- Email: [email protected]
Plexin A1 signaling confers malignant phenotypes in lung cancer cells
Biochemical and Biophysical Research Communications xxx (2016) 1e6
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Plexin A1 signaling confers malignant phenotypes in lung cancer cells Daisuke Yamada, Satoshi Watanabe, Kohichi Kawahara, Takehiko Maeda* Department of Pharmacology, Faculty of Pharmacy, Niigata University of Pharmacy and Applied Life Sciences, 265-1 Higashijima, Akiha-ku, Niigata, Niigata 956-8603, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 11 September 2016 Accepted 3 October 2016 Available online xxx
Aberrant changes to several signaling pathways because of genetic mutations or increased cytokine production are critical for tumor cells to become malignant. Semaphorin 3A (SEMA3A) acts as a bivalent factor that suppresses or promotes tumor development in different pathological backgrounds. Previously, we showed that SEMA3A positively regulated the proliferative and glycolytic activities of mousederived Lewis lung carcinoma (LLC) cells. Plexins A1-A4 (PLXNA1-PLXNA4) are SEMA3A receptors; however, it is not known which subtype is critical for oncogenic SEMA3A signaling. We used LLC cells to investigate the role of PLXNA1 in oncogenic SEMA3A signaling. Using short hairpin RNA-mediated knockdown, we investigated the effects of constitutive inhibition of Plxna1 on cell proliferation, metabolic dependency, and epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) sensitivity. We found that Plxna1 knockdown did not affect apoptosis but resulted in decreased cell proliferation and reductions in mRNA expression levels of proliferation-marker genes, such as Ccnd1, Pcna, and Myc. In addition, we found decreased mRNA expression levels of glycolysis-associated genes, such as Pkm2 and Ldha, and decreased lactate production. In contrast, we found no changes in the mRNA expression levels of oxidative phosphorylation-associated genes, such as Cycs, Cox5a, and Atp5g1. We found that Plxna1 knockdown conferred resistance to glucose starvation but increased cytotoxicity to oligomycin. Plxna1 or Sema3a knockdown caused an increased sensitivity to the EGFR-TKIs gefitinib and erlotinib, in Lewis lung carcinoma (LLC) cells. These findings demonstrate that PLXNA1 mediates the acquisition of malignant phenotypes induced by autocrine SEMA3A signaling. © 2016 Elsevier Inc. All rights reserved.
Keywords: Lung cancer Semaphorin 3A Plexin A1 Glycolysis Drug resistance
1. Introduction Despite recent improvements in treatment and diagnosis, lung cancer, particularly non-small-cell lung cancer (NSCLC), is the leading cause of cancer-related death. Mutations or increased expression in the epidermal growth factor receptor gene (EGFR) are frequently found in patients with NSCLC. EGFR-specific tyrosine kinase inhibitors (TKIs), such as gefitinib and erlotinib, provide the best initial therapeutic response in patients with NSCLC, but this therapeutic effect is reduced because of acquired resistance [1]. EGFR activates several downstream signaling pathways shared by
Abbreviations: CSC, cancer stem cell; EGFR-TKI, epidermal growth factor receptor-tyrosine kinase inhibitor; LLC, Lewis lung carcinoma; NSCLC, non-smallcell lung cancer; shRNA, short hairpin RNA. * Corresponding author. Department of Pharmacology, Faculty of Pharmacy, Niigata University of Pharmacy and Applied Life Sciences, 265-1 Higashijima, Akiha-ku, Niigata-shi, Niigata-ken 956-8603, Japan. E-mail addresses: [email protected] (D. Yamada), [email protected] (S. Watanabe), [email protected] (K. Kawahara), [email protected] (T. Maeda).
other cytokines. Previous studies found that hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), and interleukin 6 (IL6) stimulate these downstream pathways, including PI3K/AKT/mTOR and JAK/STAT signaling that result in EGFR-TKI resistance [2]. Although multiple mechanisms of acquired resistance to EGFR-TKIs have been reported, the molecular machinery that causes the decreased therapeutic response has not been fully defined. Semaphorins are membrane-anchored or secreted proteins, which were originally discovered as axon guidance factors during the development of the central nervous system. Recently, associations between semaphorins and their receptors, plexins, have been associated with various pathophysiological disorders, including lung cancer and bone diseases [3]. In addition, there is increasing evidence that semaphorins, in particular Class 3 semaphorins, have critical roles in tumor progression by regulating angiogenesis, metastasis, and tumor cell survival [4,5]. Semaphorin 3A (SEMA3A) is a secreted semaphorin that exerts its effects by binding to its coreceptor neuropilin1 (NRP1) or to the plexin family of receptors,
http://dx.doi.org/10.1016/j.bbrc.2016.10.006 0006-291X/© 2016 Elsevier Inc. All rights reserved.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
2
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
plexin A1-A4 (PLXNA1-PLXNA4). SEMA3A functions not only as a regulator of axonal extension and bone metabolism, but also as a tumor suppressor by inhibiting angiogenesis and metastasis [6e9]. However, some studies found that SEMA3A promoted tumor progression by increasing tumor angiogenesis and invasion [10,11]. In addition to the complicated role of SEMA3A in cancer, it remains unclear through which PLXNA receptor SEMA3A exerts its oncogenic or tumor-suppressive effects. In cancer research, cell metabolism including glycolysis has been widely analyzed owing to its critical role in tumorigenesis [12,13]. Although a positive correlation of cancer stem cell (CSC) aggressiveness with glycolytic activity has been reported [14], targeting glycolysis is also demonstrated to spare CSCs that are less glycolytic than differentiated cells [15,16]. Thus, there is the need to identify the regulatory factors involved in cell metabolism to understand fully the role of glycolysis in cancer. Previously, we reported that Sema3a knockdown caused decreased cell proliferation and induced a metabolic shift from glycolysis to oxidative phosphorylation in mouse-derived Lewis lung carcinoma (LLC) cells [17,18]. To identify the critical receptor responsible for oncogenic SEMA3A signaling, we inhibited PLXNA1 function by knockdown using short hairpin RNA (shRNA), and investigated the effects on proliferative capacity, metabolic dependency, and EGFR-TKI sensitivity. 2. Material and methods 2.1. Cell culture LLC cells were provided from AntiCancer Japan. Cells were maintained in Dulbecco's modified Eagle Medium (DMEM) (SigmaAldrich) containing 10% fetal bovine serum (FBS) (JRH Biosciences) and 50 U/ml penicillin/0.5% streptomycin (Life Technologies) at 37 C in a humidified 5% CO2 atmosphere. Following 4 days of culture, cells were trypsinized using 0.05% Trypsin/EDTA (Life Technologies) and re-seeded on collagen-coated culture plates (Iwaki). 2.2. Lentiviral infection pLKO.1/TRC1-based MISSION short hairpin RNA (shRNA) Lentiviral Transduction Particles were purchased from Sigma-Aldrich. The following clones were used: TRCN0000067328 (shSema3a#1), TRCN0000067329 (shSema3a#2), TRCN0000079188 (shPlxna1#1), and TRCN0000079189 (shPlxna1#2). Lentivirus encoding a scrambled shRNA was used as a control. LLC cells were incubated with medium containing shRNA-encoding lentivirus for 24 h, followed by a 24-h incubation in lentivirus-free medium. LLC cells were selected using 50 ng/ml puromycin (Wako). shRNAexpressing LLC cell lines identified as LLC/shSema3a, LLC/ shPlxna1, and LLC/scramble, were maintained using the same culture medium containing 10 ng/ml puromycin. 2.3. Growth curve LLC cells (1 103) were seeded and cultured on collagen-coated 96-well plates (Iwaki) at 37 C in a humidified 5% CO2 atmosphere. Cells were trypsinized following 2, 4, and 6 days of culture. Trypan blue (Sigma-Aldrich) negative cells were counted as viable cells.
