- Email: [email protected]
Platelet-derived factor V promotes angiogenesis in a mouse hind limb ischemia model
Platelet-derived factor V promotes angiogenesis in a mouse hind limb ischemia model Yan Yang, MS,a,b Lamei Xiao, MS,a,b Ni Chen, MS,a,b Yongjie Li, PhD,a,b Xin Deng, MS,a,b Liqun Wang, PhD,a,b Hongmin Sun, PhD,c and Jianbo Wu, PhD,a,b,c Luzhou, Sichuan, People’s Republic of China; and Columbia, Mo Objective: Coagulation factor V (FV) is distributed in plasma and platelet pools, which are distinguished by physical and functional differences. FV has been extensively studied for its roles in coagulation. The roles of FV in other physiologic pathways remain understudied. Methods: Hind limb ischemia was produced in transgenic mice by femoral artery ligation, with different levels of FV gene expression restricted to the plasma or platelets. Results: Hind limb blood flow perfusion in mice with higher platelet FV was significantly increased. The expression of major angiogenesis-related factors was correlated with the level of FV during ischemia. Furthermore, a platelet depletion and transfusion procedure showed that the transfusion of platelets with higher levels of FV into transgenic mice with undetectable platelet FV significantly rescued the ischemia-mediated impairments in blood flow perfusion. Immunohistochemistry analysis also indicated markedly increased capillary formation in the ischemic muscle of mice with higher platelet FV. Moreover, thrombin activity was significantly higher in the mice with higher platelet FV. Platelets expressing higher levels of FV stimulated increased endothelial cell migration. Hind limb blood flow perfusion was significantly blocked by thrombin inhibitor. Conclusions: These findings suggest that platelet-derived FV contributes to the control of angiogenesis and is likely associated with thrombin generation. (J Vasc Surg 2016;-:1-9.) Clinical Relevance: Platelets and the fibrinolytic system contain many regulators of angiogenesis. Studying the specific roles of individual hemostatic proteins in angiogenesis could lead to novel therapeutic approaches by targeting the angiogenesis functions of the hemostatic proteins. However, the roles of factor V (FV) in angiogenesis have not been reported. This study suggests that platelet-derived FV has an important role in angiogenesis. The stimulation could be partially associated with thrombin generation due to platelet-derived FV.
Factor V (FV) is a central regulatory protein in the blood coagulation cascade that plays critical roles in both procoagulant and anticoagulant pathways. It serves as a critical cofactor for factor Xa, forming the prothrombinase complex to convert prothrombin to thrombin in the presence of calcium and a phospholipid surface. FV is distributed into distinct plasma and platelet compartments, with w80% of total blood FV in the former and w20% in the latter. Clinical and experimental evidence also suggest From the Drug Discovery Research Center, Southwest Medical University, Luzhoua; the Laboratory for Cardiovascular Pharmacology of the Department of Pharmacology, School of Pharmacy, Southwest Medical University, Luzhoub; and the Department of Medicine, University of Missouri School of Medicine, Columbia.c This work was supported by National Natural Science Foundation of China Grant 81570263 and by Sichuan Province Science and Technology Agency Grant 2014FZ0104 to J.W. Author conflict of interest: H.S. owns stocks in Nanova Inc. Additional material for this article may be found online at www.jvascsurg.org. Correspondence: Jianbo Wu, PhD, Division of Cardiovascular Medicine, University of Missouri, 5 Hospital Dr, CE344-DC095.00, Columbia, MO 65212 (e-mail: [email protected]). The editors and reviewers of this article have no relevant financial relationships to disclose per the JVS policy that requires reviewers to decline review of any manuscript for which they may have a conflict of interest. 0741-5214 Copyright Ó 2016 by the The Society for Vascular Surgery. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.jvs.2016.03.453
that human platelet and plasma FV may be functionally distinct.1,2 Platelet-derived FVa has been reported to be more resistant to activated protein C cleavage and expresses significantly more FXa cofactor activity than plasmaderived FVa.1 Patients with undetectable plasma FV, but detectable platelet FV, had only relatively mild bleeding, suggesting that platelet FV is critical for coagulation and thrombin generation.3 Although FV is a critical factor in hemostasis, it can also affect the host’s susceptibility to infection due to its effect on thrombin generation.4 Thrombin is a multifunctional protein that has roles in coagulation as well as in cell proliferation and angiogenesis. Thrombin is a potent activator of angiogenesis, which is independent of its function in fibrin formation.5 Previous studies demonstrated that thrombin activated angiogenesis through regulation of multiple pathways, such as regulation of vascular endothelial growth factor (VEGF) avb3 integrin, reactive oxygen species, and the expression of the hypoxia inducible factor 1 signaling pathways.6-8 Other coagulation factors, such as tissue factor and factor X are also involved in controlling angiogenesis.9,10 Platelets and the fibrinolytic system contain many regulators of angiogenesis.11,12 Studying the specific roles of individual hemostatic proteins in angiogenesis could lead to novel therapeutic approaches to treat cancers and ischemia by targeting the angiogenesis functions of the hemostatic proteins. However, no studies have implicated FV in 1
2 Yang et al
controlling angiogenesis. Given that platelet FV affects thrombin generation, we hypothesized that platelet FV could play an important role in angiogenesis. METHODS The protocols for animal use in this study were reviewed and approved by the Animal Care Committee of Sichuan Medical University in accordance with the Institutional Animal Care and Use Committee guidelines. Animals. TgF5þ/þ, TgþF5þ/, TgþF5/ mice were previously generated and characterized13 on a background strain of C57BL/6 mice. The mice exhibited different levels of FV gene expression restricted to the plasma or platelets (TgF5þ/þ, 100%/100%; TgþF5þ/, 65%/50%; TgþF5/, 15%/0%). Male TgF5þ/þ, TgþF5þ/, and TgþF5/ litter mates, aged between 6 and 8 weeks and weighing between 25 and 30 g, were used for all experiments. Immunoblotting. Isolated mouse platelets were homogenized in radioimmunoprecipitation assay buffer (Sigma-Aldrich, St. Louis, Mo). Equal amounts of protein underwent sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were transferred to polyvinylidene difluoride membranes by electroblotting. After blocking, the membranes were incubated with anti-FV antibody (a gift from Dr David Ginsburg, University of Michigan) and b-actin. Mouse hind limb ischemia model. Unilateral hind limb ischemia was induced in mice by ligation and excision of a segment of the left femoral artery, as previously described.14,15 Mice were anesthetized using intraperitoneal sodium pentobarbital (60 mg/kg body weight) or isoflurane (5% by inhalation). A subcutaneous dose of buprenorphine hydrochloride (0.1 mg/kg) was administered for analgesia. Additional sodium pentobarbital (12 mg/kg body weight) or 5% isoflurane was given as needed to maintain anesthesia. The proximal portion of the femoral artery and the distal portion of the saphenous artery were ligated, and excision of the femoral bifurcation with all branches was performed. To minimize ambient light and temperature variation, mice were kept on a heating plate at 37 C for w10 minutes before measurement in a darkened room.14 Perfusion of the ischemic and nonischemic hind limb of the distal foot was measured in each mouse by laser Doppler imaging immediately before surgery, immediately after ligation, and at 3, 7, 12, and 14 days after ligation using a scanning moorLDI2-HIR (Moor Instruments, Wilmington, Del) high-resolution laser Doppler imager. Quantitative real-time polymerase chain reaction. The ischemic gastrocnemius muscle was excised, embedded in paraffin, and cross-sections were prepared for immunofluorescence analysis. Total RNA was extracted from the ischemic gastrocnemius muscles using TRIzol (Invitrogen, Carlsbad, Calif). RNA was pretreated with DNA (Invitrogen Life Technologies, Grand Island, NY), and SuperScript (Invitrogen Life Technologies) was used to
JOURNAL OF VASCULAR SURGERY --- 2016
synthesize complementary DNA according the manufacturer’s recommended conditions. Each sample was analyzed in duplicate with ribosomal 18S messenger RNA used as a control. After amplification, the relative differences in the amount of RNA were calculated based on the 2DDCT method. The oligonucleotide sequences of the polymerase chain reaction primers were: (1) VEGF-A (GCAGGCTGCTGTAACGATGAA, TCACATCTGCTGTGCTGTAGGA); (2) fibroblast growth factor (FGF)-2 (GGACG GCTGCTGGCTTCTAA, CCAGTTCGTTTCA GTGCCACATAC); (3) monocyte chemoattractant protein (MCP)-1 (CAGCCAGATGCAGTTAACGC, GCCTACTCATTGGGATCATCTTG); and (4) 18S (CCTGGATACCGCAGCTAGGA, GCGG CGCAATACGAATGCCCC). Thrombin activity assay. Blood was collected into citrate anticoagulant tubes, and plasma was prepared by centrifugation. The ischemic muscles were homogenized with 0.3 mL of phosphate-buffered saline (pH 7.2), and the homogenates were centrifuged at 12,000g for 15 minutes. Thrombin activity was measured using a SensoLyte 520 Thrombin Assay Kit (AnaSpec Inc, Fremont, Calif). Platelet depletion. To deplete endogenous platelets, mice were injected intraperitoneally every 3 days with 2.5 mg/g mouse platelet-depleting antibody (polyclonal anti-mouse glycoprotein Ib-a rat immunoglobulin G [IgG]; Emfret Analytics, Eibelstadt, Germany), and the platelets were counted. Platelet isolation and transfusion. To determine whether platelet-derived FV contributes to microvascular angiogenesis during rodent hind limb ischemia, mice were anesthetized, as described above, and whole blood was collected from the inferior vena cava using a 1 mL syringe containing 0.1 mL sodium citrate anticoagulant. Plateletrich plasma (PRP) was obtained from whole blood by centrifugation at 260g for 8 minutes and 260g for an additional 3 minutes. The supernatant was collected after each centrifugation. The platelets were isolated from the PRP using a Sepharose 2B column in PIPES buffer (PIPES, 5 mM; NaCl, 1.37 mM; KCl 4, mM, glucose 0.1%, pH 7.0). Platelet-poor plasma (PPP) was prepared by centrifugation at 1500g for 20 minutes. The PPP was further centrifuged at 10,000g for 5 minutes to remove the remaining cells. The pellet containing the platelets was then resuspended in 1 mL of phosphate-buffered saline (SigmaAldrich), allowed to sit for 30 minutes, and the platelets were counted with a hemocytometer. The platelets from the suspension were diluted with normal saline to a concentration of 1.56 109 platelets in 1.2 mL. We transfused 0.2 mL of the suspension via the tail vein into each recipient mouse every 6 days.
