- Email: [email protected]
Plasmodium falciparum: The calmodulin gene is not amplified or overexpressed in chloroquine resistant or sensitive isolates
EXPERIMENTAL
PARASITOLOGY
73, 269-275 (1991)
Plasmodium falciparum: The Calmodulin Gene is Not Amplified or Overexpressed in Chloroquine Resistant or Sensitive Isolates’ ALAN F. COWMAN'AND The Walter and Eliza Hall Institute
of Medical
DENISE GALATIS Research,
Melbourne
3050, Australia
COWMAN, A. F., AND GALATIS, D. 1991. Plasmodium falciparum: The calmodulin gene is not amplified or overexpressed in chloroquine resistant or sensitive isolates. Experimental Parasitology 73, 269-275. The in vitro growth of Plasmodium falciparum is sensitive to some calmodulin antagonists and these compounds show antagonism with classic antimalarials such as chloroquine suggesting competition for the same drug binding site. In order to ask if calmodulin is involved in resistance to chloroquine we cloned the calmodulin gene of P. falciparum. We show that it is encoded by a single gene and that the putative protein is highly homologous to calmodulin from other eukaryotes. The calmodulin gene is encoded on chromosome 14 and contains a single intron of 506 bp that has the appropriate donor and acceptor splice sites. Two major transcripts of similar size are encoded by this gene. The sequence of the gene is identical and the calmodulin protein is expressed approximately equally in chloroquine resistant and sensitive isolates of P. falciparum suggesting that alterations in this protein play no role in the mechanism of chloroquine resistance in the isolates tested. a 1991 Academic Press, Inc. INDEX DESCRIPTORS AND ABBREVIATIONS: Malaria; Calmodulin; Chromosome; Polymerase chain reaction (PCR); Glutathione S-transferase (GST); Pulsed field gradient electrophoresis (PFG).
modulin may be the target of some antimaThe calcium binding protein calmodulin larial drugs since chloroquine, quinine, and quinicrine do have some apparent antiis found in all eukaryotic cells and its secalmodulin activity (Scheibel et al., 1987). quence is highly conserved throughout evIt has also been shown that the potency of olution (Baba et al. 1984; Klee et al. 1980). calmodulin antagonists is proportional to Calmodulin is important in many metabolic inhibition of growth of the malarial parasite activities and is essential for normal cell Plasmodium falciparum and these comgrowth and division (Cheung 1980). One of pounds show antagonism with classic antithe many roles of the calmodulin-calcium malarials such as chloroquine. complex is to regulate cyclic nucleotides We have isolated the gene for calmodulin and therefore it is responsible for the coufrom P. falciparum and analyzed its strucpling of the two second messengers, CAMP ture and expression. P. falciparum has a and calcium. The calmodulin gene(s) from single gene that is highly homologous to many organisms including humans calmodulin from other eukaryotes. We also (Wawrzynczak and Perham 1984), Trypashow that the expression of the calmodulin nosoma brucei (Tschudi et al. 198% and gene and its protein product is indistinSaccharomyces cerevisiae (Davis et al. guishable in chloroquine resistant and sen1986) have been sequenced. sitive P. falciparum, suggesting that calIt has been previously suggested that calmodulin is not involved in the mechanism of chloroquine resistance. INTRODUCTION
’ The sequence data reported herein has been submitted to EMBL and assigned Accession Number X56950. 2 To whom correspondence should be addressed.
MATERIALS AND METHODS Parasites.
The P. falciparum
isolate FC27 was ob-
269 0014-4894191$3.00 Copyright All rights
Q 1991 by Academic Press, Inc. of reproduction in any form reserved.
270
COWMAN
AND
tamed through a collaboration with the Papua-New Guinea Institute of Medical Research. 3D7 (the parent was obtained from an airport worker in Amsterdam) and HB3 were obtained from D. Walliker, University of Edinburgh, Edinburgh. FAC8 is a cloned line derived from ITG2F6, a cloned Brazilian line which was obtained from the laboratory of L. Miller, N.I.H. Bethesda. CSL2 originated from Thailand and was obtained from Margaret Maloney at the Commonwealth Serum Laboratories, Melbourne. VI (Vietnam) was obtained from R. Howard, DNAX. Parasites were grown in RPMI-Hepes, 5.8% NaHCO, with 10% human serum as described (Trager and Jensen, 1976). Polymerase chain reaction and sequencing. The gene for calmodulin from P. falciparum was obtained by using oligonucleotides designed from known calmoduhn sequences in PCRs to amplify the gene sequence (Saiki et a/., 1988). The oligonucleotide sequences used were ATGGC(T/A)GATCAA(C/ T)T(A/T)(A/T)C(T/A)(G/A)A(A/T)GAACA(A/G) at the 5’ end and the antisense primer CATCATTT(T/ G)(T/A)ACAAATICTTCATA at the 3’ end. The 5’ and 3’ ends of the gene were then obtained by using appropriate oligonucleotide primers in inverted PCR (Triglia et a/. 1988)to amplify the rest of the gene. The PCR fragments were isolated and cloned into Ml3 vectors and the full calmodulin gene was sequenced on both strands. The calmodulin gene was sequenced from other isolates by amplifying the full gene using oligonucleotide primers (5’, CCTAATAGAAATATATCAATG and 3’, CTTATTTATTTTATTCTGATATTTAAAAATCA) and cloning the PCR product into Ml3 vectors. DNA and RNA analysis. DNA and RNA was obtained as previously described (Coppel et al. 1983). DNA was digested with the appropriate restriction enzymes, fractionated on 0.8% agarose gels, and transferred to nylon membranes; 20 pg of total RNA was fractionated on 1.5% agarose gels in E buffer (36 m&Z Na, HP0,/4 mM NaH,PO,) and 6% formaldehyde and transferred to nylon membranes. All filters were hybridized in 5 x SSC (1 x SSC = 15mM NaCl/lSO mM Na-citrate, pH 7)/1x Denhardt’s solution (0.02% FicolVO.OZ%bovine serum albumin)/O. 1% SDS1500mg herring sperm DNA at 65°C. PFG electrophoresis. PFG electrophoresis was performed in a cantor-clamped homogenous electric field (CHEF) apparatus (Chu et a/. 1986). Running conditions were 70 V with pulse times of 17 min. The gel was stained with ethidium bromide and photographed on a 305nm wavelength transilluminator. The gel was exposed to uv light for 5 min to introduce breaks into the DNA, transferred to Hybond N, and hybridized with the appropriate probe using the conditions described above. Preparation