performed in accordance with the manufacturer's instructions (Promega). All photomicrographs were taken using a LSM700 (ZEISS). The number of TUNEL-positive cells was counted to measure apoptotic cell death. 2.5. Lactate measurement LLC cells (1 103) were seeded and cultured on collagen-coated plates (Iwaki) at 37 C in a humidified 5% CO2 atmosphere for 24 h. Medium lactate levels were measured using the L-Lactate assay kit (Cayman). To monitor lactate levels, fluorescent products were measured using an excitation wavelength of 530e540 nm and an emission wavelength of 590 nm with an Infinite F200 Pro (TECAN). 2.6. Quantitative RT-PCR Total RNA was extracted using TRIZOL (Life Technologies) and 1 mg was reverse-transcribed to cDNA using PrimeScript Reverse Transcriptase (Takara). Quantitative real-time PCR (RT-PCR) was performed using GoTaq® qPCR Master Mix (Promega) on a MiniOpticon RT-PCR system (BioRad). The following cycle parameters were used: denaturation at 95 C for 30 s followed by annealing for 30 s at 58 C, and elongation for 30 s at 72 C. The following sense and antisense primers were used: Plxna1 sense 50 -GGGTGTGTGGATAGCCATCA-30 , Plxna1 antisense 50 GCCAACATATACCTCTCCTGTCT-30 , Plexa2 sense 50 0 0 AACCTGTCTGTGGTTCTGCTC-3 , Plxna2 antisense 5 -TCCAGTCACGATTCTCAGAGT-30 , Plxna3 sense 50 - CAGATACCACTCTGACTCACCT30 , Plxna3 antisense 50 -GGCCCGTAGCTCAGTTAGG-30 , Plxna4 sense 50 -ACAGGGCACATTTATTTGGGG-30 , Plxna4 antisense 50 CACTTGGGGTTGTCCTCATCT-30 , Nrp1 sense 50 0 0 GACAAATGTGGCGGGACCATA-3 , Nrp1 antisense 5 -TGGATTAGCCATTCACACTTCTC-30 , Ccnd1 sense 50 -GCGTACCCTGACACCAATCTC30 , Ccnd1 antisense 50 -CTCCTCTTCGCACTTCTGCTC-30 , Pcna sense 50 TTTGAGGCACGCCTGATCC-30 , Pcna antisense 50 -GGAGACGTGAGACGAGTCCAT-30 , Myc sense 50 -ATGCCCCTCAACGTGAACTTC-30 , Myc antisense 50 -CGCAACATAGGATGGAGAGCA-30 , Pkm2 sense 50 GCCGCCTGGACATTGACTC-30 , Pkm2 antisense 50 -CCATGAGAGAAATTCAGCCGAG-30 , Ldha sense 50 -TGTCTCCAGCAAA0 0 GACTACTGT-3 , Ldha antisense 5 -GACTGTACTTGACAATGTTGGGA30 , Actb sense 50 -GGCTGTATTCCCCTCCATCG-30 , and Actb antisense 50 -CCAGTTGGTAACAATGCCATGT-30 . 2.7. Glucose starvation assay DMEM without glucose (-) (Life Technologies) containing 10% dialyzed FBS (Thermo Fisher Scientific) and 50 U/ml penicillin/0.5% streptomycin was used as the standard medium for the glucose starvation assay. Glucose was added to reach final concentrations of 0.045, 0.45, or 4.5 g/L. Cells (1 103) were seeded onto collagencoated 96-well plates (Iwaki) and cultured for 4 days. Cell viability was assessed using the Cell Counting Kit (Dojindo, Japan) following the manufacturer's instructions. Briefly, cells were incubated with WST-8 at 37 C in a humidified 5% CO2 atmosphere for 30 min, followed by measuring optical density at 450 nm using an Infinite F200 Pro (TECAN). Values were determined as relative percentages normalized to that found in 4.5 g/L glucose-treated samples. 2.8. Oligomycin or EGFR-TKI sensitivity assay
2.4. TUNEL assay 3
Cells (5 10 ) were seeded on Geltrex (Life Technologies)coated chamber slides (Matsunami, Japan) and cultured at 37 C in a humidified 5% CO2 atmosphere for 24 h. TUNEL staining was
LLC cells (1 103) were seeded and cultured on collagen-coated plates (Iwaki) at 37 C in a humidified 5% CO2 atmosphere. Cells were treated with oligomycin (Cell signaling technologies), gefitinib (Sigma-Aldrich), or erlotinib (LC laboratories) for 72 h. Drugs
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
3
Fig. 1. Expression of Plxna1-Plxna4 and Nrp1 after Sema3a knockdown. Total RNA was extracted from each clone of an established cell line, LLC/scramble, LLC/shSema3a#1, and LLC/shSema3a#2. mRNA levels of Plxna1-Plxna4 and Nrp1 were quantified using real-time PCR. Values were normalized to Actb mRNA. Data shown represent the mean ± SEM (n ¼ 3). *P < 0.05 and **P < 0.01 vs. LLC/scramble.
were dissolved in DMSO (Wako) and stock solutions were stored at 30 C. Cell viability was assessed in the same manner as in the glucose starvation assay. Values were determined as relative percentages normalized to that found in DMSO-treated samples.
2.9. Statistical analysis The Student's t-test was performed using Prism7 (GraphPad). All P-values were two-tailed and P-values < 0.05 (indicated by *), <0.01
Fig. 2. Plxna1 knockdown decreased the proliferative capacity of LLC cells. Quantification of (A) Plxna1, (B) Sema3a, (D) Ccnd1, (E) Pcna, and (F) Myc mRNA levels using real-time PCR. Total RNA was extracted and mRNA expression levels were compared between LLC/scramble, LLC/shPlxna1#1, and LLC/shPlxna1#2. Values were normalized to Actb mRNA. (C) Comparison of the proliferation rate between LLC/scramble and LLC/shPlxna1. The number of cells was counted at each time point. (G) Assessment of apoptosis using TUNEL staining. Data shown represent the mean ± SEM (n ¼ 3). *P < 0.05, **P < 0.01 and ***P < 0.001 vs. LLC/scramble.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
4
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
(indicated by **), and <0.001 (indicated by ***) were considered statistically significant. Data are presented as the mean ± standard error of the mean (SEM). 3. Results 3.1. Sema3a knockdown increased Plxna1 expression To identify SEMA3A receptors expressed in LLC cells, mRNA expression levels of Plxna1-Plxna4 and Nrp1 were measured following Sema3a knockdown. The Sema3a shRNA clones used in this study were as described previously [17]. As shown in Fig. 1AeD, LLC cells expressed all 4 PLXNA receptors, but increased mRNA levels of Plxna1 and Plxna3 were found following Sema3a knockdown. In contrast, we found that Sema3a knockdown resulted in decreased mRNA expression of the Nrp1 gene, which encodes the SEMA3A co-receptor (Fig. 1E). These results indicate that Sema3a knockdown upregulates the expression of Plxna1 and Plxna3 in LLC cells. 3.2. Cell proliferation and apoptosis after Plxna1 knockdown in LLC The increased Plxna1 and Plxna3 expression may be a
compensatory response to decreased SEMA3A, thereby demonstrating the critical roles of PLXNA1 and PLXNA3 in SEMA3A signaling. We focused our efforts on the Plxna1 gene, because mutations in the human PLXNA1 gene are associated with enhanced pancreatic cancer invasion and proliferation [19]. To evaluate the oncogenic function of Plxna1, we introduced shRNA specific for Plxna1 (shPlxna1) into LLC cells using a lentiviral vector. We used two shRNA clones and established two cell lines designated as LLC/shPlxna1#1 and LLC/shPlxna1#2. We found using RTPCR that both shPlxna1 clones decreased Plexa1 mRNA expression levels over 50% compared to that found using scrambled shRNA (Fig. 2A). Interestingly, Plxna1 knockdown increased Sema3a mRNA expression (Fig. 2B). To evaluate the proliferative capacity of LLC/ shPlxna1, cell counts were performed. As shown in Fig. 2C, the number of LLC/shPlxna1#1 and LLC/shPlxna1#2 cells was lower than that found in LLC/scramble at each time (2, 4, and 6 days culture). We also found that Plxna1 knockdown caused decreased mRNA expression of proliferation markers, such as Ccnd1, Pcna, and Myc (Fig. 2DeF). We next assessed LLC cell apoptosis using the TUNEL assay, and found that Plxna1 knockdown did not affect the number of TUNEL positive stained cells (Fig. 2G). These findings indicate that PLXNA1 is a positive regulator of cell proliferation by promoting cell-cycle progression.
