307-314. Vlahos, R., Wark, P.A., Anderson, G.P., Bozinovski, S., 2012. Glucocorticosteroids differentially regulate MMP-9 and neutrophil elastase in COPD. PLoS One 7, e33277. Wang, H., Wu, F.H., Xiong, F., Wu, J.J., Zhang, L.Y., Ye, W.C., Li, P., Zhao, S.X., 2006. Iridoids from Neopicrorhiza scrophulariiflora and their hepatoprotective activities in vitro. Chemical and Pharmaceutical Bulletin 54, 1144-1149. Zhao, Y., Xu, Y., Li, Y., Xu, W., Luo F., Wang, B., Pang, Y., Xiang, Q., Zhou, J., Wang, X., Liu, Q., 2013. NF-țB-mediated inflammation leading to EMT via miR-200c is involved in cell transformation induced by cigarette smoke extract. Toxicology Sciences 135, 265-276.

Table 1. NMR spectroscopic data (400 MHz, DMSO-d6) for compound 1 (piscroside C) Position

įC, type

1

90.6, CH

5.55, d (1.6)

3

93.5, CH

5.30, d (2.4)

4Į

32.9, CH2

2.38, dd (13.4, 8.2)

įH, mult. (J in Hz)

1.94, dd (13.4, 2.4)

4ȕ 5

33.0, CH

2.26, ddd (9.6, 8.8, 2.2)

6

85.7, CH

4.96, dd (8.8, 2.2)

7

69.2, CH

4.54, d (8.8)

8

78.3, C

9

46.4, CH

2.55, br d (10.0)

10Į

60.8, CH2

3.56, d (12.4) 3.86, d (12.4)

10ȕ 1'

96.8, CH

4.50, d (7.6)

2'

73.0, CH

2.91, d (8.4)

3'

76.5, CH

3.13, m

4'

70.1, CH

3.04, t (9.2)

5'

77.1, CH

3.13, m

6a'

60.9, CH2

3.69, d (8.8) 3.43, dd (12.0, 5.6)

6b' 1"

119.8, C

2"

116.4, CH

3"

145.1, C

4"

150.9, CH

6.83, d (8.0)

5"

115.4, C

7.37, dd (8.0, 2.1)

6"

122.1, CH

7"

165.6, CH

7.39, d (2.1)

Table 2. The effects of piscroside C on proinflammatory cytokines in cigarette smoke and LPS induced COPD mice Groups

IL-6 (pg/mL)

TNF-Į (pg/mL)

NC

0.00 ± 0.0

3.37 ± 1.9

COPD

18.06 ± 4.2#

199.81 ± 20.0#

Rof

11.95 ± 3.6*

139.04 ± 38.7*

Pis-15

11.59 ± 2.8*

163.26 ± 26.3*

Pis-30 8.92 ± 3.3* 144.67 ± 17.2* NC, normal control mice treated with PBS only; COPD, cigarette smoke and LPS exposure; Rof, 10 mg/kg of roflumilast, p.o. + cigarette smoke and LPS exposure; Pis 15 and 30, 15 mg/kg and 30 mg/kg of piscroside C, p.o., respectively + cigarette smoke and LPS exposure. #

*

Significantly different from NC, P < 0.05.

Significantly different from COPD, P < 0.05

Figure captions Fig. 1. COSY and Key HMBC correlation (A) and Key NOE correlations (B) of piscroside C (compound 1, R; 3,4-dihydroxybenzoic acid, GlcO; O-glucoside).

Fig. 2. The effects of piscroside C on the inflammatory cell count in BALF. Cells were isolated by centrifugation and stained with Diff-Quik® staining reagent. The cell numbers were counted at 400× magnification using a light microscope. NC, normal control mice treated with PBS only; COPD, cigarette smoke and LPS exposure; Rof, 10 mg/kg of roflumilast, p.o. + cigarette smoke and LPS exposure; Pis 15 and 30, 15 mg/kg and 30 mg/kg of piscroside C, p.o., respectively + cigarette smoke and LPS exposure. #Significantly different from NC, P < 0.05; *significantly different from COPD group, P < 0.05.

Fig. 3. The effect of piscroside C on ROS production (A), BALF contents (B), and elastase activity (C) in BALF induced by cigarette smoke and LPS exposure. #Significantly different from NC, P < 0.05; *significantly different from the COPD-induced group, P < 0.05.

Fig. 4. Representative figure for H&E stain (A) and quantitative analysis for inflammation responses (B) in lung tissue by treated piscroside C in COPD mouse induced by cigarette smoke and LPS. #Significantly different from NC, P < 0.05; *significantly different from COPD group, P < 0.05.

Fig. 5. The effects of piscroside C on protein expression (A) and densitometric value (B) of IțB and NF-țB induced by cigarette smoke and LPS exposure. #Significantly different from NC, p < 0.05; *significantly different from COPD group, P < 0.05.

Fig. 6. Effect of piscroside C on TNF-Į-induced IL-6, IL-8 and IL-1ȕ expression in NCIH292 cells. (A) Effect of piscroside C on the cell growth. (B) effect of piscroside C on the mRNA expression of TNF-Į-induced IL-6, IL-8 and IL-1ȕ. (C) effect of piscroside C on the protein expression of TNF-Į-increased IL-6, IL-8 and IL-1ȕ. Statistical significance was determined using a two-tailed Student's t-test. These results are representative of three independent experiments.* Significantly different from TNF-Į-stimulated-H292 cells, P < 0.05.

Fig. 7. Effect of piscroside C on TNF-Į-activated IKK/NF-țB signal pathway in NCI-H292 cells. (A) Effect of piscroside C on translocation of NF-țBp65. (B) Effect of piscroside C on p-IKKĮ/ȕ, p-IțBĮ, p-TAK1 and TAK1 expression. GAPDH was used as a protein loading control in western blot. The results shown are representative of three independent experiments. Numbers at bottom indicate relative intensity of band (fold of control) estimated by using Multi Gauge software version 3.0.

*Graphical Abstract (for review)

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7