of affinity
pur$ed
antibodies
to cal-
GALATIS
mod&n. The region of the calmodulin gene from 585 to 960 bp was amplified with oligonucleotide primers and PCR and the fragment cloned into pGex-2 to produce an abundant fusion protein attached to GST (Smith and Johnson 1988). The fusion protein was affinity purified on a GST-agarose column. The protein eluted was used to raise antisera by injection into rabbits with Freund’s complete adjuvant followed by subsequent boosts in Freund’s incomplete adjuvant. Antibodies to the calmodulin portion of the fusion protein were obtained by depleting background specificities over a CNBr-Sepharose affinity column to which lysed human red blood cells had been conjugated. The flow through from the column was then loaded onto a second CNB-sepharose affinity column to which GST had been conjugated to deplete specificities to the GST part of the fusion protein. Affinity purified antibodies were then obtained by a third CNBr-sepharose column to which the calmodulin-GST fusion protein had been bound. The eluted antibodies from this column were used in the experiments described. Preparation of purified trophozoites. Trophozoites from each isolate were obtained by synchronization of ring stages with 5% sorbitol and the parasites were replated at 10% parasitemia and 2% hematocrit. The mature trophozoites were harvested 24 hr later and the trophozoite-infected erythrocytes further purified by separation over a Percoll step gradient with concentration steps of 90, 80, 60, and 40% made in RPMIHepes. Mature trophozoites separating between the 6080% step were harvested and washed in serum free RPMI-Hepes. The concentration of cells was calculated by counting on a hemocytometer and the parasites were frozen at - 70°C in aliquots of 10’ parasites. Immunoblotting. Immunoblotting was performed as has been previously described (Towbin et al. 1979). Briefly, purified GST-fusion proteins or 10’ Percoll gradient purified trophozoites of each isolate was diluted in SDS sample buffer, separated by SDS-PAGE, and transferred to nitrocellulose. The nitrocellulose tilter was incubated with affinity purified anticalmodulin antisera and immune complexes were detected with radioiodinated protein A (specific activity 40 &i/up). RESULTS
Isolation of the calmodulin gene. In order to test the possibility that alterations in expression or sequence of the calmodulin gene of P. falciparum are involved in the mechanism of chloroquine resistance we designed two oligonucleotides corresponding to conserved regions of the gene from comparisons with the calmodulin gene of other eukaryotes (Sherbany et al. 1987).
CALMODULIN
GENE OF P. fulciparum
271
The sequence of the primers was adjusted amino acids long, the same length as most to account for the codon preference of P. other calmodulin proteins from other spefalciparum and used to amplify the gene se- cies. A comparison of the P. falciparum quence from genomic DNA of the cloned calmodulin protein sequence with the same isolate HB3 using the PCR. The 940-bp protein from a number of other eukaryotes fragment was cloned into Ml3 vectors and is shown in Fig. 2. The P. falciparum sesequenced on both strands. The sequence quence is more homologous to human calwas found to be highly homologous to cal- modulin (89%) (Wawrzynczak and Perham modulin from other eukaryotes and, conse- 1984) than to either T. brucei (86.6%) quently, we isolated the 5’ and 3’ ends of the (Tschudi et al. 1985) or the yeast (60.4%) gene by using appropriate oligonucleotides protein (Davis et al. 1986). in inverted PCR (Triglia et al. 1988). The In order to determine if calmodulin was sequences obtained were determined in full encoded by a single gene we probed genoon both strands in order to give the full mic DNA from the HB3 cloned isolate of P. length sequence of the P. fulciparum cal- fulciparum (Fig. 3). The DNA was incubated with restriction enzymes that cut outmodulin gene (Fig. 1). The calmodulin gene of P. falciparum. side the gene or within the intron. If calThe sequence obtained from the PCR prod- modulin was encoded by a single gene one ucts contained a protein reading frame that hybridizing DNA band would be present was interrupted by a single putative intron. but if there was more than one gene some The predicted protein was highly homolo- polymorphism would be expected. The calgous to calmodulin proteins from other eu- modulin gene probe hybridized to one DNA karyotes suggesting that this gene encoded band when cut with the different restriction a calmodulin protein of P. fulciparum. The enzymes which is consistant with a single sequence of the calmodulin gene was ob- calmodulin gene in P. falciparum. To determine if the calmodulin gene was tained from the chloroquine sensitive isolates HB3, 3D7, and FC27 and also the amplified in chloroquine resistant isolates we hybridized a gene chloroquine resistant isolates VI and of P. falciparum CSL2. All were found to be identical. The probe to EcoRl digests of genomic DNA intron is 506 bp long and it has the appro- from chloroquine resistant and sensitive priate acceptor and donor splice sites. The isolates (Fig. 4). A single band of 1.1 kb predicted reading frame of calmodulin is hybridized in all isolates with an equal incontiguous when the intron is removed so tensity suggesting that they all contain a that the protein encoded by this gene is 149 single calmodulin gene. The same filter was
272
COWMAN
AND
GALATIS
P.fal Human Tryps Yeast
MADKLTEEQI SEFKEAFSLF DKDGDGTITT . ..Q...... A......... .......... . ..Q.SN... .......... .......... .SSN...... A......A.. . ..NN.S.SS
KELGTVMRSL .,.,...... .......... S..A......
P.fal Human Tryps Yeast
DMINEIDTDG NGTIDFPEFL TLMARKLKDT . . . ..V.A.. . . . . . . . . . . .M....M... . . . ..V.Q.. S......... . . . . ..MQ.S .LM....V.. .HQ.E.S... A..S.QL.SN
DTEEELIEAF .S...IR... .S...IK... .S.Q..L...