Fig. 3. Plxna1 knockdown decreased glycolytic activity. Quantification of (A) Pkm2, (B) Ldha, (E) Cycs, (F) Cox5a, and (G) Atp5g1 mRNA levels using real-time PCR. Total RNA was extracted and mRNA levels were compared between LLC/scramble, LLC/shPlxna1#1, and LLC/shPlxna1#2. Values were normalized to Actb mRNA. (C) Assessment of glycolytic activity by lactate production. Following culture for 24 h, lactate levels in culture media were measured. (D) Assessment of glucose dependency following Plxna1 knockdown. Cells were cultured in DMEM containing 0.045 g/L, 0.45 g/L, or 4.5 g/L glucose for 4 days. Cell viability was measured using the WST-8 assay. Note that cell viability was not detected (represented as N.D.) following incubation in medium without glucose (indicated as a concentration of 0 g/L). **P < 0.01 and ***P < 0.001. (H) Determination of oligomycin sensitivity following Plxna1 knockdown. Cells were cultured in DMEM containing vehicle (0 mM) and 0.1 mM, 0.5 mM, or 1 mM oligomycin for 3 days. Cell viability was measured using the WST-8 assay. Data shown represents the mean ± SEM (n ¼ 3). **P < 0.01 and ***P < 0.001.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
3.3. Effects of Plxna1 knockdown on glucose metabolism To determine the regulatory role of PLXNA1 in cell metabolism, we measured mRNA expression levels of two major glycolysisassociated genes, Pkm2 and Ldha. As shown in Fig. 3AeB, we found that Plxna1 knockdown decreased the mRNA levels of both genes. We also measured extracellular lactate production as an indicator of glycolytic activity and found that LLC/shPlxna1#1 and LLC/shPlxna1#2 had decreased lactate levels compared to that in LLC/scramble (Fig. 3C). In addition, we found that glucose starvation caused decreased viability of LLC/scramble in a concentrationdependent manner (Fig. 3D). However, Plxna1 knockdown significantly attenuated this glucose-starvation mediated decrease in cell viability (Fig. 3D). In contrast to our findings in glycolysisassociated genes, Plxna1 knockdown had no significant effect on mRNA expression levels of three major oxidative phosphorylationassociated genes, Cycs, Cox5a, and Atp5g1 (Fig. 3EeG). Although exposure to oligomycin, which is an inhibitor of oxidative phosphorylation, caused decreased viability of LLC/scramble cells with increasing concentration (Fig. 3H), we found that Plxna1 knockdown sensitized LLC cells to oligomycin treatment (Fig. 3H). Our findings demonstrate that PLXNA1 increases glucose requirements and glycolysis dependency. 3.4. Effect of PlexA1 or Sema3A knockdown on EGFR-TKI sensitivity Finally, we tested cell sensitivity to the EGFR-TKIs, gefitinib and erlotinib, following Plxna1 or Sema3a knockdown. We found that
5
exposure to 1 mM concentrations of gefitinib or erlotinib, but not 0.1 mM, for 3 days significantly decreased cell viability in LLC/ scramble compared to that using vehicle (indicated as 0 mM in Fig. 4AeB). We also found that 0.1 mM and 1 mM concentrations of gefitinib or erlotinib significantly decreased the viability of LLC/ shPlxna1#1 and LLC/shPlxna1#2 cells compared to that in LLC/ scramble (Fig. 4AeB). Furthermore, we tested the effect of Sema3a knockdown on EGFR-TKI sensitivity and found that Sema3a knockdown caused increased sensitivity to 1 mM concentrations of gefitinib and erlotinib (Fig. 4CeD). Our results show that SEMA3A signaling via PLXNA1 contributes to EGFR-TKI resistance. 4. Discussion Semaphorins and plexins are critical regulators of tumor development or progression by forming autocrine and paracrine signaling loops [4]. In the present study, we demonstrated that PLXNA1 signaling positively regulates cell proliferation and glycolysis. Although the mechanism by which Plxna1 knockdown increases Sema3a expression is unclear, the present study confirms the critical role of PLXNA1 in SEMA3A signaling, because other types of PLXNA receptors did not compensate in response to decreased SEMA3A. Kigel et al. [20] reported that knockdown of Plxna4 or its ligand Sema6b caused decreased proliferation and tumor forming ability in U87MG cells. Furthermore, they demonstrated that PLXNA4 associated with fibroblast growth factor receptor (FGFR) and VEGF receptor 2 (VEGFR2) increased basic FGF (bFGF)-induced and VEGF-induced signal transduction.
