- Email: [email protected]
Pnas4 is a novel regulator for convergence and extension during vertebrate gastrulation
FEBS Letters 582 (2008) 2325–2332
Pnas4 is a novel regulator for convergence and extension during vertebrate gastrulation Shaohua Yao, Lifang Xie, Meilin Qian, Hanshuo Yang, Lang Zhou, Qian Zhou, Fei Yan, Lantu Gou, Yuquan Wei, Xia Zhao*, Xianming Mo* State Key Laboratory of Biotherapy, West China Hospital and Life Science College, Sichuan University, Chengdu 610041, China Received 31 March 2008; revised 25 May 2008; accepted 26 May 2008 Available online 4 June 2008 Edited by Daniela Ruffell
Abstract Recent studies show that human Pnas4 might be tumor associated, while its function remains unknown. Here, we investigate the developmental function of Pnas4 using zebrafish as a model system. Knocking down Pnas4 causes gastrulation defects with a shorter and broader axis, as well as a posteriorly mis-positioned prechordal plate, due to the defective convergence and extension movement. Conversely, over-expression of Pnas4 mRNA leads to an elongated body axis. We further demonstrate that Pnas4 is required cell-autonomously for dorsal convergence but not for anterior migration. In addition, genetic interaction assays indicate that Pnas4 might act in parallel with non-canonical Wnt signal in the regulation of cell movement. Our data suggest that Pnas4 is a key regulator of cell movement during gastrulation. Ó 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Gastrulation; Convergence and extension; Anterior migration; Pnas4
1. Introduction The Pnas4 gene was previously identified as a putative apoptosis-related protein in human acute promyelocytic leukemia cell line NB4. Recent evidence shows that Pnas4 is up-regulated in human papillomavirus-infected invasive cervical cancer and androgen-independent prostate cancer [1,2]. In addition, it is also up-regulated in peripheral blood mononuclear cells exposed to benzene which is an established cause of leukemia [3]. These findings indicate Pnas4 might be linked with tumor genesis and development. However, to date the biological function of Pnas4 in these processes is still unclear. It has been widely proven that the genesis of cancer often uses similar mechanisms to embryogenesis, and aggressive tumor cells share many behaviors with embryonic progenitors [4,5]. Furthermore, members of Pnas4 family of various organisms share high homology of protein sequence, and all of them contain a conserved DUF862 domain with unknown function, suggesting Pnas4 may be functionally conserved. Considering
*
Corresponding authors. Fax: +86 28 85164047. E-mail addresses: [email protected] (X. Zhao), [email protected] (X. Mo).
this, we hypothesize that Pnas4 may also play an important role in early vertebrate development. Zebrafish is an excellent model organism to study vertebrate development and establish disease models. Reverse-genetic approaches, especially the morpholino oligo knocking-down technique, facilitate in vivo functional analysis of interesting genes. To test our hypothesis, we used zebrafish as a model system to investigate the developmental function of Pnas4. We show that Pnas4 is both maternally and zygotically expressed and is broadly distributed in early development. Knocking-down zebrafish Pnas4 (ZPnas4) protein expression by amplification of specific antisense morphorlino caused gastrulation defects, characterized by shorter and broader anteroposterior (AP) axes. Over-expression of ZPnas4 mRNA leads to the elongation of the AP axis. With in situ hybridization and cell transplantation experiments, we demonstrated that these phenotypes resulted from defective convergence and extension movement. Furthermore, analysis of genetic interaction between ZPnas4 and non-canonical Wnt signal revealed that they might act in parallel to regulate cell movement. These results established a role for ZPnas4 in the control of cell movement during gastrulation. 2. Materials and methods 2.1. Zebrafish maintenance Wild-type embryos of the Tuebingen strain were used. Embryos were obtained from natural mating and staged according to morphology as described [6]. 2.2. DNA, RNA and antisense MO injections Plasmids were purified with QIAGEN Plasmid Mini Kit, and injected into embryos at one-cell stage. Capped sense RNAs encoding full-length zebrafish Pnas4 and xenopus Pnas4 were synthesized using mMessage Machine system (Ambion). Antisense MOs (Gene-Tools) targeted against the ZPnas4 transcript was designed to inhibit RNA translation, and was obtained from Gene Tools. The sequences were as follows: standard control-MO, 5 0 CCTCTTACCTCAGTTACAATTTATA3 0 ; ZPnas4-MO, 5 0 CAGGATAACCGGCTCGTTTGCCATC 3 0 ; Wnt11-MO, 5 0 GTTCCTGTATTCTGTCATGTCGCTC3 0 . MO or mRNA solution in Danieau buffer [7] was injected into zebrafish or xenopus embryos at one-cell stage. 2.3. In situ hybridization Whole-mount in situ hybridization was performed as described [8]. Antisense RNA probes for no tail (ntl) [9], Myod [10], groosecoid (gsc) [11], paraxial protocadherin (Papc) [12] distal-less3 (dlx3) [13] and hatching gland 1 (hgg1) [14] were synthesized with a digoxygenin RNA labeling kit (Roche, Switzerland) according to the manufacturerÕs instructions.