P.fcIl Human Tryps Yeast
EVDEMIREAD ,,........ .......... . ..D.L..VS
ISADELRHVM TNLGEKLTNE . ..A...... . . . . . . ..D. . ..A....I. . . . . . . ..D. .SI.....DA ., .A..K..L FIG. 2. Comparison of Plasmodium falciparum
50 GQNPTEAELQ ..,,...... es......,. .LS.S...VN 100 RVFDRDGDGY . . ..K..N..
. . ..K..N.F K...KN...L
150 IDGDGQINYE EFVKMMIAK* . . . . ..V... . ..Q..T..* V......... . . . . ..MSK* -..S.E..IQ Q.AALL-SK*
calmodulin with the protein from other eukaryotes. Dots indicate exact identity and only mismatches are shown.
hybridized with a DNA probe from the gene for dihydrofolate reductase (Cowman et al. 1988) to show that equal amounts of DNA were loaded in each track. There are two major transcripts from the calmodulin gene. The transcripts derived
from the calmodulin gene were analyzed by Northern blot hybridization (Fig. 5). The calmodulin gene was hybridized to total RNA from a number of different isolates and each gave the same result. Two major transcripts were identified of 1.3 and 1.Okb both of which are long enough to encode the calmodulin protein.
Approximately equal amounts of total RNA, from chloroquine resistant and senwere sitive isolates of P. fulciparum, loaded onto this gel and this was shown by ethidium bromide staining of the rRNA bands. There was an apparent increase in the level of calmodulin transcript in FACS; however, there was more RNA loaded in this track as shown by the intensity of ethidium bromide staining of the rRNA bands.
ABCD
Probe:
CAM
DHFR
FIG. 4. The calmodulin gene is not amplified in FIG. 3. Calmodulin is encoded by a single gene. Genomic DNA was cut with the restriction enzymes (A) Sspl, (B) Dal, and (C) EcoRI and hybridized with a calmodulin radiolabeled probe that included the regions of the gene from 579 to 951 bp. The molecular size of the hybridizing fragments are shown in kilobase pairs.
chloroquine resistant isolates. EcoRI digested DNA from the chloroquine sensitive isolates 3D7, FC27, HB3, and the chloroquine resistant isolates FACI, VI, CSL2, ITG2 were hybridized with the following radiolabelled DNA probes: calmodulin (A), DHFR (B). The molecular sizes of the hybridizing fragments are shown in kilobase pairs.
CALMODULIN
GENE OF P.
FIG. 5. Transcripts from the calmodulin gene of falciparum. Twenty micrograms of total RNA from the P. falciparum isolates 3D7, FC27, HB3, FACS, VI, and CSL2 were size separated on a formaldehyde agarose gel and the blot was hybridized with a radiolabeled calmodulin DNA probe. The amount of RNA loaded was equalized by visualization of the rRNA bands by staining with ethidium bromide. The molecular sizes of the hybridizing bands are shown in kilobases.
Plasmodium
The calmodulin gene is on chromosome 14. Pulsed-field gradient electrophoresis
(PFG) was used to determine the chromosomal location of the calmodulin gene. A fragment containing the full calmodulin gene hybridized to the largest chromosome
Probe:
273
fakiparum
in all of the isolates tested (Fig. 6) suggesting that this gene was present on chromosome 14. In order to confirm this, the gene for the histidine-rich protein hrp3, which had been mapped to chromosome 13 (Wellems et al. 1987), was hybridized to the same PFG filter. Hrp3 hybridizes not only to chromosome 13 but also to a homologous gene on chromosome 8 (hrp2). The calmodulin protein. In order to analyze the calmodulin protein we used oligonucleotides that allowed the amplification by PCR of the region from 585 to 951 bp (Fig. 1). The fragment generated was cloned into the expression vector pGex-I to produce an abundant fusion protein (Fig. 7) that was affinity purified on a glutathioneagarose column. This fusion protein was used to generate antibodies that were affinity purified on the calmodulin fusion protein. These anti-calmodulin antibodies were used to probe immunoblots of different GST fusion proteins to determine the specificity. The antisera reacted with the calmodulin fusion protein but did not react with either the GST or another fusion protein made from the pfmdrl gene (Fig. 7). Immunoblots of equal amounts of puritied trophozoites from chloroquine resistant and sensitive isolates were probed with the affinity purified anti-calmodulin antisera (Fig. 8). A single band of approximately
CAM
HRP3
FIG. 6. Chromosomal localization of the Plasmodium falciparum calmodulin gene. (A) Ethidium bromide-stained pulsed-field gradient electrophoresis gel of P. falciparum chromosomes. 3D7 chromosomes were used as the reference clone for numbering chromosomes. (B) Blot of the same gel hybridized with the radiolabeled calmodulin probe. (C) Blot of the same gel hybridized with the radiolabled hrp3 gene.
274
A ABCM
COWMANANDGALATIS
-200
.a -9,
FIG. 7. Affinity purified anti-calmodulin antisera reacts only with the Plasmodium falciparum fusion protein. (A) Purified proteins (lane A) glutathione Stransferase (GST), (lane B) pfmdrl-GST, and (lane C) calmodulin4ST were separated by SDS-PAGE and visualized by staining with Coomassie blue (B) An equivalent gel was transferred to nitrocellulose and reacted with the affinity purified anti-calmodulin antibody followed by ‘251-labeled protein A.