JOURNAL OF VASCULAR SURGERY Volume -, Number -
Yang et al 3
Fig 1. Expression of factor V (FV) in platelet-poor plasma (PPP) and platelets. A, Platelet lysates from TgFvþ/þ, TgþFvþ/, and TgþFv/ mice were analyzed using Western blotting with anti-FV antibody. B, Equal amounts of PPP from TgFvþ/þ, TgþFvþ/, and TgþFv/ mice were analyzed using Western blotting with anti-FV antibody. The graphs correspond to the blots and represent densitometric analyses of three independent experiments. The error bars show the standard error of the mean. *P < .05 vs TgFvþ/þ; **P < .05 vs TgþFvþ/.
Injection of hirudin. We injected a subset of TgFvþ/þ mice subcutaneously with hirudin (1.5 mg/kg body weight; Perfemiker, Shanghai, China) or saline once daily starting day 1 after surgery until 14 days. Perfusion of the ischemic and nonischemic hind limb was measured in each mouse. Immunofluorescence. Middle sections of the isolated ischemic gastrocnemius muscle were fixed in 4% paraformaldehyde, embedded in paraffin, and serially cut into 10-mm-thick sections. After the standard histologic procedures, the sections were incubated overnight at 4 C with 1:50 anti-platelet endothelial cell adhesion molecule (PECAM-1) and anti-CD41 antibodies (Santa Cruz Biotechnology Inc, Santa Cruz, Calif). The sections were incubated with 1:100 goat anti-rabbit IgG AlexaFluor 488conjugated antibody or 1:100 goat anti-mouse IgG AlexaFluor 568-conjugated antibody (both Molecular Probes, Invitrogen). Images were captured using an Olympus (DP70) microscope (Melville, NY) and evaluated using the Photoshop CS4 (Adobe, San Jose, Calif) function. The capillaries within the gastrocnemius muscle were immunostained with anti-PECAM-1 antibody. The percentage of area positive for PECAM-1 or total number of capillaries around each fiber was determined throughout entire cross-sectional regions.14-16 Quantification was performed by analyzing at least three sections and three fields per sample. Cell migration. Mouse aortic endothelial cell (EC) migration was studied using transwell migration chambers (Life Technologies) with bottom membranes containing
8-mm pores. ECs (2 104) were added to the upper chamber and treated with hirudin (2 mg/mL) or the vehicle control for 30 minutes, followed by adding purified platelets (3 108) or PPP (20 mL) from TgFvþ/þ, TgþFvþ/, or TgþFv/ mice to the upper chamber. After incubation for 24 hours at 37 C in a humidified chamber with 5% CO2, the ECs that migrated to the lower-chamber were stained with 0.5% crystal violet and counted. Data analysis. Image analyses were performed in a blinded fashion. The data are presented as the mean 6 standard error of the mean. The experimental groups were compared using the two-tailed Student t-test or one-way analysis of variance. RESULTS FV promoted recovery of hind limb reperfusion after femoral artery ligation. In previous studies, we generated transgenic mice with different levels of plasma and platelet pools of FV. FV in either pool is sufficient for hemostasis.13 These mice were generated by crossing tissue-specific FV transgenes into an FV-null background. The transgenic line AlbfvB was used in the current study.13 The transgene expressed FV from a liver-specific promoter. As a result, the TgþF5/ mouse expresses w15% of the wild-type plasma FV level with no detectable level of platelet FV. As demonstrated using Western blot analysis, TgþFv/ mice had no detectable level of platelet FV and the lowest level of PPP FV (Fig 1). To determine whether FV mediates the formation of functional vasculature, hind limb ischemia was induced in
4 Yang et al
JOURNAL OF VASCULAR SURGERY --- 2016
Fig 2. Factor V (FV) promotes recovery of hind limb perfusion after femoral artery ligation. A, Representative laserDoppler images of mouse hind limbs at indicated times after femoral artery ligation, with Pre indicating immediately before and Post indicating immediately after surgery. The red color denotes normal perfusion. B, The mean ratio of blood flow in ischemic and nonischemic hind limb footpads for all animals (n ¼ 6 per group) at indicated times. *P < .05 vs TgþFvþ/ and TgþFv/ at 11 and 14 days. C, Representative images of capillaries assessed using anti-platelet endothelial cell adhesion molecule 1 (PECAM-1) immunostaining in ischemic gastrocnemius muscles recovered 2 weeks after femoral artery interruption. Scale bars ¼ 100 mm. D, Mean capillary density in ischemic gastrocnemius muscles, assessed using anti-PECAM-1 immunostaining. E, Mean PECAM-1-positive microvessel/muscle fiber ratio in ischemic gastrocnemius muscles (n ¼ 6 per group). The error bars show the standard error of the mean. HPF, Highpower field. *P < .05 vs TgFvþ/þ; **P < .05 vs TgFvþ/þ and TgþFvþ/.