0014-5793/$34.00 Ó 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2008.05.036
2326 2.4. Cell transplantation For migration behavior analysis of the ZPnas4-depleted cells, donor cells from embryos injected with control-MO together with Rhodamine-dextran (10 000 MW, invitrogen) or ZPnas4-MO together with FITC-dextran (10 000 MW, invitrogen) were transplanted into wildtype host embryos as described [15,16]. For analysis of cells with excess level of ZPnas4 activity, donor embryos were injected with Rhodamine-dextran alone or ZPnas4 mRNA together with FITC-dextran. Both groups of the donor embryos were grown until shield stage. Then about 10–30 cells from two embryos, one of each type, were sequentially aspirated into a micropipette and transplanted simultaneously into the deep cells of the shield or into the lateral germ ring of wildtype shield stage hosts, as indicated by Fig. 6.
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
3. Results 3.1. Cloning and expression of zebrafish Pnas4 In order to identify zebrafish Pnas4, we queried the zebrafish protein data base with the human Pnas4 protein sequence. One zebrafish protein sequence (GenBank accession no: NM_001003532) was identified that showed high homology with the input sequence. The predicted protein encoded by zebrafish Pnas4 shares about 81% amino acid identity to human Pnas4 and 86% to xenopus Pnas4 (XPnas4) (Fig. 1A). The multiple sequence alignment revealed that Pnas4 is highly con-
Fig. 1. Isolation and characterization of zebrafish Pnas4. (A) Multiple sequence alignment and (B) phylogenetic analysis of Pnas4 protein in vertebrates.
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
served in almost all vertebrate and ZPnas4 mostly closes to XPnas4 (Fig. 1B). We investigated the spatiotemporal expression pattern of ZPnas4 in zebrafish embryos by whole-mount in situ hybridization. ZPnas4 transcripts were detected before the 1k cell stage (Fig. 2A), suggesting that it is maternally loaded. At the shield stage stronger staining was detected in the dorsal region (Fig. 2C); then Pnas4 transcripts were found in the whole gastrula (Fig. 2E). At tail bud stage and 24 h post fertilization (hpf), stronger staining was detected in the anterior structure (Fig. 2F and G). 3.2. Knocking-down of ZPnas4 caused gastrulation defects To investigate the function of ZPnas4 during zebrafish embryonic development, we blocked its expression by means of antisense morpholino oligonucleotides against translational initiation site of the targeted transcripts (ZPnas4-MO). Standard control morpholino (control-MO) was used as negative control. Fig. 3A shows that both control-MO and ZPnas4MO had no effect on the expression of GFP protein, but ZPnas4-MO specifically inhibited the expression of ZPnas4GFP, suggesting that ZPnas4-MO was able to efficiently block the translation of ZPnas4 in vivo. Following injection of ZPnas4-MO, the earliest phenotype occurred at the late gastrula stage. Embryos injected with ZPnas4-MO displayed shorter and wider AP axis than control-MO injected ones. In addition, the prechordal plate was vegetally mis-positioned (Fig. 3C, F and I). At somite stage, the anterior structure seemed normal, while the elongation and protrusion of the tail bud was inhibited in ZPnas4-MO-injected embryos (data not shown), which in turn led to ventrally curved tails at 2 days post fertilization (dpf) (Fig. 3L–N). We quantified the phenotypes induced byZPnas4-MO according to the severity of the tail defects. As shown in Fig. 3O, both severity and penetrance of the phenotypes increased with the dosage of ZPnas4-MO. To verify that these phenotypes produced by the injection of ZPnas4-MO were the result of the depletion of ZPnas4 but not non-specific effects, we performed rescue experiments using XPnas4 mRNA which did not contain the ZPnas4-MO targeted
2327