17,000 kDa was seen in all isolates in approximately equal amounts. This band was not seen in uninfected erythrocytes indicating that this protein corresponded to the P. falciparum calmodulin and was not of host origin. DISCUSSION
We have examined the calmodulin gene
FIG. 8. The calmodulin protein in chloroquine resistant and sensitive Plasmodium falciparum. Equal numbers of Percoll gradient purified trophozoites from the isolates 3D7, FC27, HB3, FAC8, Vl, CSL2, and uninfected human erythrocytes were separated by SDS-PAGE and blotted to nitrocellulose. The filter was probed with affinity purified anti-calmodulin antibodies.
in P. falciparum and found that it was encoded by a single gene. Other eukaryotes such as T. brucei (Tschudi et al. 1985), chicken (Putkey et al. 1983), and Xenopus (Chien and Dawid 1984) have a number of calmodulin genes in the genome. The P. falciparum calmodulin gene encodes two transcripts. These may represent different start or termination sites for transcription or the larger transcript could correspond to an unspliced intermediate. These two transcripts are expressed at the same time as the RNA tested and are from synchronized trophozoites. The calmodulin protein from P. falciparum was very homologous to the same protein from other eukaryotes. This was not surprising as it is an extremely conserved molecule that is essential for the normal growth and division of cells. Calmodulin has been shown to be present in rhoptries of merozoites suggesting that it may also be essential for invasion of erythrocytes. It has been shown previously that calmodulin antagonists can inhibit the growth of P. falciparum and it was suggested that they mediate their effect by binding to calmodulin and inhibiting essential functions (Scheibel et al. 1987). Classic antimalarial drugs such as chloroquine show varying degrees of antagonism with these drugs suggesting that they are competing for the same binding site. If calmodulin were a target for such antimalarials it may be involved in the development of resistance to these drugs. Our results show that calmodulin was expressed at the same level in chloroquine resistant and sensitive isolates. Also, the sequence of calmodulin was identical in all of the isolates analyzed. Hence we have found no evidence that alterations in calmodulin are directly involved in the mechanism of chloroquine resistance in these isolates. ACKNOWLEDGMENTS We thank D. Kemp for critical appraisal of the manuscript. This work was supported by grants from
CALMODULIN
GENE OF P.
the National Health and Medical Research Council of Australia and the John D. and Catherine T. MacArthur Foundation. A.F.C. is supported by a Wellcome Australian Senior Research Fellowship. Note added in proof. Since acceptance of this manuscript, K. J. H. Robson and M. W. Jennings (Mol. Biochem. Parasitol. 46, 19-34) reported results similar to those we have obtained.
REFERENCES BABA, M. L., GOODMAN,M., BERGER-COHN,J., DEMAILLE, J. G., AND MATSUDA, G. 1984. The early adaptive evolution of calmodulin. Molecular and Biological Evolution 1, 442-455. CHEUNG, W. Y. 1980. Calmodulin plays a pivotal role in cellular regulation. Science 207, 19-27. CHIEN, Y. H., AND DAWID, I. B. 1984. Isolation and characterization of calmodulin genes from Xenopus laevis. Molecular
and Cellular
Biology
4, 501-513.
CHU, Cl., VOLLRATH, D., AND DAVIS, R. 1986. Separation of large DNA molecules by contour clamped homogenous electric fields. Science 239, 487-491. COPPEL, R. L., COWMAN, A. F., LINGELBACH, K. R., BROWN, G. V., SAINT, R. B., KEMP, D. J., AND ANDERS, R. F. 1983. Isolate specific S-antigen of Plasmodium falciparum contains a repeat sequence of eleven amino acids. Nature 306,751-756. COWMAN, A. F., MORRY, M. J., BIGGS, B. A., CROSS,G. A. M., AND FOOTE, S. J. 1988. Identification of amino acids linked to pyrimethamine resistance in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum. Proceedings of the National
Academy
of Science USA 85,
9109-9113. DAVIS, T. N., URDEA, M. S., MASIARZ, F. R., AND THORNER,J. 1986. Isolation of the yeast calmodulin gene: Calmodulin is an essential protein. Cell 47, 423-43 1. KLEE, C. B., CROUCH,T. H., AND RICHMAN, P. Cl. 1980. Calmodulin. Annual Review of Biochemistry 49, 488-518. PUTKEY, J. A., TSUI, K. F., TANAKA, T., LEGACE, L., STEIN, J. P., LAI, E. C., AND MEANS, A. R. 1983. Chicken calmodulin genes. Journal of Biological Chemistry 258, 11,864-l 1,870. SAIKI, R. K., GELFAND, D. H., STOFFEL, S.,
275
fakiparum
SCHARF, S., HIGUCHI, R., HORN, G. T., MULLIS, K. B., AND ERLICH, H. A. 1988. Primer directed enzymatic amplification of DNA with a thermostable DNA polyerase. Science 239, 487-491. SCHEIBEL, L. W., COLOMBANI, P. M., HESS, A. D., AIKAWA, M., ATKINSON, C. T., AND MIHOUS, W. K. 1987.Calcium and calmodulin antagonists inhibit human malaria parasites (Plasmodium falciparum); Implications for drug design. Proceedings of the National Academy of Science USA 84, 7,3 lO7,314. SHERBANY,A. A., PARENT, A. S., AND BROSIUS,J. 1987. Rat calmodulin cDNA DNA 6, 267-272. SMITH, D. B., AND JOHNSON,K. S. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67, 3 140. TOWBIN, H., STAEHELIN, T., AND GORDON,J. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedures and some applications. Proceedings of the National Academy of Science USA 76, 4,350-4,354.
TRAGER,W., AND JENSEN,J. B. 1976. Human malaria parasites in continuous culture. Science 193, 673615. TRIGLIA, T., PETERSON,M. G., AND KEMP, D. J. 1988. A procedure for the in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Research 16,8186. TSCHUDI, C., YOUNG, A. S., RUBEN, L., PATTON, C. L., AND RICHARDS, F. F. 1985. Calmodulin genes in trypanosomes are tandemly repeated and produce multiple RNA’s. Proceedings of the National Academy
of Science USA 82, 3,998-4,002.
WAWRZYNCZAK, E. F., AND PERHAM, R. N. 1984. Isolation and nucleotide sequence of a cDNA encoding human calmodulin. Biochemistry International 9, 177-185. WELLEMS, T. E., WALLIKER, D., SMITH, C. L., RoSARIO, V. E., MALOY, W. L., HOWARD, R. J., CARTER,R., AND MCCUTCHAN, T. F. 1987. A histidine-rich protein gene marks a linkage group favoured strongly in a genetic cross of Plasmodium falciparum. Cell 49, 633-642. Received 14 December 1990;accepted with revision 19 April 1991.