FV transgenic mice by ligation and excision of the femoral artery. Laser Doppler imaging revealed that the blood flow perfusion of the ischemic hind limb tissue after femoral artery interruption was significantly higher in TgFvþ/þ mice than in mice with lower levels of plasma and platelet FV (TgþFvþ/ and TgþFv/; Fig 2, A and B). The capillary formation in ischemic muscle was also correlated with the level of FV, in agreement with these results. The capillary density in the ischemic gastrocnemius muscle 2 weeks after induction of ischemia was significantly higher in TgFvþ/þ mice than in TgþFvþ/ or TgþFv/ mice (Fig 2, C-E). FV-mediated proangiogenic activity is associated with thrombin generation. Thrombin is a potent angiogenesis activator, and FV could exert its effect on microvascular angiogenesis through thrombin. To study the potential mechanisms by which FV promotes ischemiamediated angiogenesis, thrombin activity was measured in PPP, PRP, or hind limb ischemic muscles. As expected, the level of thrombin activity was highest in TgFvþ/þ mice and was lowest in TgþFv/ mice (Fig 3, A). The thrombin activity in the PRP of transgenic mice, with different levels of FV, was significantly greater than that of PPP, indicating
the contribution of platelets to thrombin generation. Interestingly, thrombin activity in the PRP of TgþFv/ mice was much higher than in PPP, suggesting that the presence of platelets, even without platelet FV, could still enhance thrombin generation. However, thrombin activity in ischemic muscles did not differ among TgFvþ/þ, TgþFvþ/, and TgþFv/ mice (Fig 3, B), suggesting that thrombin in the general circulation could partially lead to the difference in angiogenesis. To determine the role of thrombin in the involvement of FV modulation in ischemia-mediated flow perfusion, we used the direct thrombin inhibitor, hirudin, in the TgFvþ/þ mouse hind limb ischemia model. Mice were subcutaneously administered hirudin (1.5 mg/kg body weight) or saline once daily after surgery for 14 days. Laser Doppler imaging revealed that the blood flow perfusion of the ischemic hind limb tissue after femoral artery interruption was significantly blocked at 7, 12, and 14 days in hirudintreated mice compared with vehicle-treated control mice (Fig 3, C and D). We next examined the effect of FV on plateletmediated endothelial cell migration in vitro. Mouse aortic
JOURNAL OF VASCULAR SURGERY Volume -, Number -
Yang et al 5
Fig 3. Factor V (FV)-mediated proangiogenic activity is associated with thrombin generation. A, Thrombin activity was analyzed in platelet-rich plasma (PRP) and platelet-poor plasma (PPP) using a thrombin activity assay. *P < .05 vs TgFvþ/þ; **P < .05 vs TgFvþ/þ, TgþFvþ/. B, Thrombin activity was analyzed in ischemic muscles from TgFvþ/þ, TgþFvþ/, and TgþFvþ/, respectively. (C) Representative laser-Doppler images of mouse hind limbs at indicated times after femoral artery ligation in TgFvþ/þ mice treated with hirudin. D, Mean ratio of blood flow in ischemic and nonischemic hind limb footpads for all animals (n ¼ 6 per group) at indicated times. *P < .05 hirudin-treated group vs vehicle control. E, Cocultivation of endothelial cells (ECs) and platelets or PPP. ECs were grown on the upper chamber of transwell migration chambers and treated with hirudin or the vehicle control for 30 minutes, followed by the addition of purified platelets or PPP from TgF5þ/þ, TgþF5þ/, or TgþF5/ mice. After 24 hours at 37 C, the membranes were excised and stained. ECs that migrated to the lower chamber were counted. The means 6 standard error of the mean (range bars) of three independent experiments are shown. *P < .05 vs TgFvþ/þ; **P < .01 vs TgþF5þ/; #P < .05 vs TgFvþ/þ; ##P < .05 vs TgþF5þ/. Tg-Fv+/+
Relative VEGF-A
1
0.6 0.4
*
*
Relative FGF
Tg+Fv-/-
1.2
0.8
B
Tg+Fv+/-
1.4
Tg-Fv+/+
C
Tg-Fv+/+
1.4
Tg+Fv+/-
1.4
Tg+Fv+/-
1.2
Tg+Fv-/-
1.2
Tg+Fv-/-
1 0.8 0.6 0.4
* **
Relative MCP-1
A
1 0.8 0.6
*
0.4
0.2
0.2
0.2
0
0
0
**
Fig 4. Messenger RNA expression of major angiogenesis-related factors in ischemic muscles as assessed by real-time polymerase chain reaction. The mRNA expression of (A) vascular endothelial growth factor A (VEGF-A), (B) fibroblast growth factor 2 (FGF-2), and (C) monocyte chemoattractant protein 1 (MCP-1) were analyzed using real-time reverse-transcription polymerase chain reaction in TgF5þ/þ, TgþF5þ/, or TgþF5/ mice. The data were standardized by the expression level of 18S in each sample and are presented as the expression relative to nonischemia (n ¼ 6 per group). All values represent the mean 6 standard error of the mean (error bars). *P < .05 vs TgFvþ/þ; **P < .05 vs TgþF5þ/ and TgFvþ/þ.
ECs were coated on wells and then incubated with platelets or PPP derived from TgFvþ/þ, TgþFvþ/, or TgþFv/ mice. Adding platelets significantly promoted migration of ECs compared with PPP. Furthermore, platelets derived
from TgFvþ/þ mice promoted significantly more EC migration than platelets derived from TgþFvþ/ or TgþFv/ mice (Fig 3, E). We next studied the effects of FV on mouse aortic EC migration in the presence and in
6 Yang et al
JOURNAL OF VASCULAR SURGERY --- 2016
Fig 5. Platelet-derived factor V (FV) promotes recovery of hind limb perfusion after femoral artery ligation. A, Representative laser-Doppler images at indicated times after femoral artery ligation in mice during the platelet depletion and reinfusion model. B, Mean ratio of blood flow in ischemic and nonischemic hind limb footpads for all animals at indicated times (n ¼ 6 per group). *P < .05, TgFvþ/þ to TgþFvþ/ vs TgþFvþ/ to TgþFvþ/. C, Representative laser-Doppler images of mouse hind limbs at indicated times during the platelet depletion and reinfusion model from the TgFvþ/þ to TgþFv/ and TgþFv/ to TgþFv/ groups. D, Mean ratio of blood flow in ischemic and nonischemic hind limb footpads for all animals at indicated times (n ¼ 6 per group). *P < .05, TgFvþ/þ to TgþFv/ vs TgþFv/ to TgþFv/ at 11 days; **P < .05, Tg-Fvþ/þ to TgþFv/ vs TGþFv/ to TgþFv/ at 14 days. E, Representative images of capillaries assessed using anti-platelet endothelial cell adhesion molecule 1 (PECAM1) immunostaining in ischemic gastrocnemius muscles recovered 2 weeks after femoral artery interruption. Scale bars ¼ 100 mm. F, Mean capillary density in ischemic gastrocnemius muscles assessed using anti-PECAM-1 immunostaining. G, Mean PECAM-1-positive microvessel/muscle fiber ratio in ischemic gastrocnemius muscles (n ¼ 6 per group). The error bars indicate the standard error of the mean. *P < .05 vs TgFvþ/þ to TgþFv/.
the absence of hirudin. The promigratory effects of plateletFV were lost in the presence of hirudin (Fig 3, E). Together, these results supported the functional significance of platelet-derived FV in angiogenesis and its thrombin dependence. FV-mediated angiogenic factors are essential for ischemia-induced angiogenesis. To examine the potential roles of angiogenic factors in mediating blood flow perfusion by FV, we conducted a relative assessment of the gene expression of angiogenesis-related factors and arteriogenic molecules. Quantitative analysis by real-time polymerase chain reaction revealed that VEGF-A, FGF-2, and MCP-1 gene expression were upregulated in the ischemic muscles of TgFvþ/þ mice compared with the lower levels of plasma and platelet FV (TgþFvþ/ and TgþFv/) at 14 days after surgery (Fig 4). These results
may suggest that the expression of angiogenic factors is correlated with the level of FV during ischemia. Platelet FV promotes recovery of hind limb reperfusion. To study the contribution of platelet FV in ischemic reperfusion, we used a platelet depletion and reinfusion model to examine hind limb ischemia-induced angiogenesis in different groups (TgFvþ/þ/TgþFvþ/, TgþFvþ/ /TgþFvþ/ or TgFvþ/þ/TgþFv/, TgþFv/ /TgþFv/). Consistent with our previous report,17 platelet counts were successfully reduced using anti-mouse glycoprotein Ib-a rat IgG. We also evaluated the effect of platelet depletion on thrombin activity in TgFvþ/þ and TgþFv/ mice. Thrombin activity in PRP with different level of FV was significantly greater than that of platelet depletion; however, no difference was found in thrombin activity of PPP between normal the platelet and
JOURNAL OF VASCULAR SURGERY Volume -, Number -
Yang et al 7
Fig 6. Deposition of platelets in ischemic muscles after femoral artery ligation. A, Representative images of capillaries and platelets assessed using anti-platelet endothelial cell adhesion molecule 1 (PECAM-1; red color) and CD41 (green color) immunostaining in ischemic gastrocnemius muscles recovered 2 weeks after femoral artery interruption, respectively. Scale bars ¼ 100 mm. B, Mean platelet density in ischemic gastrocnemius muscles assessed using antiCD41 immunostaining (n ¼ 6 per group). *P < .05 vs TgFvþ/þ; **P < .05 vs TgFvþ/þ and TgþFvþ/. C, Representative images of capillaries and platelets in ischemic gastrocnemius muscles. D, Mean platelet density in ischemic gastrocnemius muscles assessed using anti-CD41 immunostaining (n ¼ 6 per group). A and C, The arrow indicates CD41-positive platelets; the arrowhead indicates merged anti-PECAM-1 and CD41-positive cells. The error bars indicate the standard error of the mean. *P < .05 vs TgFvþ/þ to TgþFv/.