sequence. Co-injection of XPnas4 mRNA with ZPnas4-MO could efficiently suppress the ZPnas4-MO phenotype, as judged by the reduction of embryos with gastrulation and tail defects. (Fig. 3D, G, J and O). The results demonstrated that introduction of exogenous Pnas4 activity can compromise the effect of injection of ZPnas4-MO, which supported the notion that ZPnas4-MO specifically impairs endogenous ZPnas4 activity. 3.3. Over-expression of ZPnas4 led to an elongated body axis To complement our analysis of phenotypes induced by the inhibition of ZPnas4 activity, we investigated the consequences of increased levels of ZPnas4 by injection of ZPnas4 mRNA. At tail bud stage, embryos that received ectopic ZPnas4 mRNA exhibited elongated animal-vegetal (AV) and narrowed mediolateral (ML) axis. The AV/ML ratio of ZPnas4mRNA-injected embryos was significantly increased (1.41 ± 0.05) compared with GFP-mRNA-injected embryos (1.17 ± 0.05). The phenotype of ZPnas4 over-expression became more dramatic during somitogenesis, with the somites expanded mediolaterally (Fig. 4B and D). The penetrance of the elongated body axis phenotype depended on the dose of ZPnas4 mRNA (Fig. 4G). In comparison, embryos injected with the same dose of GFP mRNA were normal in morphology. When 4 ng ZPnas4-MO with 80pg ZPnas4 mRNA was coinjected, the percentage of injected embryos exhibiting AP axis elongation at tail-bud stage was significantly reduced (Fig. 4G). This result provided another line of evidence that ZPnas4-MO does functionally block the translation of ZPnas4 mRNA and further demonstrated the specificity of the phenotype produced by ZPnas4 mRNA injection was the result of activation of ZPnas4 signaling. Taken together, these results indicate that Pnas4 protein levels must be maintained within a defined range, as under- or over-expression causes gastrulation defects. 3.4. Loss or gain of function of ZPnas4 altered the expression pattern of marker genes To further characterize gastrulation defects caused by inhibition or activation of ZPnas4, we examined the expression of a variety of marker genes in ZPnas4 morphants by whole-mount
Fig. 2. Expression pattern of Pnas4 in zebrafish embryos. Whole-mount in situ hybridization with Pnas4 anti-sense probe at two-cell (A), dome (B), shield (C), 70% epiboly (E), tail-bud (F) and 24 hpf (G) stages. (D) shield-stage embryo hybridized with control sense probe. (A–E) Lateral views with dorsal to the right; (G) lateral views with anterior to the left.
2328
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
Fig. 3. Inhibition of ZPnas4 leads to gastrulation defects. (A) Western blot analysis of the inhibition of ZPnas4-GFP translation by ZPnas4-MO, using anti-GFP antibody. (B–G) lateral view and (H–J) dorsal view of living embryos at tail bud stage. The AP axial length was highlighted with arrow head and asterisk. (K–N) Range of phenotypes at 2 dpf induced by injection of ZPnas4-MO, lateral view. (O) Quantification of ZPnas4-MO morphant and mRNA rescue phenotype.
in situ hybridization. In wild-type embryos at tail bud stage, the neural plate, marked by dlx3, became narrow due to the convergent movement of the ectoderm. However, the neural plate was much broader in ZPnas4-MO-injected embryos at the same stage (73.9%, n = 23, Fig. 5E and H). The anterior
end of prechordal plate, the polster, which is marked with hgg1, had migrated to the tip of the head (delimited by the dlx3 domain) in wild-type, but not in ZPnas4-MO-injected embryos whose polster was positioned more vegetally and within the anterior edge of the neural plate. Analogously, the expres-
Fig. 4. Over-expression of ZPnas4 mRNA promotes body axis elongation. One somite stage living GFP mRNA (A, C, E) and ZPnas 4 mRNA (B, D, F) injected embryos. (A, B, E, F) lateral views, and (C, D) dorsal views. Note that ZPnas4 mRNA injected embryos display more elongated body axis than control embryos. Arrow highlighted the expanded somite in ZPnas4 mRNA injected embryo. (G) Quantification of phenotype produced by gradient dose of ZPnas mRNA.