PARASITOLOGY
73, 269-275 (1991)
Plasmodium falciparum: The Calmodulin Gene is Not Amplified or Overexpressed in Chloroquine Resistant or Sensitive Isolates’ ALAN F. COWMAN'AND The Walter and Eliza Hall Institute
of Medical
DENISE GALATIS Research,
Melbourne
3050, Australia
COWMAN, A. F., AND GALATIS, D. 1991. Plasmodium falciparum: The calmodulin gene is not amplified or overexpressed in chloroquine resistant or sensitive isolates. Experimental Parasitology 73, 269-275. The in vitro growth of Plasmodium falciparum is sensitive to some calmodulin antagonists and these compounds show antagonism with classic antimalarials such as chloroquine suggesting competition for the same drug binding site. In order to ask if calmodulin is involved in resistance to chloroquine we cloned the calmodulin gene of P. falciparum. We show that it is encoded by a single gene and that the putative protein is highly homologous to calmodulin from other eukaryotes. The calmodulin gene is encoded on chromosome 14 and contains a single intron of 506 bp that has the appropriate donor and acceptor splice sites. Two major transcripts of similar size are encoded by this gene. The sequence of the gene is identical and the calmodulin protein is expressed approximately equally in chloroquine resistant and sensitive isolates of P. falciparum suggesting that alterations in this protein play no role in the mechanism of chloroquine resistance in the isolates tested. a 1991 Academic Press, Inc. INDEX DESCRIPTORS AND ABBREVIATIONS: Malaria; Calmodulin; Chromosome; Polymerase chain reaction (PCR); Glutathione S-transferase (GST); Pulsed field gradient electrophoresis (PFG).
modulin may be the target of some antimaThe calcium binding protein calmodulin larial drugs since chloroquine, quinine, and quinicrine do have some apparent antiis found in all eukaryotic cells and its secalmodulin activity (Scheibel et al., 1987). quence is highly conserved throughout evIt has also been shown that the potency of olution (Baba et al. 1984; Klee et al. 1980). calmodulin antagonists is proportional to Calmodulin is important in many metabolic inhibition of growth of the malarial parasite activities and is essential for normal cell Plasmodium falciparum and these comgrowth and division (Cheung 1980). One of pounds show antagonism with classic antithe many roles of the calmodulin-calcium malarials such as chloroquine. complex is to regulate cyclic nucleotides We have isolated the gene for calmodulin and therefore it is responsible for the coufrom P. falciparum and analyzed its strucpling of the two second messengers, CAMP ture and expression. P. falciparum has a and calcium. The calmodulin gene(s) from single gene that is highly homologous to many organisms including humans calmodulin from other eukaryotes. We also (Wawrzynczak and Perham 1984), Trypashow that the expression of the calmodulin nosoma brucei (Tschudi et al. 198% and gene and its protein product is indistinSaccharomyces cerevisiae (Davis et al. guishable in chloroquine resistant and sen1986) have been sequenced. sitive P. falciparum, suggesting that calIt has been previously suggested that calmodulin is not involved in the mechanism of chloroquine resistance. INTRODUCTION
’ The sequence data reported herein has been submitted to EMBL and assigned Accession Number X56950. 2 To whom correspondence should be addressed.
MATERIALS AND METHODS Parasites.
The P. falciparum
isolate FC27 was ob-
269 0014-4894191$3.00 Copyright All rights
Q 1991 by Academic Press, Inc. of reproduction in any form reserved.
270
COWMAN
AND
tamed through a collaboration with the Papua-New Guinea Institute of Medical Research. 3D7 (the parent was obtained from an airport worker in Amsterdam) and HB3 were obtained from D. Walliker, University of Edinburgh, Edinburgh. FAC8 is a cloned line derived from ITG2F6, a cloned Brazilian line which was obtained from the laboratory of L. Miller, N.I.H. Bethesda. CSL2 originated from Thailand and was obtained from Margaret Maloney at the Commonwealth Serum Laboratories, Melbourne. VI (Vietnam) was obtained from R. Howard, DNAX. Parasites were grown in RPMI-Hepes, 5.8% NaHCO, with 10% human serum as described (Trager and Jensen, 1976). Polymerase chain reaction and sequencing. The gene for calmodulin from P. falciparum was obtained by using oligonucleotides designed from known calmoduhn sequences in PCRs to amplify the gene sequence (Saiki et a/., 1988). The oligonucleotide sequences used were ATGGC(T/A)GATCAA(C/ T)T(A/T)(A/T)C(T/A)(G/A)A(A/T)GAACA(A/G) at the 5’ end and the antisense primer CATCATTT(T/ G)(T/A)ACAAATICTTCATA at the 3’ end. The 5’ and 3’ ends of the gene were then obtained by using appropriate oligonucleotide primers in inverted PCR (Triglia et a/. 1988)to amplify the rest of the gene. The PCR fragments were isolated and cloned into Ml3 vectors and the full calmodulin gene was sequenced on both strands. The calmodulin gene was sequenced from other isolates by amplifying the full gene using oligonucleotide primers (5’, CCTAATAGAAATATATCAATG and 3’, CTTATTTATTTTATTCTGATATTTAAAAATCA) and cloning the PCR product into Ml3 vectors. DNA and RNA analysis. DNA and RNA was obtained as previously described (Coppel et al. 1983). DNA was digested with the appropriate restriction enzymes, fractionated on 0.8% agarose gels, and transferred to nylon membranes; 20 pg of total RNA was fractionated on 1.5% agarose gels in E buffer (36 m&Z Na, HP0,/4 mM NaH,PO,) and 6% formaldehyde and transferred to nylon membranes. All filters were hybridized in 5 x SSC (1 x SSC = 15mM NaCl/lSO mM Na-citrate, pH 7)/1x Denhardt’s solution (0.02% FicolVO.OZ%bovine serum albumin)/O. 1% SDS1500mg herring sperm DNA at 65°C. PFG electrophoresis. PFG electrophoresis was performed in a cantor-clamped homogenous electric field (CHEF) apparatus (Chu et a/. 1986). Running conditions were 70 V with pulse times of 17 min. The gel was stained with ethidium bromide and photographed on a 305nm wavelength transilluminator. The gel was exposed to uv light for 5 min to introduce breaks into the DNA, transferred to Hybond N, and hybridized with the appropriate probe using the conditions described above. Preparation