platelet-depletion groups (Supplementary Fig, online only), indicating the contribution of platelet to thrombin generation. Reinfusion of platelets from a donor mouse to the thrombocytopenic mice successfully restored platelet counts. The blood flow perfusion level was increased 2.09-fold at 2 weeks in the TgFvþ/þ/TgþFvþ/ group compared with the TgþFvþ//TgþFvþ/ group (Fig 5, A and B). Similarly, with TgFvþ/þ platelet infusion, the blood flow perfusion level was increased 1.98-fold at 7 days and 1.36-fold at 2 weeks in TgþFv/ mice (Fig 5, C and D). Consistent with these results, the capillary density in ischemic gastrocnemius muscles 2 weeks after the induction of ischemia was significantly higher in TgFvþ/ þ /TgþFv/ mice than in TgþFv//TgþFv/ mice (Fig 5, E-G). Thus, the infusion of platelets with higher levels of FV promoted blood flow recovery after surgery. To test whether the proangiogenic effect of plateletderived FV is associated with the deposition of platelets, we further examined the deposition of platelets by assessing anti-CD41 immunostaining in the ischemic gastrocnemius muscles recovered 2 weeks after surgery. The number of CD41-positive platelets in extracapillary ischemic muscle was significantly greater in TgFvþ/þ (17 6 5.67 per high-power field [HPF]) than in TgþFvþ/ (3.16 6 1.57 per HPF) or TgþFv/ mice (1.58 6 0.95 per HPF;
Fig 6, A and B). Similarly, the number of extracapillary platelets in ischemic gastrocnemius muscles 2 weeks after the induction of ischemia was significantly higher in TgFvþ/þ/TgþFv/ (15.7 6 2.01/HPF) mice than in TgþFv//TgþFv/ mice (6.33 6 1.44/HPF; Fig 6, C and D). These data suggested that the platelets with higher levels of FV were more likely to be aggregated and activated at injury sites. DISCUSSION In our previous studies, we generated mice with different levels of FV in the plasma and platelet pools, leading to changes in thrombin generation. Interestingly, these mice demonstrated different susceptibilities to bacterial infection, which could be partially attributed to differences in thrombin generation.4 These mice thus can also be used to explore the effect of FV in angiogenesis. We used a hind limb reperfusion model after femoral artery ligation to study angiogenesis. We previously used this model to study how plasminogen activator inhibitor-1 affected angiogenesis.18 Femoral artery ligation was performed in three groups of mice that had different levels of FV in their plasma and platelet pools. Significantly reduced reperfusion rates were observed in mice with lower FV levels (Fig 2, A), suggesting reduced angiogenesis, which was supported by lower levels of capillary density as represented by
JOURNAL OF VASCULAR SURGERY --- 2016
8 Yang et al
PECAM-1 levels (Fig 2, B). The expression of angiogenesis-related genes (VEGF-A and FGF-2), as well as MCP-1, were correlated with the level of FV during ischemia. The level of angiogenesis also correlates with FV levels. In our previous studies, we demonstrated that the prothrombin time in TgþFv/ mice was significantly increased, suggesting defects in thrombin generation.13 As expected, thrombin activity in the PPP and PRP of mice with different levels of FV were closely correlated with their FV levels. TgþFv/ mice had the lowest thrombin activity in both PPP and PRP and also had the lowest level of angiogenesis. Furthermore, thrombin inhibitors blocked perfusion in TgFvþ/þ mice, indicating that FV mediated flow perfusion due to thrombin generation. Using an in vitro EC migration assay, we also found that platelets with higher levels of FV demonstrated stronger promigratory effects, which were abrogated by thrombin inhibitors, strongly supporting the proangiogenesis role of platelet FV. These results further supported the hypothesis that lower levels of FV could lead to lower thrombin generation and thus lead to a lower level of angiogenesis, although multiple factors could be involved. To further dissect the contribution of plasma and platelet FV to angiogenesis, mice with lower levels of FV were infused with platelets with higher levels of FV, leading to increased reperfusion rates and capillary density. These results suggested that increase platelet FV levels could significantly increase angiogenesis. Platelets with higher FV were also observed to aggregate at injury sites, which was directly correlated with higher ischemia-mediated capillary formation. Platelet activation simultaneously releases multiple proangiogenic and antiangiogenic regulators.19 Our data demonstrated that platelet FV is one of the proangiogenesis regulators and could be one of the important factors participating in capillary network formation enhanced by platelet release. A limitation of our hind limb ischemia model experiment is that we cannot definitively conclude that the angiogenic effects of platelet-derived FV are due to thrombin generation. Nevertheless, our hind limb ischemia model data support the significance of our proposed molecular mechanisms in a clinically relevant in vivo context, which demonstrated that FV promotes ischemia-mediated angiogenesis. Additional in vivo studies will be necessary to further dissect and better characterize the mechanisms, such as recombinant FV protein infusion, assessment of arteriogenesis, overexpression of thrombin, inflammatory cell infiltration studies, and so on. CONCLUSIONS A new platelet-dependent pathway for angiogenesis that does not significantly affect hemostatic balance could serve as a potential angiogenic therapeutic target. Our finding of the effect of platelet FV in angiogenesis could open another venue for modulating angiogenesis for therapeutic benefits. Of note, targeting thrombin and the coagulation system could lead to severe adverse effects,
such as excessive clotting or bleeding. However, targeting only platelet FV could significantly diminish bleeding risks, because plasma FV could still provide sufficient coagulation activity. AUTHOR CONTRIBUTIONS Conception and design: YY, LX, NC, YL, XD, LW, HS, JW Analysis and interpretation: YY, LX, NC, YL, XD, LW, HS, JW Data collection: YY, LX, NC, YL, XD, LW, HS, JW Writing the article: YY, LX, NC, YL, XD, LW, HS, JW Critical revision of the article: YY, LX, NC, YL, XD, LW, HS, JW Final approval of the article: YY, LX, NC, YL, XD, LW, HS, JW Statistical analysis: YY, JW Obtained funding: JW Overall responsibility: JW REFERENCES 1. Gould WR, Silveira JR, Tracy PB. Unique in vivo modifications of coagulation factor V produce a physically and functionally distinct platelet-derived cofactor: characterization of purified platelet-derived factor V/Va. J Biol Chem 2004;279:2383-93. 2. Gould WR, Simioni P, Silveira JR, Tormene D, Kalafatis M, Tracy PB. Megakaryocytes endocytose and subsequently modify human factor V in vivo to form the entire pool of a unique platelet-derived cofactor. J Thromb Haemost 2005;3:450-6. 3. Duckers C, Simioni P, Spiezia L, Radu C, Dabrilli P, Gavasso S, et al. Residual platelet factor V ensures thrombin generation in patients with severe congenital factor V deficiency and mild bleeding symptoms. Blood 2010;115:879-86. 4. Sun H, Wang X, Degen JL, Ginsburg D. Reduced thrombin generation increases host susceptibility to group A streptococcal infection. Blood 2009;113:1358-64. 5. Haralabopoulos GC, Grant DS, Klienman HK, Maragoudakis ME. Thrombin promotes endothelial cell alignment in matrigel in vitro and angiogenesis in vivo. Am J Physiol Cell Physiol 1997;273:C239. 6. Tsopanoglou NE, Maragoudakis ME. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost 2004;30:63-9. 7. Diebold I, Petry A, Djordjevic T, Belaiba RS, Fineman J, Black S, et al. Reciprocal regulation of Rac1 and PAK-1 by HIF-1alpha: a positivefeedback loop promoting pulmonary vascular remodeling. Antioxid Redox Signal 2010;13:399-412. 8. Diebold I, Djordjevic T, Hess J, Görlach A. Rac-1 promotes pulmonary artery smooth muscle cell proliferation by upregulation of plasminogen activator inhibitor-1: role of NFkappaB dependent hypoxia-inducible factor-1alpha transcription. Thromb Haemost 2008;100:1021-8. 9. Lange S, Gonzalez I, Pinto MP, Arce M, Valenzuela R, Aranda E, et al. Independent anti-angiogenic capacities of coagulation factors X and Xa. J Cell Physiol 2014;229:1673-80. 10. Chen J, Bierhaus A, Schiekofer S, Andrassy M, Chen B, Stern DM, et al. Tissue factorea receptor involved in the control of cellular properties, including angiogenesis. Thromb Haemost 2001;86:334-45. 11. Brunner G, Nguyen H, Gabrilove J, Rifkin DB, Wilson EL. Basic fibroblast growth factor expression in human bone marrow and peripheral blood cells. Blood 1993;81:631-8. 12. McMahon GA, Petitclerc E, Stefansson S, Smith E, Wong MK, Westrick RJ, et al. Plasminogen activator inhibitor-1 regulates tumor growth and angiogenesis. J Biol Chem 2001;276:33964-8. 13. Sun H, Yang TL, Yang A, Wang X, Ginsburg D. The murine platelet and plasma factor V pools are biosynthetically distinct and sufficient for minimal hemostasis. Blood 2003;102:2856-61.
JOURNAL OF VASCULAR SURGERY Volume -, Number -
14. Couffinhal T, Silver M, Zheng LP, Kearney M, Witzenbichler B, Isner JM. Mouse model of angiogenesis. Am J Pathol 1998;152: 1667-79. 15. Tang K, Breen EC, Gerber HP, Ferrara NM, Wagner PD. Capillary regression in vascular endothelial growth factor-deficient skeletal muscle. Physiol Genomics 2004;18:63-9. 16. He Y, Luo Y, Tang S, Rajantie I, Salven P, Heil M, et al. Critical function of Bmx/Etk in ischemia-mediated arteriogenesis and angiogenesis. J Clin Invest 2006;116:2344-55. 17. Ren M, Li R, Luo M, Chen N, Deng X, Yan K, et al. Endothelial cells but not platelets are the major source of Toll-like receptor 4 in the arterial thrombosis and tissue factor expression in mice. Am J Physiol Regul Integr Comp Physiol 2014;307:R901-7.