Fig. 4. Plxna1 or Sema3a knockdown increased EGFR-TKI sensitivity. (A) LLC/shPlxna1 treated with 0.1 mM or 1 mM gefitinib for 3 days. (B) LLC/shPlxna1 treated with 0.1 mM or 1 mM erlotinib for 3 days. (C) LLC/shSema3a treated with 0.1 mM or 1 mM gefitinib for 3 days. (D) LLC/shSema3a treated with 0.1 mM or 1 mM erlotinib for 3 days. Cell viability was measured using the WST-8 assay. Data shown represent the mean ± SEM (n ¼ 3). *P < 0.05, **P < 0.01, and ***P < 0.001.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
6
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
Interestingly, we found that LLC cells expressed Sema6b (data not shown) and Plxna4 (Fig. 1D). We believe future studies that investigate possible crosstalk between SEMA3A/PLXNA1 signaling and SEMA6B/PLXNA4 signaling are warranted. Recently, it was demonstrated that SEMA3F inhibited the PI3K/AKT/mTOR pathway, tumor growth, and angiogenesis via SEMA3F-NRP2 interaction [21]. Previously, we reported that Sema3a knockdown suppressed cell proliferation, mTORC1 activity, and glycolytic activity in LLC cells [17]. Although SEMA3F shares the PLXNA1-A4 family of receptors with SEMA3A, an interaction between SEMA3A/ PLXNA1 signaling and SEMA3F signaling can be excluded because SEMA3F is not expressed in LLC cells (data not shown). Cancer cells dramatically alter metabolic pathways to meet their increased proliferative rates [22]. An increase in aerobic glycolysis, known as the Warburg effect, is a critical event in tumor cells, because an inhibition of glycolysis results in a decreased proliferative and tumorigenic capacity [23,24]. Similar to our previously reported findings with Sema3a knockdown [17], we found, in this study, that Plxna1 knockdown also caused decreased glycolytic activity (Fig. 3C) and increased dependency on oxidative phosphorylation (Fig. 3H). These findings demonstrate that SEMA3A/ PLXNA1 signaling positively regulates cancer cell proliferation by promoting glycolytic activity. Overexpression of HGF and genetic mutations in genes including c-Met, K-RAS, BRAF, PTEN, PIK3CA, and NF1 induce aberrant activation of the PI3K/AKT/mTOR pathway in lung cancer [2]. Several studies found that mTOR inhibitors caused an increased EGFR-TKI sensitivity [25e27], which indicates that the PI3K/AKT/mTOR pathway is a crucial determinant of resistance to EGFR-TKIs. To our knowledge, this is the first study to report that SEMA3A and PLXNA1 regulate EGFR-TKI sensitivity. We found in a previous study that SEMA3A is a positive regulator of mTORC1 [17], which suggests that decreased mTORC1 activity caused by Sema3a knockdown may enhance EGFR-TKI sensitivity. We believe that the regulatory mechanism of EGFR-TKI resistance mediated by SEMA3A/PLXNA1 signaling requires further study. In conclusion, PLXNA1 and SEMA3A may be potential therapeutic targets to suppress oncogenic metabolic activities and regress EGFR-TKI resistance. Our findings provide a novel understanding of oncogenic SEMA3A/PLXNA1 signaling for basic and clinical cancer research. Conflict of interest The authors declare no conflict of interest. Acknowledgements This work was supported by JSPS KAKENHI (Grant Numbers 15K18449 and 15K08682). References [1] J. Wang, B. Wang, H. Chu, et al., Intrinsic resistance to EGFR tyrosine kinase inhibitors in advanced non-small-cell lung cancer with activating EGFR mutations, Onco Targets Ther. 9 (2016) 3711e3726.
[2] L. Huang, L. Fu, Mechanisms of resistance to EGFR tyrosine kinase inhibitors, Acta Pharm. Sin. B 5 (2015) 390e401. [3] T. Worzfeld, S. Offermanns, Semaphorins and plexins as therapeutic targets, Nat. Rev. Drug Discov. 13 (2014) 603e621. [4] G. Neufeld, O. Kessler, The semaphorins: versatile regulators of tumour progression and tumour angiogenesis, Nat. Rev. Cancer 8 (2008) 632e645. [5] L. Capparuccia, L. Tamagnone, Semaphorin signaling in cancer cells and in cells of the tumor microenvironmentetwo sides of a coin, J. Cell Sci. 122 (2009) 1723e1736. [6] G. Chakraborty, S. Kumar, R. Mishra, et al., Semaphorin 3A suppresses tumor growth and metastasis in mice melanoma model, PLoS One 7 (2012) e33633. [7] A.D. Sabag, J. Bode, D. Fink, et al., Neufeld, Semaphorin-3D and semaphorin-3E inhibit the development of tumors from glioblastoma cells implanted in the cortex of the brain, PLoS One 7 (2012) e42912. [8] F. Maione, F. Molla, C. Meda, et al., Semaphorin 3A is an endogenous angiogenesis inhibitor that blocks tumor growth and normalizes tumor vasculature in transgenic mouse models, J. Clin. Investig. 119 (2009) 3356e3372. [9] F. Maione, S. Capano, D. Regano, et al., Semaphorin 3A overcomes cancer hypoxia and metastatic dissemination induced by antiangiogenic treatment in mice, J. Clin. Investig. 122 (2012) 1832e1848. [10] T. Bagci, J.K. Wu, R. Pfannl, et al., Autocrine semaphorin 3A signaling promotes glioblastoma dispersal, Oncogene 28 (2009) 3537e3550. [11] A. Casazza, D. Laoui, M. Wenes, et al., Impeding macrophage entry into hypoxic tumor areas by Sema3A/Nrp1 signaling blockade inhibits angiogenesis and restores antitumor immunity, Cancer Cell 24 (2013) 695e709. [12] R.A. Cairns, I.S. Harris, T.W. Mak, Regulation of cancer cell metabolism, Nat. Rev. Cancer 11 (2011) 85e95. [13] K. Ito, T. Suda, Metabolic requirements for the maintenance of self-renewing stem cells, Nat. Rev. Mol. Cell Biol. 15 (2014) 243e256. [14] P. Mao, K. Joshi, J. Li, et al., Mesenchymal glioma stem cells are maintained by activated glycolytic metabolism involving aldehyde dehydrogenase 1A3, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 8644e8649. [15] Y. Zhou, Y. Zhou, T. Shingu, et al., Metabolic alterations in highly tumorigenic glioblastoma cells: preference for hypoxia and high dependency on glycolysis, J. Biol. Chem. 286 (2011) 32843e32853. [16] E. Vlashi, C. Lagadec, L. Vergnes, et al., Metabolic state of glioma stem cells and nontumorigenic cells, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 16062e16067. [17] D. Yamada, K. Kawahara, T. Maeda, mTORC1 is a critical mediator of oncogenic Semaphorin3A signaling, Biochem. Biophys. Res. Commun. 476 (2016) 475e480. [18] T. Maeda, D. Yamada, K. Kawahara, Cancer pain relief achieved by disrupting tumor-driven semaphorin 3A signaling in mice, Neurosci. Lett. 632 (2016) 147e151. [19] R. Sorber, Y. Teper, A. Abisoye-Ogunniyan, et al., Whole genome sequencing of newly established pancreatic Cancer lines identifies novel somatic mutation (c.2587G>A) in axon guidance receptor plexin A1 as enhancer of proliferation and invasion, PLoS One 11 (2016) e0149833. [20] B. Kigel, N. Rabinowicz, A. Varshavsky, et al., Plexin-A4 promotes tumor progression and tumor angiogenesis by enhancement of VEGF and bFGF signaling, Blood 118 (2011) 4285e4296. [21] H. Nakayama, S. Bruneau, N. Kochupurakkal, et al., Regulation of mTOR signaling by semaphorin 3F-Neuropilin 2 interactions in vitro and in vivo, Sci. Rep. 5 (2015) 11789. [22] D.A. Tennant, R.V. Duran, E. Gottlieb, Targeting metabolic transformation for cancer therapy, Nat. Rev. Cancer 10 (2010) 267e277. [23] V.R. Fantin, J. St-Pierre, P. Leder, Attenuation of LDH-A expression uncovers a link between glycolysis, mitochondrial physiology, and tumor maintenance, Cancer Cell 9 (2006) 425e434. [24] A. Wolf, S. Agnihotri, J. Micallef, et al., Hexokinase 2 is a key mediator of aerobic glycolysis and promotes tumor growth in human glioblastoma multiforme, J. Exp. Med. 208 (2011) 313e326. [25] T. Sano, S. Takeuchi, T. Nakagawa, et al., The novel phosphoinositide 3-kinasemammalian target of rapamycin inhibitor, BEZ235, circumvents erlotinib resistance of epidermal growth factor receptor mutant lung cancer cells triggered by hepatocyte growth factor, Int. J. Cancer 133 (2013) 505e513. [26] M.Y. Wang, K.V. Lu, S. Zhu, et al., Mammalian target of rapamycin inhibition promotes response to epidermal growth factor receptor kinase inhibitors in PTEN-deficient and PTEN-intact glioblastoma cells, Cancer Res. 66 (2006) 7864e7869. [27] D. Ishikawa, S. Takeuchi, T. Nakagawa, et al., mTOR inhibitors control the growth of EGFR mutant lung cancer even after acquiring resistance by HGF, PLoS One 8 (2013) e62104.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Plexin A1 signaling confers malignant phenotypes in lung cancer cells Daisuke Yamada, Satoshi Watanabe, Kohichi Kawahara, Takehiko Maeda* Department of Pharmacology, Faculty of Pharmacy, Niigata University of Pharmacy and Applied Life Sciences, 265-1 Higashijima, Akiha-ku, Niigata, Niigata 956-8603, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 11 September 2016 Accepted 3 October 2016 Available online xxx
Aberrant changes to several signaling pathways because of genetic mutations or increased cytokine production are critical for tumor cells to become malignant. Semaphorin 3A (SEMA3A) acts as a bivalent factor that suppresses or promotes tumor development in different pathological backgrounds. Previously, we showed that SEMA3A positively regulated the proliferative and glycolytic activities of mousederived Lewis lung carcinoma (LLC) cells. Plexins A1-A4 (PLXNA1-PLXNA4) are SEMA3A receptors; however, it is not known which subtype is critical for oncogenic SEMA3A signaling. We used LLC cells to investigate the role of PLXNA1 in oncogenic SEMA3A signaling. Using short hairpin RNA-mediated knockdown, we investigated the effects of constitutive inhibition of Plxna1 on cell proliferation, metabolic dependency, and epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) sensitivity. We found that Plxna1 knockdown did not affect apoptosis but resulted in decreased cell proliferation and reductions in mRNA expression levels of proliferation-marker genes, such as Ccnd1, Pcna, and Myc. In addition, we found decreased mRNA expression levels of glycolysis-associated genes, such as Pkm2 and Ldha, and decreased lactate production. In contrast, we found no changes in the mRNA expression levels of oxidative phosphorylation-associated genes, such as Cycs, Cox5a, and Atp5g1. We found that Plxna1 knockdown conferred resistance to glucose starvation but increased cytotoxicity to oligomycin. Plxna1 or Sema3a knockdown caused an increased sensitivity to the EGFR-TKIs gefitinib and erlotinib, in Lewis lung carcinoma (LLC) cells. These findings demonstrate that PLXNA1 mediates the acquisition of malignant phenotypes induced by autocrine SEMA3A signaling. © 2016 Elsevier Inc. All rights reserved.