of affinity
pur$ed
antibodies
to cal-
GALATIS
mod&n. The region of the calmodulin gene from 585 to 960 bp was amplified with oligonucleotide primers and PCR and the fragment cloned into pGex-2 to produce an abundant fusion protein attached to GST (Smith and Johnson 1988). The fusion protein was affinity purified on a GST-agarose column. The protein eluted was used to raise antisera by injection into rabbits with Freund’s complete adjuvant followed by subsequent boosts in Freund’s incomplete adjuvant. Antibodies to the calmodulin portion of the fusion protein were obtained by depleting background specificities over a CNBr-Sepharose affinity column to which lysed human red blood cells had been conjugated. The flow through from the column was then loaded onto a second CNB-sepharose affinity column to which GST had been conjugated to deplete specificities to the GST part of the fusion protein. Affinity purified antibodies were then obtained by a third CNBr-sepharose column to which the calmodulin-GST fusion protein had been bound. The eluted antibodies from this column were used in the experiments described. Preparation of purified trophozoites. Trophozoites from each isolate were obtained by synchronization of ring stages with 5% sorbitol and the parasites were replated at 10% parasitemia and 2% hematocrit. The mature trophozoites were harvested 24 hr later and the trophozoite-infected erythrocytes further purified by separation over a Percoll step gradient with concentration steps of 90, 80, 60, and 40% made in RPMIHepes. Mature trophozoites separating between the 6080% step were harvested and washed in serum free RPMI-Hepes. The concentration of cells was calculated by counting on a hemocytometer and the parasites were frozen at - 70°C in aliquots of 10’ parasites. Immunoblotting. Immunoblotting was performed as has been previously described (Towbin et al. 1979). Briefly, purified GST-fusion proteins or 10’ Percoll gradient purified trophozoites of each isolate was diluted in SDS sample buffer, separated by SDS-PAGE, and transferred to nitrocellulose. The nitrocellulose tilter was incubated with affinity purified anticalmodulin antisera and immune complexes were detected with radioiodinated protein A (specific activity 40 &i/up). RESULTS
Isolation of the calmodulin gene. In order to test the possibility that alterations in expression or sequence of the calmodulin gene of P. falciparum are involved in the mechanism of chloroquine resistance we designed two oligonucleotides corresponding to conserved regions of the gene from comparisons with the calmodulin gene of other eukaryotes (Sherbany et al. 1987).
CALMODULIN
GENE OF P. fulciparum
271
The sequence of the primers was adjusted amino acids long, the same length as most to account for the codon preference of P. other calmodulin proteins from other spefalciparum and used to amplify the gene se- cies. A comparison of the P. falciparum quence from genomic DNA of the cloned calmodulin protein sequence with the same isolate HB3 using the PCR. The 940-bp protein from a number of other eukaryotes fragment was cloned into Ml3 vectors and is shown in Fig. 2. The P. falciparum sesequenced on both strands. The sequence quence is more homologous to human calwas found to be highly homologous to cal- modulin (89%) (Wawrzynczak and Perham modulin from other eukaryotes and, conse- 1984) than to either T. brucei (86.6%) quently, we isolated the 5’ and 3’ ends of the (Tschudi et al. 1985) or the yeast (60.4%) gene by using appropriate oligonucleotides protein (Davis et al. 1986). in inverted PCR (Triglia et al. 1988). The In order to determine if calmodulin was sequences obtained were determined in full encoded by a single gene we probed genoon both strands in order to give the full mic DNA from the HB3 cloned isolate of P. length sequence of the P. fulciparum cal- fulciparum (Fig. 3). The DNA was incubated with restriction enzymes that cut outmodulin gene (Fig. 1). The calmodulin gene of P. falciparum. side the gene or within the intron. If calThe sequence obtained from the PCR prod- modulin was encoded by a single gene one ucts contained a protein reading frame that hybridizing DNA band would be present was interrupted by a single putative intron. but if there was more than one gene some The predicted protein was highly homolo- polymorphism would be expected. The calgous to calmodulin proteins from other eu- modulin gene probe hybridized to one DNA karyotes suggesting that this gene encoded band when cut with the different restriction a calmodulin protein of P. fulciparum. The enzymes which is consistant with a single sequence of the calmodulin gene was ob- calmodulin gene in P. falciparum. To determine if the calmodulin gene was tained from the chloroquine sensitive isolates HB3, 3D7, and FC27 and also the amplified in chloroquine resistant isolates we hybridized a gene chloroquine resistant isolates VI and of P. falciparum CSL2. All were found to be identical. The probe to EcoRl digests of genomic DNA intron is 506 bp long and it has the appro- from chloroquine resistant and sensitive priate acceptor and donor splice sites. The isolates (Fig. 4). A single band of 1.1 kb predicted reading frame of calmodulin is hybridized in all isolates with an equal incontiguous when the intron is removed so tensity suggesting that they all contain a that the protein encoded by this gene is 149 single calmodulin gene. The same filter was
272
COWMAN
AND
GALATIS
P.fal Human Tryps Yeast
MADKLTEEQI SEFKEAFSLF DKDGDGTITT . ..Q...... A......... .......... . ..Q.SN... .......... .......... .SSN...... A......A.. . ..NN.S.SS
KELGTVMRSL .,.,...... .......... S..A......
P.fal Human Tryps Yeast
DMINEIDTDG NGTIDFPEFL TLMARKLKDT . . . ..V.A.. . . . . . . . . . . .M....M... . . . ..V.Q.. S......... . . . . ..MQ.S .LM....V.. .HQ.E.S... A..S.QL.SN
DTEEELIEAF .S...IR... .S...IK... .S.Q..L...