Yang et al 9
18. Wu J, Strawn TL, Luo M, Wang L, Li R, Ren M, et al. Plasminogen activator inhibitor-1 inhibits angiogenic signaling by uncoupling vascular endothelial growth factor receptor-2-aVb3 integrin cross talk. Arterioscler Thromb Vasc Biol 2015;35:111-20. 19. Chatterjee M, Huang Z, Zhang W, Jiang L, Hultenby K, Zhu L, et al. Distinct platelet packaging, release, and surface expression of proangiogenic and antiangiogenic factors on different platelet stimuli. Blood 2011;117:3907-11. Submitted Jan 5, 2016; accepted Mar 18, 2016.
Additional material for this article may be found online at www.jvascsurg.org.
9.e1 Yang et al
JOURNAL OF VASCULAR SURGERY --- 2016
Supplementary Fig (online only). Effects of platelet (PLT) depletion on thrombin activity. Thrombin activity was analyzed in PLT-rich plasma (PRP) and PLT-poor plasma (PPP) by thrombin activity assay in (A) Tg Fvþ/þ and (B) TgþFv/ mice (n ¼ 3 per group). The error bars indicate the standard error of the mean. *P < .05 vs normal PLT.
Factor V (FV) is a central regulatory protein in the blood coagulation cascade that plays critical roles in both procoagulant and anticoagulant pathways. It serves as a critical cofactor for factor Xa, forming the prothrombinase complex to convert prothrombin to thrombin in the presence of calcium and a phospholipid surface. FV is distributed into distinct plasma and platelet compartments, with w80% of total blood FV in the former and w20% in the latter. Clinical and experimental evidence also suggest From the Drug Discovery Research Center, Southwest Medical University, Luzhoua; the Laboratory for Cardiovascular Pharmacology of the Department of Pharmacology, School of Pharmacy, Southwest Medical University, Luzhoub; and the Department of Medicine, University of Missouri School of Medicine, Columbia.c This work was supported by National Natural Science Foundation of China Grant 81570263 and by Sichuan Province Science and Technology Agency Grant 2014FZ0104 to J.W. Author conflict of interest: H.S. owns stocks in Nanova Inc. Additional material for this article may be found online at www.jvascsurg.org. Correspondence: Jianbo Wu, PhD, Division of Cardiovascular Medicine, University of Missouri, 5 Hospital Dr, CE344-DC095.00, Columbia, MO 65212 (e-mail: [email protected]). The editors and reviewers of this article have no relevant financial relationships to disclose per the JVS policy that requires reviewers to decline review of any manuscript for which they may have a conflict of interest. 0741-5214 Copyright Ó 2016 by the The Society for Vascular Surgery. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.jvs.2016.03.453
that human platelet and plasma FV may be functionally distinct.1,2 Platelet-derived FVa has been reported to be more resistant to activated protein C cleavage and expresses significantly more FXa cofactor activity than plasmaderived FVa.1 Patients with undetectable plasma FV, but detectable platelet FV, had only relatively mild bleeding, suggesting that platelet FV is critical for coagulation and thrombin generation.3 Although FV is a critical factor in hemostasis, it can also affect the host’s susceptibility to infection due to its effect on thrombin generation.4 Thrombin is a multifunctional protein that has roles in coagulation as well as in cell proliferation and angiogenesis. Thrombin is a potent activator of angiogenesis, which is independent of its function in fibrin formation.5 Previous studies demonstrated that thrombin activated angiogenesis through regulation of multiple pathways, such as regulation of vascular endothelial growth factor (VEGF) avb3 integrin, reactive oxygen species, and the expression of the hypoxia inducible factor 1 signaling pathways.6-8 Other coagulation factors, such as tissue factor and factor X are also involved in controlling angiogenesis.9,10 Platelets and the fibrinolytic system contain many regulators of angiogenesis.11,12 Studying the specific roles of individual hemostatic proteins in angiogenesis could lead to novel therapeutic approaches to treat cancers and ischemia by targeting the angiogenesis functions of the hemostatic proteins. However, no studies have implicated FV in 1
2 Yang et al
controlling angiogenesis. Given that platelet FV affects thrombin generation, we hypothesized that platelet FV could play an important role in angiogenesis. METHODS The protocols for animal use in this study were reviewed and approved by the Animal Care Committee of Sichuan Medical University in accordance with the Institutional Animal Care and Use Committee guidelines. Animals. TgF5þ/þ, TgþF5þ/, TgþF5/ mice were previously generated and characterized13 on a background strain of C57BL/6 mice. The mice exhibited different levels of FV gene expression restricted to the plasma or platelets (TgF5þ/þ, 100%/100%; TgþF5þ/, 65%/50%; TgþF5/, 15%/0%). Male TgF5þ/þ, TgþF5þ/, and TgþF5/ litter mates, aged between 6 and 8 weeks and weighing between 25 and 30 g, were used for all experiments. Immunoblotting. Isolated mouse platelets were homogenized in radioimmunoprecipitation assay buffer (Sigma-Aldrich, St. Louis, Mo). Equal amounts of protein underwent sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were transferred to polyvinylidene difluoride membranes by electroblotting. After blocking, the membranes were incubated with anti-FV antibody (a gift from Dr David Ginsburg, University of Michigan) and b-actin. Mouse hind limb ischemia model. Unilateral hind limb ischemia was induced in mice by ligation and excision of a segment of the left femoral artery, as previously described.14,15 Mice were anesthetized using intraperitoneal sodium pentobarbital (60 mg/kg body weight) or isoflurane (5% by inhalation). A subcutaneous dose of buprenorphine hydrochloride (0.1 mg/kg) was administered for analgesia. Additional sodium pentobarbital (12 mg/kg body weight) or 5% isoflurane was given as needed to maintain anesthesia. The proximal portion of the femoral artery and the distal portion of the saphenous artery were ligated, and excision of the femoral bifurcation with all branches was performed. To minimize ambient light and temperature variation, mice were kept on a heating plate at 37 C for w10 minutes before measurement in a darkened room.14 Perfusion of the ischemic and nonischemic hind limb of the distal foot was measured in each mouse by laser Doppler imaging immediately before surgery, immediately after ligation, and at 3, 7, 12, and 14 days after ligation using a scanning moorLDI2-HIR (Moor Instruments, Wilmington, Del) high-resolution laser Doppler imager. Quantitative real-time polymerase chain reaction. The ischemic gastrocnemius muscle was excised, embedded in paraffin, and cross-sections were prepared for immunofluorescence analysis. Total RNA was extracted from the ischemic gastrocnemius muscles using TRIzol (Invitrogen, Carlsbad, Calif). RNA was pretreated with DNA (Invitrogen Life Technologies, Grand Island, NY), and SuperScript (Invitrogen Life Technologies) was used to
JOURNAL OF VASCULAR SURGERY --- 2016
synthesize complementary DNA according the manufacturer’s recommended conditions. Each sample was analyzed in duplicate with ribosomal 18S messenger RNA used as a control. After amplification, the relative differences in the amount of RNA were calculated based on the 2DDCT method. The oligonucleotide sequences of the polymerase chain reaction primers were: (1) VEGF-A (GCAGGCTGCTGTAACGATGAA, TCACATCTGCTGTGCTGTAGGA); (2) fibroblast growth factor (FGF)-2 (GGACG GCTGCTGGCTTCTAA, CCAGTTCGTTTCA GTGCCACATAC); (3) monocyte chemoattractant protein (MCP)-1 (CAGCCAGATGCAGTTAACGC, GCCTACTCATTGGGATCATCTTG); and (4) 18S (CCTGGATACCGCAGCTAGGA, GCGG CGCAATACGAATGCCCC). Thrombin activity assay. Blood was collected into citrate anticoagulant tubes, and plasma was prepared by centrifugation. The ischemic muscles were homogenized with 0.3 mL of phosphate-buffered saline (pH 7.2), and the homogenates were centrifuged at 12,000g for 15 minutes. Thrombin activity was measured using a SensoLyte 520 Thrombin Assay Kit (AnaSpec Inc, Fremont, Calif). Platelet depletion. To deplete endogenous platelets, mice were injected intraperitoneally every 3 days with 2.5 mg/g mouse platelet-depleting antibody (polyclonal anti-mouse glycoprotein Ib-a rat immunoglobulin G [IgG]; Emfret Analytics, Eibelstadt, Germany), and the platelets were counted. Platelet isolation and transfusion. To determine whether platelet-derived FV contributes to microvascular angiogenesis during rodent hind limb ischemia, mice were anesthetized, as described above, and whole blood was collected from the inferior vena cava using a 1 mL syringe containing 0.1 mL sodium citrate anticoagulant. Plateletrich plasma (PRP) was obtained from whole blood by centrifugation at 260g for 8 minutes and 260g for an additional 3 minutes. The supernatant was collected after each centrifugation. The platelets were isolated from the PRP using a Sepharose 2B column in PIPES buffer (PIPES, 5 mM; NaCl, 1.37 mM; KCl 4, mM, glucose 0.1%, pH 7.0). Platelet-poor plasma (PPP) was prepared by centrifugation at 1500g for 20 minutes. The PPP was further centrifuged at 10,000g for 5 minutes to remove the remaining cells. The pellet containing the platelets was then resuspended in 1 mL of phosphate-buffered saline (SigmaAldrich), allowed to sit for 30 minutes, and the platelets were counted with a hemocytometer. The platelets from the suspension were diluted with normal saline to a concentration of 1.56 109 platelets in 1.2 mL. We transfused 0.2 mL of the suspension via the tail vein into each recipient mouse every 6 days.