Keywords: Lung cancer Semaphorin 3A Plexin A1 Glycolysis Drug resistance
1. Introduction Despite recent improvements in treatment and diagnosis, lung cancer, particularly non-small-cell lung cancer (NSCLC), is the leading cause of cancer-related death. Mutations or increased expression in the epidermal growth factor receptor gene (EGFR) are frequently found in patients with NSCLC. EGFR-specific tyrosine kinase inhibitors (TKIs), such as gefitinib and erlotinib, provide the best initial therapeutic response in patients with NSCLC, but this therapeutic effect is reduced because of acquired resistance [1]. EGFR activates several downstream signaling pathways shared by
Abbreviations: CSC, cancer stem cell; EGFR-TKI, epidermal growth factor receptor-tyrosine kinase inhibitor; LLC, Lewis lung carcinoma; NSCLC, non-smallcell lung cancer; shRNA, short hairpin RNA. * Corresponding author. Department of Pharmacology, Faculty of Pharmacy, Niigata University of Pharmacy and Applied Life Sciences, 265-1 Higashijima, Akiha-ku, Niigata-shi, Niigata-ken 956-8603, Japan. E-mail addresses: [email protected] (D. Yamada), [email protected] (S. Watanabe), [email protected] (K. Kawahara), [email protected] (T. Maeda).
other cytokines. Previous studies found that hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), and interleukin 6 (IL6) stimulate these downstream pathways, including PI3K/AKT/mTOR and JAK/STAT signaling that result in EGFR-TKI resistance [2]. Although multiple mechanisms of acquired resistance to EGFR-TKIs have been reported, the molecular machinery that causes the decreased therapeutic response has not been fully defined. Semaphorins are membrane-anchored or secreted proteins, which were originally discovered as axon guidance factors during the development of the central nervous system. Recently, associations between semaphorins and their receptors, plexins, have been associated with various pathophysiological disorders, including lung cancer and bone diseases [3]. In addition, there is increasing evidence that semaphorins, in particular Class 3 semaphorins, have critical roles in tumor progression by regulating angiogenesis, metastasis, and tumor cell survival [4,5]. Semaphorin 3A (SEMA3A) is a secreted semaphorin that exerts its effects by binding to its coreceptor neuropilin1 (NRP1) or to the plexin family of receptors,
http://dx.doi.org/10.1016/j.bbrc.2016.10.006 0006-291X/© 2016 Elsevier Inc. All rights reserved.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
2
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
plexin A1-A4 (PLXNA1-PLXNA4). SEMA3A functions not only as a regulator of axonal extension and bone metabolism, but also as a tumor suppressor by inhibiting angiogenesis and metastasis [6e9]. However, some studies found that SEMA3A promoted tumor progression by increasing tumor angiogenesis and invasion [10,11]. In addition to the complicated role of SEMA3A in cancer, it remains unclear through which PLXNA receptor SEMA3A exerts its oncogenic or tumor-suppressive effects. In cancer research, cell metabolism including glycolysis has been widely analyzed owing to its critical role in tumorigenesis [12,13]. Although a positive correlation of cancer stem cell (CSC) aggressiveness with glycolytic activity has been reported [14], targeting glycolysis is also demonstrated to spare CSCs that are less glycolytic than differentiated cells [15,16]. Thus, there is the need to identify the regulatory factors involved in cell metabolism to understand fully the role of glycolysis in cancer. Previously, we reported that Sema3a knockdown caused decreased cell proliferation and induced a metabolic shift from glycolysis to oxidative phosphorylation in mouse-derived Lewis lung carcinoma (LLC) cells [17,18]. To identify the critical receptor responsible for oncogenic SEMA3A signaling, we inhibited PLXNA1 function by knockdown using short hairpin RNA (shRNA), and investigated the effects on proliferative capacity, metabolic dependency, and EGFR-TKI sensitivity. 2. Material and methods 2.1. Cell culture LLC cells were provided from AntiCancer Japan. Cells were maintained in Dulbecco's modified Eagle Medium (DMEM) (SigmaAldrich) containing 10% fetal bovine serum (FBS) (JRH Biosciences) and 50 U/ml penicillin/0.5% streptomycin (Life Technologies) at 37 C in a humidified 5% CO2 atmosphere. Following 4 days of culture, cells were trypsinized using 0.05% Trypsin/EDTA (Life Technologies) and re-seeded on collagen-coated culture plates (Iwaki). 2.2. Lentiviral infection pLKO.1/TRC1-based MISSION short hairpin RNA (shRNA) Lentiviral Transduction Particles were purchased from Sigma-Aldrich. The following clones were used: TRCN0000067328 (shSema3a#1), TRCN0000067329 (shSema3a#2), TRCN0000079188 (shPlxna1#1), and TRCN0000079189 (shPlxna1#2). Lentivirus encoding a scrambled shRNA was used as a control. LLC cells were incubated with medium containing shRNA-encoding lentivirus for 24 h, followed by a 24-h incubation in lentivirus-free medium. LLC cells were selected using 50 ng/ml puromycin (Wako). shRNAexpressing LLC cell lines identified as LLC/shSema3a, LLC/ shPlxna1, and LLC/scramble, were maintained using the same culture medium containing 10 ng/ml puromycin. 2.3. Growth curve LLC cells (1 103) were seeded and cultured on collagen-coated 96-well plates (Iwaki) at 37 C in a humidified 5% CO2 atmosphere. Cells were trypsinized following 2, 4, and 6 days of culture. Trypan blue (Sigma-Aldrich) negative cells were counted as viable cells.