P.fcIl Human Tryps Yeast
EVDEMIREAD ,,........ .......... . ..D.L..VS
ISADELRHVM TNLGEKLTNE . ..A...... . . . . . . ..D. . ..A....I. . . . . . . ..D. .SI.....DA ., .A..K..L FIG. 2. Comparison of Plasmodium falciparum
50 GQNPTEAELQ ..,,...... es......,. .LS.S...VN 100 RVFDRDGDGY . . ..K..N..
. . ..K..N.F K...KN...L
150 IDGDGQINYE EFVKMMIAK* . . . . ..V... . ..Q..T..* V......... . . . . ..MSK* -..S.E..IQ Q.AALL-SK*
calmodulin with the protein from other eukaryotes. Dots indicate exact identity and only mismatches are shown.
hybridized with a DNA probe from the gene for dihydrofolate reductase (Cowman et al. 1988) to show that equal amounts of DNA were loaded in each track. There are two major transcripts from the calmodulin gene. The transcripts derived
from the calmodulin gene were analyzed by Northern blot hybridization (Fig. 5). The calmodulin gene was hybridized to total RNA from a number of different isolates and each gave the same result. Two major transcripts were identified of 1.3 and 1.Okb both of which are long enough to encode the calmodulin protein.
Approximately equal amounts of total RNA, from chloroquine resistant and senwere sitive isolates of P. fulciparum, loaded onto this gel and this was shown by ethidium bromide staining of the rRNA bands. There was an apparent increase in the level of calmodulin transcript in FACS; however, there was more RNA loaded in this track as shown by the intensity of ethidium bromide staining of the rRNA bands.
ABCD
Probe:
CAM
DHFR
FIG. 4. The calmodulin gene is not amplified in FIG. 3. Calmodulin is encoded by a single gene. Genomic DNA was cut with the restriction enzymes (A) Sspl, (B) Dal, and (C) EcoRI and hybridized with a calmodulin radiolabeled probe that included the regions of the gene from 579 to 951 bp. The molecular size of the hybridizing fragments are shown in kilobase pairs.
chloroquine resistant isolates. EcoRI digested DNA from the chloroquine sensitive isolates 3D7, FC27, HB3, and the chloroquine resistant isolates FACI, VI, CSL2, ITG2 were hybridized with the following radiolabelled DNA probes: calmodulin (A), DHFR (B). The molecular sizes of the hybridizing fragments are shown in kilobase pairs.
CALMODULIN
GENE OF P.
FIG. 5. Transcripts from the calmodulin gene of falciparum. Twenty micrograms of total RNA from the P. falciparum isolates 3D7, FC27, HB3, FACS, VI, and CSL2 were size separated on a formaldehyde agarose gel and the blot was hybridized with a radiolabeled calmodulin DNA probe. The amount of RNA loaded was equalized by visualization of the rRNA bands by staining with ethidium bromide. The molecular sizes of the hybridizing bands are shown in kilobases.
Plasmodium
The calmodulin gene is on chromosome 14. Pulsed-field gradient electrophoresis
(PFG) was used to determine the chromosomal location of the calmodulin gene. A fragment containing the full calmodulin gene hybridized to the largest chromosome
Probe:
273
fakiparum
in all of the isolates tested (Fig. 6) suggesting that this gene was present on chromosome 14. In order to confirm this, the gene for the histidine-rich protein hrp3, which had been mapped to chromosome 13 (Wellems et al. 1987), was hybridized to the same PFG filter. Hrp3 hybridizes not only to chromosome 13 but also to a homologous gene on chromosome 8 (hrp2). The calmodulin protein. In order to analyze the calmodulin protein we used oligonucleotides that allowed the amplification by PCR of the region from 585 to 951 bp (Fig. 1). The fragment generated was cloned into the expression vector pGex-I to produce an abundant fusion protein (Fig. 7) that was affinity purified on a glutathioneagarose column. This fusion protein was used to generate antibodies that were affinity purified on the calmodulin fusion protein. These anti-calmodulin antibodies were used to probe immunoblots of different GST fusion proteins to determine the specificity. The antisera reacted with the calmodulin fusion protein but did not react with either the GST or another fusion protein made from the pfmdrl gene (Fig. 7). Immunoblots of equal amounts of puritied trophozoites from chloroquine resistant and sensitive isolates were probed with the affinity purified anti-calmodulin antisera (Fig. 8). A single band of approximately
CAM
HRP3
FIG. 6. Chromosomal localization of the Plasmodium falciparum calmodulin gene. (A) Ethidium bromide-stained pulsed-field gradient electrophoresis gel of P. falciparum chromosomes. 3D7 chromosomes were used as the reference clone for numbering chromosomes. (B) Blot of the same gel hybridized with the radiolabeled calmodulin probe. (C) Blot of the same gel hybridized with the radiolabled hrp3 gene.
274
A ABCM
COWMANANDGALATIS
-200
.a -9,
FIG. 7. Affinity purified anti-calmodulin antisera reacts only with the Plasmodium falciparum fusion protein. (A) Purified proteins (lane A) glutathione Stransferase (GST), (lane B) pfmdrl-GST, and (lane C) calmodulin4ST were separated by SDS-PAGE and visualized by staining with Coomassie blue (B) An equivalent gel was transferred to nitrocellulose and reacted with the affinity purified anti-calmodulin antibody followed by ‘251-labeled protein A.