JOURNAL OF VASCULAR SURGERY Volume -, Number -
Yang et al 3
Fig 1. Expression of factor V (FV) in platelet-poor plasma (PPP) and platelets. A, Platelet lysates from TgFvþ/þ, TgþFvþ/, and TgþFv/ mice were analyzed using Western blotting with anti-FV antibody. B, Equal amounts of PPP from TgFvþ/þ, TgþFvþ/, and TgþFv/ mice were analyzed using Western blotting with anti-FV antibody. The graphs correspond to the blots and represent densitometric analyses of three independent experiments. The error bars show the standard error of the mean. *P < .05 vs TgFvþ/þ; **P < .05 vs TgþFvþ/.
Injection of hirudin. We injected a subset of TgFvþ/þ mice subcutaneously with hirudin (1.5 mg/kg body weight; Perfemiker, Shanghai, China) or saline once daily starting day 1 after surgery until 14 days. Perfusion of the ischemic and nonischemic hind limb was measured in each mouse. Immunofluorescence. Middle sections of the isolated ischemic gastrocnemius muscle were fixed in 4% paraformaldehyde, embedded in paraffin, and serially cut into 10-mm-thick sections. After the standard histologic procedures, the sections were incubated overnight at 4 C with 1:50 anti-platelet endothelial cell adhesion molecule (PECAM-1) and anti-CD41 antibodies (Santa Cruz Biotechnology Inc, Santa Cruz, Calif). The sections were incubated with 1:100 goat anti-rabbit IgG AlexaFluor 488conjugated antibody or 1:100 goat anti-mouse IgG AlexaFluor 568-conjugated antibody (both Molecular Probes, Invitrogen). Images were captured using an Olympus (DP70) microscope (Melville, NY) and evaluated using the Photoshop CS4 (Adobe, San Jose, Calif) function. The capillaries within the gastrocnemius muscle were immunostained with anti-PECAM-1 antibody. The percentage of area positive for PECAM-1 or total number of capillaries around each fiber was determined throughout entire cross-sectional regions.14-16 Quantification was performed by analyzing at least three sections and three fields per sample. Cell migration. Mouse aortic endothelial cell (EC) migration was studied using transwell migration chambers (Life Technologies) with bottom membranes containing
8-mm pores. ECs (2 104) were added to the upper chamber and treated with hirudin (2 mg/mL) or the vehicle control for 30 minutes, followed by adding purified platelets (3 108) or PPP (20 mL) from TgFvþ/þ, TgþFvþ/, or TgþFv/ mice to the upper chamber. After incubation for 24 hours at 37 C in a humidified chamber with 5% CO2, the ECs that migrated to the lower-chamber were stained with 0.5% crystal violet and counted. Data analysis. Image analyses were performed in a blinded fashion. The data are presented as the mean 6 standard error of the mean. The experimental groups were compared using the two-tailed Student t-test or one-way analysis of variance. RESULTS FV promoted recovery of hind limb reperfusion after femoral artery ligation. In previous studies, we generated transgenic mice with different levels of plasma and platelet pools of FV. FV in either pool is sufficient for hemostasis.13 These mice were generated by crossing tissue-specific FV transgenes into an FV-null background. The transgenic line AlbfvB was used in the current study.13 The transgene expressed FV from a liver-specific promoter. As a result, the TgþF5/ mouse expresses w15% of the wild-type plasma FV level with no detectable level of platelet FV. As demonstrated using Western blot analysis, TgþFv/ mice had no detectable level of platelet FV and the lowest level of PPP FV (Fig 1). To determine whether FV mediates the formation of functional vasculature, hind limb ischemia was induced in
4 Yang et al
JOURNAL OF VASCULAR SURGERY --- 2016
Fig 2. Factor V (FV) promotes recovery of hind limb perfusion after femoral artery ligation. A, Representative laserDoppler images of mouse hind limbs at indicated times after femoral artery ligation, with Pre indicating immediately before and Post indicating immediately after surgery. The red color denotes normal perfusion. B, The mean ratio of blood flow in ischemic and nonischemic hind limb footpads for all animals (n ¼ 6 per group) at indicated times. *P < .05 vs TgþFvþ/ and TgþFv/ at 11 and 14 days. C, Representative images of capillaries assessed using anti-platelet endothelial cell adhesion molecule 1 (PECAM-1) immunostaining in ischemic gastrocnemius muscles recovered 2 weeks after femoral artery interruption. Scale bars ¼ 100 mm. D, Mean capillary density in ischemic gastrocnemius muscles, assessed using anti-PECAM-1 immunostaining. E, Mean PECAM-1-positive microvessel/muscle fiber ratio in ischemic gastrocnemius muscles (n ¼ 6 per group). The error bars show the standard error of the mean. HPF, Highpower field. *P < .05 vs TgFvþ/þ; **P < .05 vs TgFvþ/þ and TgþFvþ/.
FV transgenic mice by ligation and excision of the femoral artery. Laser Doppler imaging revealed that the blood flow perfusion of the ischemic hind limb tissue after femoral artery interruption was significantly higher in TgFvþ/þ mice than in mice with lower levels of plasma and platelet FV (TgþFvþ/ and TgþFv/; Fig 2, A and B). The capillary formation in ischemic muscle was also correlated with the level of FV, in agreement with these results. The capillary density in the ischemic gastrocnemius muscle 2 weeks after induction of ischemia was significantly higher in TgFvþ/þ mice than in TgþFvþ/ or TgþFv/ mice (Fig 2, C-E). FV-mediated proangiogenic activity is associated with thrombin generation. Thrombin is a potent angiogenesis activator, and FV could exert its effect on microvascular angiogenesis through thrombin. To study the potential mechanisms by which FV promotes ischemiamediated angiogenesis, thrombin activity was measured in PPP, PRP, or hind limb ischemic muscles. As expected, the level of thrombin activity was highest in TgFvþ/þ mice and was lowest in TgþFv/ mice (Fig 3, A). The thrombin activity in the PRP of transgenic mice, with different levels of FV, was significantly greater than that of PPP, indicating
the contribution of platelets to thrombin generation. Interestingly, thrombin activity in the PRP of TgþFv/ mice was much higher than in PPP, suggesting that the presence of platelets, even without platelet FV, could still enhance thrombin generation. However, thrombin activity in ischemic muscles did not differ among TgFvþ/þ, TgþFvþ/, and TgþFv/ mice (Fig 3, B), suggesting that thrombin in the general circulation could partially lead to the difference in angiogenesis. To determine the role of thrombin in the involvement of FV modulation in ischemia-mediated flow perfusion, we used the direct thrombin inhibitor, hirudin, in the TgFvþ/þ mouse hind limb ischemia model. Mice were subcutaneously administered hirudin (1.5 mg/kg body weight) or saline once daily after surgery for 14 days. Laser Doppler imaging revealed that the blood flow perfusion of the ischemic hind limb tissue after femoral artery interruption was significantly blocked at 7, 12, and 14 days in hirudintreated mice compared with vehicle-treated control mice (Fig 3, C and D). We next examined the effect of FV on plateletmediated endothelial cell migration in vitro. Mouse aortic
JOURNAL OF VASCULAR SURGERY Volume -, Number -
Yang et al 5
Fig 3. Factor V (FV)-mediated proangiogenic activity is associated with thrombin generation. A, Thrombin activity was analyzed in platelet-rich plasma (PRP) and platelet-poor plasma (PPP) using a thrombin activity assay. *P < .05 vs TgFvþ/þ; **P < .05 vs TgFvþ/þ, TgþFvþ/. B, Thrombin activity was analyzed in ischemic muscles from TgFvþ/þ, TgþFvþ/, and TgþFvþ/, respectively. (C) Representative laser-Doppler images of mouse hind limbs at indicated times after femoral artery ligation in TgFvþ/þ mice treated with hirudin. D, Mean ratio of blood flow in ischemic and nonischemic hind limb footpads for all animals (n ¼ 6 per group) at indicated times. *P < .05 hirudin-treated group vs vehicle control. E, Cocultivation of endothelial cells (ECs) and platelets or PPP. ECs were grown on the upper chamber of transwell migration chambers and treated with hirudin or the vehicle control for 30 minutes, followed by the addition of purified platelets or PPP from TgF5þ/þ, TgþF5þ/, or TgþF5/ mice. After 24 hours at 37 C, the membranes were excised and stained. ECs that migrated to the lower chamber were counted. The means 6 standard error of the mean (range bars) of three independent experiments are shown. *P < .05 vs TgFvþ/þ; **P < .01 vs TgþF5þ/; #P < .05 vs TgFvþ/þ; ##P < .05 vs TgþF5þ/. Tg-Fv+/+
Relative VEGF-A
1
0.6 0.4
*
*
Relative FGF
Tg+Fv-/-
1.2
0.8
B
Tg+Fv+/-
1.4
Tg-Fv+/+
C
Tg-Fv+/+
1.4
Tg+Fv+/-
1.4
Tg+Fv+/-
1.2
Tg+Fv-/-
1.2
Tg+Fv-/-
1 0.8 0.6 0.4
* **
Relative MCP-1
A
1 0.8 0.6
*
0.4
0.2
0.2
0.2
0
0
0
**
Fig 4. Messenger RNA expression of major angiogenesis-related factors in ischemic muscles as assessed by real-time polymerase chain reaction. The mRNA expression of (A) vascular endothelial growth factor A (VEGF-A), (B) fibroblast growth factor 2 (FGF-2), and (C) monocyte chemoattractant protein 1 (MCP-1) were analyzed using real-time reverse-transcription polymerase chain reaction in TgF5þ/þ, TgþF5þ/, or TgþF5/ mice. The data were standardized by the expression level of 18S in each sample and are presented as the expression relative to nonischemia (n ¼ 6 per group). All values represent the mean 6 standard error of the mean (error bars). *P < .05 vs TgFvþ/þ; **P < .05 vs TgþF5þ/ and TgFvþ/þ.