performed in accordance with the manufacturer's instructions (Promega). All photomicrographs were taken using a LSM700 (ZEISS). The number of TUNEL-positive cells was counted to measure apoptotic cell death. 2.5. Lactate measurement LLC cells (1 103) were seeded and cultured on collagen-coated plates (Iwaki) at 37 C in a humidified 5% CO2 atmosphere for 24 h. Medium lactate levels were measured using the L-Lactate assay kit (Cayman). To monitor lactate levels, fluorescent products were measured using an excitation wavelength of 530e540 nm and an emission wavelength of 590 nm with an Infinite F200 Pro (TECAN). 2.6. Quantitative RT-PCR Total RNA was extracted using TRIZOL (Life Technologies) and 1 mg was reverse-transcribed to cDNA using PrimeScript Reverse Transcriptase (Takara). Quantitative real-time PCR (RT-PCR) was performed using GoTaq® qPCR Master Mix (Promega) on a MiniOpticon RT-PCR system (BioRad). The following cycle parameters were used: denaturation at 95 C for 30 s followed by annealing for 30 s at 58 C, and elongation for 30 s at 72 C. The following sense and antisense primers were used: Plxna1 sense 50 -GGGTGTGTGGATAGCCATCA-30 , Plxna1 antisense 50 GCCAACATATACCTCTCCTGTCT-30 , Plexa2 sense 50 0 0 AACCTGTCTGTGGTTCTGCTC-3 , Plxna2 antisense 5 -TCCAGTCACGATTCTCAGAGT-30 , Plxna3 sense 50 - CAGATACCACTCTGACTCACCT30 , Plxna3 antisense 50 -GGCCCGTAGCTCAGTTAGG-30 , Plxna4 sense 50 -ACAGGGCACATTTATTTGGGG-30 , Plxna4 antisense 50 CACTTGGGGTTGTCCTCATCT-30 , Nrp1 sense 50 0 0 GACAAATGTGGCGGGACCATA-3 , Nrp1 antisense 5 -TGGATTAGCCATTCACACTTCTC-30 , Ccnd1 sense 50 -GCGTACCCTGACACCAATCTC30 , Ccnd1 antisense 50 -CTCCTCTTCGCACTTCTGCTC-30 , Pcna sense 50 TTTGAGGCACGCCTGATCC-30 , Pcna antisense 50 -GGAGACGTGAGACGAGTCCAT-30 , Myc sense 50 -ATGCCCCTCAACGTGAACTTC-30 , Myc antisense 50 -CGCAACATAGGATGGAGAGCA-30 , Pkm2 sense 50 GCCGCCTGGACATTGACTC-30 , Pkm2 antisense 50 -CCATGAGAGAAATTCAGCCGAG-30 , Ldha sense 50 -TGTCTCCAGCAAA0 0 GACTACTGT-3 , Ldha antisense 5 -GACTGTACTTGACAATGTTGGGA30 , Actb sense 50 -GGCTGTATTCCCCTCCATCG-30 , and Actb antisense 50 -CCAGTTGGTAACAATGCCATGT-30 . 2.7. Glucose starvation assay DMEM without glucose (-) (Life Technologies) containing 10% dialyzed FBS (Thermo Fisher Scientific) and 50 U/ml penicillin/0.5% streptomycin was used as the standard medium for the glucose starvation assay. Glucose was added to reach final concentrations of 0.045, 0.45, or 4.5 g/L. Cells (1 103) were seeded onto collagencoated 96-well plates (Iwaki) and cultured for 4 days. Cell viability was assessed using the Cell Counting Kit (Dojindo, Japan) following the manufacturer's instructions. Briefly, cells were incubated with WST-8 at 37 C in a humidified 5% CO2 atmosphere for 30 min, followed by measuring optical density at 450 nm using an Infinite F200 Pro (TECAN). Values were determined as relative percentages normalized to that found in 4.5 g/L glucose-treated samples. 2.8. Oligomycin or EGFR-TKI sensitivity assay
2.4. TUNEL assay 3
Cells (5 10 ) were seeded on Geltrex (Life Technologies)coated chamber slides (Matsunami, Japan) and cultured at 37 C in a humidified 5% CO2 atmosphere for 24 h. TUNEL staining was
LLC cells (1 103) were seeded and cultured on collagen-coated plates (Iwaki) at 37 C in a humidified 5% CO2 atmosphere. Cells were treated with oligomycin (Cell signaling technologies), gefitinib (Sigma-Aldrich), or erlotinib (LC laboratories) for 72 h. Drugs
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
3
Fig. 1. Expression of Plxna1-Plxna4 and Nrp1 after Sema3a knockdown. Total RNA was extracted from each clone of an established cell line, LLC/scramble, LLC/shSema3a#1, and LLC/shSema3a#2. mRNA levels of Plxna1-Plxna4 and Nrp1 were quantified using real-time PCR. Values were normalized to Actb mRNA. Data shown represent the mean ± SEM (n ¼ 3). *P < 0.05 and **P < 0.01 vs. LLC/scramble.
were dissolved in DMSO (Wako) and stock solutions were stored at 30 C. Cell viability was assessed in the same manner as in the glucose starvation assay. Values were determined as relative percentages normalized to that found in DMSO-treated samples.
2.9. Statistical analysis The Student's t-test was performed using Prism7 (GraphPad). All P-values were two-tailed and P-values < 0.05 (indicated by *), <0.01
Fig. 2. Plxna1 knockdown decreased the proliferative capacity of LLC cells. Quantification of (A) Plxna1, (B) Sema3a, (D) Ccnd1, (E) Pcna, and (F) Myc mRNA levels using real-time PCR. Total RNA was extracted and mRNA expression levels were compared between LLC/scramble, LLC/shPlxna1#1, and LLC/shPlxna1#2. Values were normalized to Actb mRNA. (C) Comparison of the proliferation rate between LLC/scramble and LLC/shPlxna1. The number of cells was counted at each time point. (G) Assessment of apoptosis using TUNEL staining. Data shown represent the mean ± SEM (n ¼ 3). *P < 0.05, **P < 0.01 and ***P < 0.001 vs. LLC/scramble.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
4
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
(indicated by **), and <0.001 (indicated by ***) were considered statistically significant. Data are presented as the mean ± standard error of the mean (SEM). 3. Results 3.1. Sema3a knockdown increased Plxna1 expression To identify SEMA3A receptors expressed in LLC cells, mRNA expression levels of Plxna1-Plxna4 and Nrp1 were measured following Sema3a knockdown. The Sema3a shRNA clones used in this study were as described previously [17]. As shown in Fig. 1AeD, LLC cells expressed all 4 PLXNA receptors, but increased mRNA levels of Plxna1 and Plxna3 were found following Sema3a knockdown. In contrast, we found that Sema3a knockdown resulted in decreased mRNA expression of the Nrp1 gene, which encodes the SEMA3A co-receptor (Fig. 1E). These results indicate that Sema3a knockdown upregulates the expression of Plxna1 and Plxna3 in LLC cells. 3.2. Cell proliferation and apoptosis after Plxna1 knockdown in LLC The increased Plxna1 and Plxna3 expression may be a
compensatory response to decreased SEMA3A, thereby demonstrating the critical roles of PLXNA1 and PLXNA3 in SEMA3A signaling. We focused our efforts on the Plxna1 gene, because mutations in the human PLXNA1 gene are associated with enhanced pancreatic cancer invasion and proliferation [19]. To evaluate the oncogenic function of Plxna1, we introduced shRNA specific for Plxna1 (shPlxna1) into LLC cells using a lentiviral vector. We used two shRNA clones and established two cell lines designated as LLC/shPlxna1#1 and LLC/shPlxna1#2. We found using RTPCR that both shPlxna1 clones decreased Plexa1 mRNA expression levels over 50% compared to that found using scrambled shRNA (Fig. 2A). Interestingly, Plxna1 knockdown increased Sema3a mRNA expression (Fig. 2B). To evaluate the proliferative capacity of LLC/ shPlxna1, cell counts were performed. As shown in Fig. 2C, the number of LLC/shPlxna1#1 and LLC/shPlxna1#2 cells was lower than that found in LLC/scramble at each time (2, 4, and 6 days culture). We also found that Plxna1 knockdown caused decreased mRNA expression of proliferation markers, such as Ccnd1, Pcna, and Myc (Fig. 2DeF). We next assessed LLC cell apoptosis using the TUNEL assay, and found that Plxna1 knockdown did not affect the number of TUNEL positive stained cells (Fig. 2G). These findings indicate that PLXNA1 is a positive regulator of cell proliferation by promoting cell-cycle progression.