17,000 kDa was seen in all isolates in approximately equal amounts. This band was not seen in uninfected erythrocytes indicating that this protein corresponded to the P. falciparum calmodulin and was not of host origin. DISCUSSION
We have examined the calmodulin gene
FIG. 8. The calmodulin protein in chloroquine resistant and sensitive Plasmodium falciparum. Equal numbers of Percoll gradient purified trophozoites from the isolates 3D7, FC27, HB3, FAC8, Vl, CSL2, and uninfected human erythrocytes were separated by SDS-PAGE and blotted to nitrocellulose. The filter was probed with affinity purified anti-calmodulin antibodies.
in P. falciparum and found that it was encoded by a single gene. Other eukaryotes such as T. brucei (Tschudi et al. 1985), chicken (Putkey et al. 1983), and Xenopus (Chien and Dawid 1984) have a number of calmodulin genes in the genome. The P. falciparum calmodulin gene encodes two transcripts. These may represent different start or termination sites for transcription or the larger transcript could correspond to an unspliced intermediate. These two transcripts are expressed at the same time as the RNA tested and are from synchronized trophozoites. The calmodulin protein from P. falciparum was very homologous to the same protein from other eukaryotes. This was not surprising as it is an extremely conserved molecule that is essential for the normal growth and division of cells. Calmodulin has been shown to be present in rhoptries of merozoites suggesting that it may also be essential for invasion of erythrocytes. It has been shown previously that calmodulin antagonists can inhibit the growth of P. falciparum and it was suggested that they mediate their effect by binding to calmodulin and inhibiting essential functions (Scheibel et al. 1987). Classic antimalarial drugs such as chloroquine show varying degrees of antagonism with these drugs suggesting that they are competing for the same binding site. If calmodulin were a target for such antimalarials it may be involved in the development of resistance to these drugs. Our results show that calmodulin was expressed at the same level in chloroquine resistant and sensitive isolates. Also, the sequence of calmodulin was identical in all of the isolates analyzed. Hence we have found no evidence that alterations in calmodulin are directly involved in the mechanism of chloroquine resistance in these isolates. ACKNOWLEDGMENTS We thank D. Kemp for critical appraisal of the manuscript. This work was supported by grants from
CALMODULIN
GENE OF P.
the National Health and Medical Research Council of Australia and the John D. and Catherine T. MacArthur Foundation. A.F.C. is supported by a Wellcome Australian Senior Research Fellowship. Note added in proof. Since acceptance of this manuscript, K. J. H. Robson and M. W. Jennings (Mol. Biochem. Parasitol. 46, 19-34) reported results similar to those we have obtained.
REFERENCES BABA, M. L., GOODMAN,M., BERGER-COHN,J., DEMAILLE, J. G., AND MATSUDA, G. 1984. The early adaptive evolution of calmodulin. Molecular and Biological Evolution 1, 442-455. CHEUNG, W. Y. 1980. Calmodulin plays a pivotal role in cellular regulation. Science 207, 19-27. CHIEN, Y. H., AND DAWID, I. B. 1984. Isolation and characterization of calmodulin genes from Xenopus laevis. Molecular
and Cellular
Biology
4, 501-513.
CHU, Cl., VOLLRATH, D., AND DAVIS, R. 1986. Separation of large DNA molecules by contour clamped homogenous electric fields. Science 239, 487-491. COPPEL, R. L., COWMAN, A. F., LINGELBACH, K. R., BROWN, G. V., SAINT, R. B., KEMP, D. J., AND ANDERS, R. F. 1983. Isolate specific S-antigen of Plasmodium falciparum contains a repeat sequence of eleven amino acids. Nature 306,751-756. COWMAN, A. F., MORRY, M. J., BIGGS, B. A., CROSS,G. A. M., AND FOOTE, S. J. 1988. Identification of amino acids linked to pyrimethamine resistance in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum. Proceedings of the National
Academy
of Science USA 85,
9109-9113. DAVIS, T. N., URDEA, M. S., MASIARZ, F. R., AND THORNER,J. 1986. Isolation of the yeast calmodulin gene: Calmodulin is an essential protein. Cell 47, 423-43 1. KLEE, C. B., CROUCH,T. H., AND RICHMAN, P. Cl. 1980. Calmodulin. Annual Review of Biochemistry 49, 488-518. PUTKEY, J. A., TSUI, K. F., TANAKA, T., LEGACE, L., STEIN, J. P., LAI, E. C., AND MEANS, A. R. 1983. Chicken calmodulin genes. Journal of Biological Chemistry 258, 11,864-l 1,870. SAIKI, R. K., GELFAND, D. H., STOFFEL, S.,
275
fakiparum
SCHARF, S., HIGUCHI, R., HORN, G. T., MULLIS, K. B., AND ERLICH, H. A. 1988. Primer directed enzymatic amplification of DNA with a thermostable DNA polyerase. Science 239, 487-491. SCHEIBEL, L. W., COLOMBANI, P. M., HESS, A. D., AIKAWA, M., ATKINSON, C. T., AND MIHOUS, W. K. 1987.Calcium and calmodulin antagonists inhibit human malaria parasites (Plasmodium falciparum); Implications for drug design. Proceedings of the National Academy of Science USA 84, 7,3 lO7,314. SHERBANY,A. A., PARENT, A. S., AND BROSIUS,J. 1987. Rat calmodulin cDNA DNA 6, 267-272. SMITH, D. B., AND JOHNSON,K. S. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67, 3 140. TOWBIN, H., STAEHELIN, T., AND GORDON,J. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedures and some applications. Proceedings of the National Academy of Science USA 76, 4,350-4,354.
TRAGER,W., AND JENSEN,J. B. 1976. Human malaria parasites in continuous culture. Science 193, 673615. TRIGLIA, T., PETERSON,M. G., AND KEMP, D. J. 1988. A procedure for the in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Research 16,8186. TSCHUDI, C., YOUNG, A. S., RUBEN, L., PATTON, C. L., AND RICHARDS, F. F. 1985. Calmodulin genes in trypanosomes are tandemly repeated and produce multiple RNA’s. Proceedings of the National Academy
of Science USA 82, 3,998-4,002.
WAWRZYNCZAK, E. F., AND PERHAM, R. N. 1984. Isolation and nucleotide sequence of a cDNA encoding human calmodulin. Biochemistry International 9, 177-185. WELLEMS, T. E., WALLIKER, D., SMITH, C. L., RoSARIO, V. E., MALOY, W. L., HOWARD, R. J., CARTER,R., AND MCCUTCHAN, T. F. 1987. A histidine-rich protein gene marks a linkage group favoured strongly in a genetic cross of Plasmodium falciparum. Cell 49, 633-642. Received 14 December 1990;accepted with revision 19 April 1991.