ECs were coated on wells and then incubated with platelets or PPP derived from TgFvþ/þ, TgþFvþ/, or TgþFv/ mice. Adding platelets significantly promoted migration of ECs compared with PPP. Furthermore, platelets derived
from TgFvþ/þ mice promoted significantly more EC migration than platelets derived from TgþFvþ/ or TgþFv/ mice (Fig 3, E). We next studied the effects of FV on mouse aortic EC migration in the presence and in
6 Yang et al
JOURNAL OF VASCULAR SURGERY --- 2016
Fig 5. Platelet-derived factor V (FV) promotes recovery of hind limb perfusion after femoral artery ligation. A, Representative laser-Doppler images at indicated times after femoral artery ligation in mice during the platelet depletion and reinfusion model. B, Mean ratio of blood flow in ischemic and nonischemic hind limb footpads for all animals at indicated times (n ¼ 6 per group). *P < .05, TgFvþ/þ to TgþFvþ/ vs TgþFvþ/ to TgþFvþ/. C, Representative laser-Doppler images of mouse hind limbs at indicated times during the platelet depletion and reinfusion model from the TgFvþ/þ to TgþFv/ and TgþFv/ to TgþFv/ groups. D, Mean ratio of blood flow in ischemic and nonischemic hind limb footpads for all animals at indicated times (n ¼ 6 per group). *P < .05, TgFvþ/þ to TgþFv/ vs TgþFv/ to TgþFv/ at 11 days; **P < .05, Tg-Fvþ/þ to TgþFv/ vs TGþFv/ to TgþFv/ at 14 days. E, Representative images of capillaries assessed using anti-platelet endothelial cell adhesion molecule 1 (PECAM1) immunostaining in ischemic gastrocnemius muscles recovered 2 weeks after femoral artery interruption. Scale bars ¼ 100 mm. F, Mean capillary density in ischemic gastrocnemius muscles assessed using anti-PECAM-1 immunostaining. G, Mean PECAM-1-positive microvessel/muscle fiber ratio in ischemic gastrocnemius muscles (n ¼ 6 per group). The error bars indicate the standard error of the mean. *P < .05 vs TgFvþ/þ to TgþFv/.
the absence of hirudin. The promigratory effects of plateletFV were lost in the presence of hirudin (Fig 3, E). Together, these results supported the functional significance of platelet-derived FV in angiogenesis and its thrombin dependence. FV-mediated angiogenic factors are essential for ischemia-induced angiogenesis. To examine the potential roles of angiogenic factors in mediating blood flow perfusion by FV, we conducted a relative assessment of the gene expression of angiogenesis-related factors and arteriogenic molecules. Quantitative analysis by real-time polymerase chain reaction revealed that VEGF-A, FGF-2, and MCP-1 gene expression were upregulated in the ischemic muscles of TgFvþ/þ mice compared with the lower levels of plasma and platelet FV (TgþFvþ/ and TgþFv/) at 14 days after surgery (Fig 4). These results
may suggest that the expression of angiogenic factors is correlated with the level of FV during ischemia. Platelet FV promotes recovery of hind limb reperfusion. To study the contribution of platelet FV in ischemic reperfusion, we used a platelet depletion and reinfusion model to examine hind limb ischemia-induced angiogenesis in different groups (TgFvþ/þ/TgþFvþ/, TgþFvþ/ /TgþFvþ/ or TgFvþ/þ/TgþFv/, TgþFv/ /TgþFv/). Consistent with our previous report,17 platelet counts were successfully reduced using anti-mouse glycoprotein Ib-a rat IgG. We also evaluated the effect of platelet depletion on thrombin activity in TgFvþ/þ and TgþFv/ mice. Thrombin activity in PRP with different level of FV was significantly greater than that of platelet depletion; however, no difference was found in thrombin activity of PPP between normal the platelet and
JOURNAL OF VASCULAR SURGERY Volume -, Number -
Yang et al 7
Fig 6. Deposition of platelets in ischemic muscles after femoral artery ligation. A, Representative images of capillaries and platelets assessed using anti-platelet endothelial cell adhesion molecule 1 (PECAM-1; red color) and CD41 (green color) immunostaining in ischemic gastrocnemius muscles recovered 2 weeks after femoral artery interruption, respectively. Scale bars ¼ 100 mm. B, Mean platelet density in ischemic gastrocnemius muscles assessed using antiCD41 immunostaining (n ¼ 6 per group). *P < .05 vs TgFvþ/þ; **P < .05 vs TgFvþ/þ and TgþFvþ/. C, Representative images of capillaries and platelets in ischemic gastrocnemius muscles. D, Mean platelet density in ischemic gastrocnemius muscles assessed using anti-CD41 immunostaining (n ¼ 6 per group). A and C, The arrow indicates CD41-positive platelets; the arrowhead indicates merged anti-PECAM-1 and CD41-positive cells. The error bars indicate the standard error of the mean. *P < .05 vs TgFvþ/þ to TgþFv/.