Fig. 3. Plxna1 knockdown decreased glycolytic activity. Quantification of (A) Pkm2, (B) Ldha, (E) Cycs, (F) Cox5a, and (G) Atp5g1 mRNA levels using real-time PCR. Total RNA was extracted and mRNA levels were compared between LLC/scramble, LLC/shPlxna1#1, and LLC/shPlxna1#2. Values were normalized to Actb mRNA. (C) Assessment of glycolytic activity by lactate production. Following culture for 24 h, lactate levels in culture media were measured. (D) Assessment of glucose dependency following Plxna1 knockdown. Cells were cultured in DMEM containing 0.045 g/L, 0.45 g/L, or 4.5 g/L glucose for 4 days. Cell viability was measured using the WST-8 assay. Note that cell viability was not detected (represented as N.D.) following incubation in medium without glucose (indicated as a concentration of 0 g/L). **P < 0.01 and ***P < 0.001. (H) Determination of oligomycin sensitivity following Plxna1 knockdown. Cells were cultured in DMEM containing vehicle (0 mM) and 0.1 mM, 0.5 mM, or 1 mM oligomycin for 3 days. Cell viability was measured using the WST-8 assay. Data shown represents the mean ± SEM (n ¼ 3). **P < 0.01 and ***P < 0.001.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
3.3. Effects of Plxna1 knockdown on glucose metabolism To determine the regulatory role of PLXNA1 in cell metabolism, we measured mRNA expression levels of two major glycolysisassociated genes, Pkm2 and Ldha. As shown in Fig. 3AeB, we found that Plxna1 knockdown decreased the mRNA levels of both genes. We also measured extracellular lactate production as an indicator of glycolytic activity and found that LLC/shPlxna1#1 and LLC/shPlxna1#2 had decreased lactate levels compared to that in LLC/scramble (Fig. 3C). In addition, we found that glucose starvation caused decreased viability of LLC/scramble in a concentrationdependent manner (Fig. 3D). However, Plxna1 knockdown significantly attenuated this glucose-starvation mediated decrease in cell viability (Fig. 3D). In contrast to our findings in glycolysisassociated genes, Plxna1 knockdown had no significant effect on mRNA expression levels of three major oxidative phosphorylationassociated genes, Cycs, Cox5a, and Atp5g1 (Fig. 3EeG). Although exposure to oligomycin, which is an inhibitor of oxidative phosphorylation, caused decreased viability of LLC/scramble cells with increasing concentration (Fig. 3H), we found that Plxna1 knockdown sensitized LLC cells to oligomycin treatment (Fig. 3H). Our findings demonstrate that PLXNA1 increases glucose requirements and glycolysis dependency. 3.4. Effect of PlexA1 or Sema3A knockdown on EGFR-TKI sensitivity Finally, we tested cell sensitivity to the EGFR-TKIs, gefitinib and erlotinib, following Plxna1 or Sema3a knockdown. We found that
5
exposure to 1 mM concentrations of gefitinib or erlotinib, but not 0.1 mM, for 3 days significantly decreased cell viability in LLC/ scramble compared to that using vehicle (indicated as 0 mM in Fig. 4AeB). We also found that 0.1 mM and 1 mM concentrations of gefitinib or erlotinib significantly decreased the viability of LLC/ shPlxna1#1 and LLC/shPlxna1#2 cells compared to that in LLC/ scramble (Fig. 4AeB). Furthermore, we tested the effect of Sema3a knockdown on EGFR-TKI sensitivity and found that Sema3a knockdown caused increased sensitivity to 1 mM concentrations of gefitinib and erlotinib (Fig. 4CeD). Our results show that SEMA3A signaling via PLXNA1 contributes to EGFR-TKI resistance. 4. Discussion Semaphorins and plexins are critical regulators of tumor development or progression by forming autocrine and paracrine signaling loops [4]. In the present study, we demonstrated that PLXNA1 signaling positively regulates cell proliferation and glycolysis. Although the mechanism by which Plxna1 knockdown increases Sema3a expression is unclear, the present study confirms the critical role of PLXNA1 in SEMA3A signaling, because other types of PLXNA receptors did not compensate in response to decreased SEMA3A. Kigel et al. [20] reported that knockdown of Plxna4 or its ligand Sema6b caused decreased proliferation and tumor forming ability in U87MG cells. Furthermore, they demonstrated that PLXNA4 associated with fibroblast growth factor receptor (FGFR) and VEGF receptor 2 (VEGFR2) increased basic FGF (bFGF)-induced and VEGF-induced signal transduction.
Fig. 4. Plxna1 or Sema3a knockdown increased EGFR-TKI sensitivity. (A) LLC/shPlxna1 treated with 0.1 mM or 1 mM gefitinib for 3 days. (B) LLC/shPlxna1 treated with 0.1 mM or 1 mM erlotinib for 3 days. (C) LLC/shSema3a treated with 0.1 mM or 1 mM gefitinib for 3 days. (D) LLC/shSema3a treated with 0.1 mM or 1 mM erlotinib for 3 days. Cell viability was measured using the WST-8 assay. Data shown represent the mean ± SEM (n ¼ 3). *P < 0.05, **P < 0.01, and ***P < 0.001.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006
6
D. Yamada et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
Interestingly, we found that LLC cells expressed Sema6b (data not shown) and Plxna4 (Fig. 1D). We believe future studies that investigate possible crosstalk between SEMA3A/PLXNA1 signaling and SEMA6B/PLXNA4 signaling are warranted. Recently, it was demonstrated that SEMA3F inhibited the PI3K/AKT/mTOR pathway, tumor growth, and angiogenesis via SEMA3F-NRP2 interaction [21]. Previously, we reported that Sema3a knockdown suppressed cell proliferation, mTORC1 activity, and glycolytic activity in LLC cells [17]. Although SEMA3F shares the PLXNA1-A4 family of receptors with SEMA3A, an interaction between SEMA3A/ PLXNA1 signaling and SEMA3F signaling can be excluded because SEMA3F is not expressed in LLC cells (data not shown). Cancer cells dramatically alter metabolic pathways to meet their increased proliferative rates [22]. An increase in aerobic glycolysis, known as the Warburg effect, is a critical event in tumor cells, because an inhibition of glycolysis results in a decreased proliferative and tumorigenic capacity [23,24]. Similar to our previously reported findings with Sema3a knockdown [17], we found, in this study, that Plxna1 knockdown also caused decreased glycolytic activity (Fig. 3C) and increased dependency on oxidative phosphorylation (Fig. 3H). These findings demonstrate that SEMA3A/ PLXNA1 signaling positively regulates cancer cell proliferation by promoting glycolytic activity. Overexpression of HGF and genetic mutations in genes including c-Met, K-RAS, BRAF, PTEN, PIK3CA, and NF1 induce aberrant activation of the PI3K/AKT/mTOR pathway in lung cancer [2]. Several studies found that mTOR inhibitors caused an increased EGFR-TKI sensitivity [25e27], which indicates that the PI3K/AKT/mTOR pathway is a crucial determinant of resistance to EGFR-TKIs. To our knowledge, this is the first study to report that SEMA3A and PLXNA1 regulate EGFR-TKI sensitivity. We found in a previous study that SEMA3A is a positive regulator of mTORC1 [17], which suggests that decreased mTORC1 activity caused by Sema3a knockdown may enhance EGFR-TKI sensitivity. We believe that the regulatory mechanism of EGFR-TKI resistance mediated by SEMA3A/PLXNA1 signaling requires further study. In conclusion, PLXNA1 and SEMA3A may be potential therapeutic targets to suppress oncogenic metabolic activities and regress EGFR-TKI resistance. Our findings provide a novel understanding of oncogenic SEMA3A/PLXNA1 signaling for basic and clinical cancer research. Conflict of interest The authors declare no conflict of interest. Acknowledgements This work was supported by JSPS KAKENHI (Grant Numbers 15K18449 and 15K08682). References [1] J. Wang, B. Wang, H. Chu, et al., Intrinsic resistance to EGFR tyrosine kinase inhibitors in advanced non-small-cell lung cancer with activating EGFR mutations, Onco Targets Ther. 9 (2016) 3711e3726.