platelet-depletion groups (Supplementary Fig, online only), indicating the contribution of platelet to thrombin generation. Reinfusion of platelets from a donor mouse to the thrombocytopenic mice successfully restored platelet counts. The blood flow perfusion level was increased 2.09-fold at 2 weeks in the TgFvþ/þ/TgþFvþ/ group compared with the TgþFvþ//TgþFvþ/ group (Fig 5, A and B). Similarly, with TgFvþ/þ platelet infusion, the blood flow perfusion level was increased 1.98-fold at 7 days and 1.36-fold at 2 weeks in TgþFv/ mice (Fig 5, C and D). Consistent with these results, the capillary density in ischemic gastrocnemius muscles 2 weeks after the induction of ischemia was significantly higher in TgFvþ/ þ /TgþFv/ mice than in TgþFv//TgþFv/ mice (Fig 5, E-G). Thus, the infusion of platelets with higher levels of FV promoted blood flow recovery after surgery. To test whether the proangiogenic effect of plateletderived FV is associated with the deposition of platelets, we further examined the deposition of platelets by assessing anti-CD41 immunostaining in the ischemic gastrocnemius muscles recovered 2 weeks after surgery. The number of CD41-positive platelets in extracapillary ischemic muscle was significantly greater in TgFvþ/þ (17 6 5.67 per high-power field [HPF]) than in TgþFvþ/ (3.16 6 1.57 per HPF) or TgþFv/ mice (1.58 6 0.95 per HPF;
Fig 6, A and B). Similarly, the number of extracapillary platelets in ischemic gastrocnemius muscles 2 weeks after the induction of ischemia was significantly higher in TgFvþ/þ/TgþFv/ (15.7 6 2.01/HPF) mice than in TgþFv//TgþFv/ mice (6.33 6 1.44/HPF; Fig 6, C and D). These data suggested that the platelets with higher levels of FV were more likely to be aggregated and activated at injury sites. DISCUSSION In our previous studies, we generated mice with different levels of FV in the plasma and platelet pools, leading to changes in thrombin generation. Interestingly, these mice demonstrated different susceptibilities to bacterial infection, which could be partially attributed to differences in thrombin generation.4 These mice thus can also be used to explore the effect of FV in angiogenesis. We used a hind limb reperfusion model after femoral artery ligation to study angiogenesis. We previously used this model to study how plasminogen activator inhibitor-1 affected angiogenesis.18 Femoral artery ligation was performed in three groups of mice that had different levels of FV in their plasma and platelet pools. Significantly reduced reperfusion rates were observed in mice with lower FV levels (Fig 2, A), suggesting reduced angiogenesis, which was supported by lower levels of capillary density as represented by
JOURNAL OF VASCULAR SURGERY --- 2016
8 Yang et al
PECAM-1 levels (Fig 2, B). The expression of angiogenesis-related genes (VEGF-A and FGF-2), as well as MCP-1, were correlated with the level of FV during ischemia. The level of angiogenesis also correlates with FV levels. In our previous studies, we demonstrated that the prothrombin time in TgþFv/ mice was significantly increased, suggesting defects in thrombin generation.13 As expected, thrombin activity in the PPP and PRP of mice with different levels of FV were closely correlated with their FV levels. TgþFv/ mice had the lowest thrombin activity in both PPP and PRP and also had the lowest level of angiogenesis. Furthermore, thrombin inhibitors blocked perfusion in TgFvþ/þ mice, indicating that FV mediated flow perfusion due to thrombin generation. Using an in vitro EC migration assay, we also found that platelets with higher levels of FV demonstrated stronger promigratory effects, which were abrogated by thrombin inhibitors, strongly supporting the proangiogenesis role of platelet FV. These results further supported the hypothesis that lower levels of FV could lead to lower thrombin generation and thus lead to a lower level of angiogenesis, although multiple factors could be involved. To further dissect the contribution of plasma and platelet FV to angiogenesis, mice with lower levels of FV were infused with platelets with higher levels of FV, leading to increased reperfusion rates and capillary density. These results suggested that increase platelet FV levels could significantly increase angiogenesis. Platelets with higher FV were also observed to aggregate at injury sites, which was directly correlated with higher ischemia-mediated capillary formation. Platelet activation simultaneously releases multiple proangiogenic and antiangiogenic regulators.19 Our data demonstrated that platelet FV is one of the proangiogenesis regulators and could be one of the important factors participating in capillary network formation enhanced by platelet release. A limitation of our hind limb ischemia model experiment is that we cannot definitively conclude that the angiogenic effects of platelet-derived FV are due to thrombin generation. Nevertheless, our hind limb ischemia model data support the significance of our proposed molecular mechanisms in a clinically relevant in vivo context, which demonstrated that FV promotes ischemia-mediated angiogenesis. Additional in vivo studies will be necessary to further dissect and better characterize the mechanisms, such as recombinant FV protein infusion, assessment of arteriogenesis, overexpression of thrombin, inflammatory cell infiltration studies, and so on. CONCLUSIONS A new platelet-dependent pathway for angiogenesis that does not significantly affect hemostatic balance could serve as a potential angiogenic therapeutic target. Our finding of the effect of platelet FV in angiogenesis could open another venue for modulating angiogenesis for therapeutic benefits. Of note, targeting thrombin and the coagulation system could lead to severe adverse effects,
such as excessive clotting or bleeding. However, targeting only platelet FV could significantly diminish bleeding risks, because plasma FV could still provide sufficient coagulation activity. AUTHOR CONTRIBUTIONS Conception and design: YY, LX, NC, YL, XD, LW, HS, JW Analysis and interpretation: YY, LX, NC, YL, XD, LW, HS, JW Data collection: YY, LX, NC, YL, XD, LW, HS, JW Writing the article: YY, LX, NC, YL, XD, LW, HS, JW Critical revision of the article: YY, LX, NC, YL, XD, LW, HS, JW Final approval of the article: YY, LX, NC, YL, XD, LW, HS, JW Statistical analysis: YY, JW Obtained funding: JW Overall responsibility: JW REFERENCES 1. Gould WR, Silveira JR, Tracy PB. Unique in vivo modifications of coagulation factor V produce a physically and functionally distinct platelet-derived cofactor: characterization of purified platelet-derived factor V/Va. J Biol Chem 2004;279:2383-93. 2. Gould WR, Simioni P, Silveira JR, Tormene D, Kalafatis M, Tracy PB. Megakaryocytes endocytose and subsequently modify human factor V in vivo to form the entire pool of a unique platelet-derived cofactor. J Thromb Haemost 2005;3:450-6. 3. Duckers C, Simioni P, Spiezia L, Radu C, Dabrilli P, Gavasso S, et al. Residual platelet factor V ensures thrombin generation in patients with severe congenital factor V deficiency and mild bleeding symptoms. Blood 2010;115:879-86. 4. Sun H, Wang X, Degen JL, Ginsburg D. Reduced thrombin generation increases host susceptibility to group A streptococcal infection. Blood 2009;113:1358-64. 5. Haralabopoulos GC, Grant DS, Klienman HK, Maragoudakis ME. Thrombin promotes endothelial cell alignment in matrigel in vitro and angiogenesis in vivo. Am J Physiol Cell Physiol 1997;273:C239. 6. Tsopanoglou NE, Maragoudakis ME. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost 2004;30:63-9. 7. Diebold I, Petry A, Djordjevic T, Belaiba RS, Fineman J, Black S, et al. Reciprocal regulation of Rac1 and PAK-1 by HIF-1alpha: a positivefeedback loop promoting pulmonary vascular remodeling. Antioxid Redox Signal 2010;13:399-412. 8. Diebold I, Djordjevic T, Hess J, Görlach A. Rac-1 promotes pulmonary artery smooth muscle cell proliferation by upregulation of plasminogen activator inhibitor-1: role of NFkappaB dependent hypoxia-inducible factor-1alpha transcription. Thromb Haemost 2008;100:1021-8. 9. Lange S, Gonzalez I, Pinto MP, Arce M, Valenzuela R, Aranda E, et al. Independent anti-angiogenic capacities of coagulation factors X and Xa. J Cell Physiol 2014;229:1673-80. 10. Chen J, Bierhaus A, Schiekofer S, Andrassy M, Chen B, Stern DM, et al. Tissue factorea receptor involved in the control of cellular properties, including angiogenesis. Thromb Haemost 2001;86:334-45. 11. Brunner G, Nguyen H, Gabrilove J, Rifkin DB, Wilson EL. Basic fibroblast growth factor expression in human bone marrow and peripheral blood cells. Blood 1993;81:631-8. 12. McMahon GA, Petitclerc E, Stefansson S, Smith E, Wong MK, Westrick RJ, et al. Plasminogen activator inhibitor-1 regulates tumor growth and angiogenesis. J Biol Chem 2001;276:33964-8. 13. Sun H, Yang TL, Yang A, Wang X, Ginsburg D. The murine platelet and plasma factor V pools are biosynthetically distinct and sufficient for minimal hemostasis. Blood 2003;102:2856-61.
JOURNAL OF VASCULAR SURGERY Volume -, Number -
14. Couffinhal T, Silver M, Zheng LP, Kearney M, Witzenbichler B, Isner JM. Mouse model of angiogenesis. Am J Pathol 1998;152: 1667-79. 15. Tang K, Breen EC, Gerber HP, Ferrara NM, Wagner PD. Capillary regression in vascular endothelial growth factor-deficient skeletal muscle. Physiol Genomics 2004;18:63-9. 16. He Y, Luo Y, Tang S, Rajantie I, Salven P, Heil M, et al. Critical function of Bmx/Etk in ischemia-mediated arteriogenesis and angiogenesis. J Clin Invest 2006;116:2344-55. 17. Ren M, Li R, Luo M, Chen N, Deng X, Yan K, et al. Endothelial cells but not platelets are the major source of Toll-like receptor 4 in the arterial thrombosis and tissue factor expression in mice. Am J Physiol Regul Integr Comp Physiol 2014;307:R901-7.
Yang et al 9
18. Wu J, Strawn TL, Luo M, Wang L, Li R, Ren M, et al. Plasminogen activator inhibitor-1 inhibits angiogenic signaling by uncoupling vascular endothelial growth factor receptor-2-aVb3 integrin cross talk. Arterioscler Thromb Vasc Biol 2015;35:111-20. 19. Chatterjee M, Huang Z, Zhang W, Jiang L, Hultenby K, Zhu L, et al. Distinct platelet packaging, release, and surface expression of proangiogenic and antiangiogenic factors on different platelet stimuli. Blood 2011;117:3907-11. Submitted Jan 5, 2016; accepted Mar 18, 2016.
Additional material for this article may be found online at www.jvascsurg.org.
9.e1 Yang et al
JOURNAL OF VASCULAR SURGERY --- 2016
Supplementary Fig (online only). Effects of platelet (PLT) depletion on thrombin activity. Thrombin activity was analyzed in PLT-rich plasma (PRP) and PLT-poor plasma (PPP) by thrombin activity assay in (A) Tg Fvþ/þ and (B) TgþFv/ mice (n ¼ 3 per group). The error bars indicate the standard error of the mean. *P < .05 vs normal PLT.