[2] L. Huang, L. Fu, Mechanisms of resistance to EGFR tyrosine kinase inhibitors, Acta Pharm. Sin. B 5 (2015) 390e401. [3] T. Worzfeld, S. Offermanns, Semaphorins and plexins as therapeutic targets, Nat. Rev. Drug Discov. 13 (2014) 603e621. [4] G. Neufeld, O. Kessler, The semaphorins: versatile regulators of tumour progression and tumour angiogenesis, Nat. Rev. Cancer 8 (2008) 632e645. [5] L. Capparuccia, L. Tamagnone, Semaphorin signaling in cancer cells and in cells of the tumor microenvironmentetwo sides of a coin, J. Cell Sci. 122 (2009) 1723e1736. [6] G. Chakraborty, S. Kumar, R. Mishra, et al., Semaphorin 3A suppresses tumor growth and metastasis in mice melanoma model, PLoS One 7 (2012) e33633. [7] A.D. Sabag, J. Bode, D. Fink, et al., Neufeld, Semaphorin-3D and semaphorin-3E inhibit the development of tumors from glioblastoma cells implanted in the cortex of the brain, PLoS One 7 (2012) e42912. [8] F. Maione, F. Molla, C. Meda, et al., Semaphorin 3A is an endogenous angiogenesis inhibitor that blocks tumor growth and normalizes tumor vasculature in transgenic mouse models, J. Clin. Investig. 119 (2009) 3356e3372. [9] F. Maione, S. Capano, D. Regano, et al., Semaphorin 3A overcomes cancer hypoxia and metastatic dissemination induced by antiangiogenic treatment in mice, J. Clin. Investig. 122 (2012) 1832e1848. [10] T. Bagci, J.K. Wu, R. Pfannl, et al., Autocrine semaphorin 3A signaling promotes glioblastoma dispersal, Oncogene 28 (2009) 3537e3550. [11] A. Casazza, D. Laoui, M. Wenes, et al., Impeding macrophage entry into hypoxic tumor areas by Sema3A/Nrp1 signaling blockade inhibits angiogenesis and restores antitumor immunity, Cancer Cell 24 (2013) 695e709. [12] R.A. Cairns, I.S. Harris, T.W. Mak, Regulation of cancer cell metabolism, Nat. Rev. Cancer 11 (2011) 85e95. [13] K. Ito, T. Suda, Metabolic requirements for the maintenance of self-renewing stem cells, Nat. Rev. Mol. Cell Biol. 15 (2014) 243e256. [14] P. Mao, K. Joshi, J. Li, et al., Mesenchymal glioma stem cells are maintained by activated glycolytic metabolism involving aldehyde dehydrogenase 1A3, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 8644e8649. [15] Y. Zhou, Y. Zhou, T. Shingu, et al., Metabolic alterations in highly tumorigenic glioblastoma cells: preference for hypoxia and high dependency on glycolysis, J. Biol. Chem. 286 (2011) 32843e32853. [16] E. Vlashi, C. Lagadec, L. Vergnes, et al., Metabolic state of glioma stem cells and nontumorigenic cells, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 16062e16067. [17] D. Yamada, K. Kawahara, T. Maeda, mTORC1 is a critical mediator of oncogenic Semaphorin3A signaling, Biochem. Biophys. Res. Commun. 476 (2016) 475e480. [18] T. Maeda, D. Yamada, K. Kawahara, Cancer pain relief achieved by disrupting tumor-driven semaphorin 3A signaling in mice, Neurosci. Lett. 632 (2016) 147e151. [19] R. Sorber, Y. Teper, A. Abisoye-Ogunniyan, et al., Whole genome sequencing of newly established pancreatic Cancer lines identifies novel somatic mutation (c.2587G>A) in axon guidance receptor plexin A1 as enhancer of proliferation and invasion, PLoS One 11 (2016) e0149833. [20] B. Kigel, N. Rabinowicz, A. Varshavsky, et al., Plexin-A4 promotes tumor progression and tumor angiogenesis by enhancement of VEGF and bFGF signaling, Blood 118 (2011) 4285e4296. [21] H. Nakayama, S. Bruneau, N. Kochupurakkal, et al., Regulation of mTOR signaling by semaphorin 3F-Neuropilin 2 interactions in vitro and in vivo, Sci. Rep. 5 (2015) 11789. [22] D.A. Tennant, R.V. Duran, E. Gottlieb, Targeting metabolic transformation for cancer therapy, Nat. Rev. Cancer 10 (2010) 267e277. [23] V.R. Fantin, J. St-Pierre, P. Leder, Attenuation of LDH-A expression uncovers a link between glycolysis, mitochondrial physiology, and tumor maintenance, Cancer Cell 9 (2006) 425e434. [24] A. Wolf, S. Agnihotri, J. Micallef, et al., Hexokinase 2 is a key mediator of aerobic glycolysis and promotes tumor growth in human glioblastoma multiforme, J. Exp. Med. 208 (2011) 313e326. [25] T. Sano, S. Takeuchi, T. Nakagawa, et al., The novel phosphoinositide 3-kinasemammalian target of rapamycin inhibitor, BEZ235, circumvents erlotinib resistance of epidermal growth factor receptor mutant lung cancer cells triggered by hepatocyte growth factor, Int. J. Cancer 133 (2013) 505e513. [26] M.Y. Wang, K.V. Lu, S. Zhu, et al., Mammalian target of rapamycin inhibition promotes response to epidermal growth factor receptor kinase inhibitors in PTEN-deficient and PTEN-intact glioblastoma cells, Cancer Res. 66 (2006) 7864e7869. [27] D. Ishikawa, S. Takeuchi, T. Nakagawa, et al., mTOR inhibitors control the growth of EGFR mutant lung cancer even after acquiring resistance by HGF, PLoS One 8 (2013) e62104.
Please cite this article in press as: D. Yamada, et al., Plexin A1 signaling confers malignant phenotypes in lung cancer cells, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.10.006