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
Fig. 5. In situ hybridization analysis of a variety of marker genes in ZPnas4 morphant embryos. (A–C) Lateral views of tail bud stage living wild-type (A), ZPnas4-MO (B) and ZPnas4 mRNA (C) embryos. The ZPnas4-MO injected embryo (B) shows shorter AP body axes, while ZPnas4 mRNA injected embryo (C) shows longer body axes as compared to wild-type embryo. (D–F, M–R) dorsal views, (G–I) animal pole views, and (J–L) lateral views of tail-bud stage wild-type, ZPnas4-MO and ZPnas4-mRNA-injected embryos labeled with a variety of marker genes which were indicated at the left of each panel. Changes of the expression pattern of those marker genes were indicated with arrow or arrow head, and described in detail in the text.
sion of gsc, marking prechordal plate, is also vegetally mispositioned in ZPnas4-MO-injected embryos (56.3%, n = 32, Fig. 5K). In addition, the expression domain of ntl in the posterior axial mesendoderm was shorter but wider in ZPnas4MO-injected embryos (Fig. 5E). It was also apparent that injection of ZPnas4-MO resulted in less convergence and
2329
Fig. 6. ZPnas4 cell-autonomously controls the convergence but not the anterior migration. (A, B) Schematic diagram of cell transplantation procedure. (A) Prechordal mesendodermal (PCME) cells from a normal control donor (red), and PCME cells from a donor received ZPnas4-MO or ZPnas4 mRNA (green) were transplanted into the inner domain of the shield of a wild-type host. (B) Lateral mesendodermal (LME) cells from a control donor (red) and a donor received ZPnas4-MO or ZPnas4-mRNA (green) were transplanted into the lateral side of a wild-type host at shield stage. (C) Wild-type host embryo received PCME cells from a control and ZPnas4-MO-injected donor, dorsal to the right. After transplantation, control PCME cells and ZPnas4-depletion PCME cells migrate anteriorly, and are restricted in the prechordal plate at tail bud stage. (D) Wild-type host embryo received LME cells from a control and ZPnas4-MO-injected donor, dorsal to the right. Cells of both groups migrate dorsally and radiately to become an arc line parallel with the notochord at tail-bud stage. However, ZPnas4-depleted cells show less dorsal convergence. (E, F) Wild-type host embryo received PCME or LME cells from a control and ZPnas4-mRNA-injected donor, dorsal to the right. PCME cells and LME cell from both the control and ZPnas4-mRNA-injected donor migrate in a similar manner. These data are representative of three separate experiments.
extension of the paraxial and lateral mesoderm, as evident from the expression pattern alternation of myoD (62.8%, n = 43, Fig. 5N) and papc (67.9%, n = 53, Fig. 5Q) respectively. At the same time, we further examined the expression of these marker genes in embryos with increased level of Pnas4 activity. In ZPnas4-mRNA-injected embryos, the expression domain of gsc (n = 34, Fig. 5L) and hgg1 (n = 32, Fig. 5I) was normal. However, the expression domain of ntl (65.6%, n = 32, Fig. 5F), myoD (76.5%, n = 34, Fig. 5O) and papc (67.3%, n = 49, Fig. 5R) became longer in AP axis, (Fig. 5F, I and L). Additionally, dlx3, myoD and papc expression domains showed less convergence in ZPnas4-mRNA-injected embryos. Consistent
2330
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
with this, we had observed that somites were expanded mediolaterally in embryos that received ectopic ZPnas4 mRNA (Fig. 2D). Taken together, over-expression of Pnas4 promotes extension and suppresses convergence, while inhibition suppresses both convergence and extension, suggesting that proper Pnas4 activity is critical for the coordination of convergence and extension. 3.5. ZPnas4 cell-autonomously controls convergence but not the anterior migration Depending on the position within the gastrula, cells exhibit different movements under the control of different cellular and molecular mechanisms [17]. Prechordal plate precursors appear to actively migrate and might be independent of convergence and extension movements, which was supported by the phenotypic analysis of the nodal [18,19] and stat3 [20–22] signal mutants. To further characterize functions of ZPnas4 in anterior migration and convergent extension, we performed cell transplantation assays to analyze these migration behaviors of cells with under- or over-expression of ZPnas4. Prechordal mesendodermal (PCME) cells from the shield of ZPnas4-MO-injected embryos and control-MO-injected embryos were co-transplanted deeply into the shield of a wildtype host embryo (Fig. 6A). Following transplantation, these PCME cells, either from ZPnas4-MO or control-MO-injected donors, migrated anteriorly. We took time lapse observations and found no differences between the migration velocity of ZPnas4-MO and control-MO donor cells, and all the cells were restricted in the prechordal plate at the end of gastrulation (n = 13, Fig. 6C). Next, we thought to examine the effects of Pnas4 depletion on the migration ability of lateral mesodermal (LME) cells (Fig. 6B). After cell transplantation, all the donor LME cells began to converge towards the dorsal side. However, in a significant proportion of transplanted embryos (65.3%, n = 23 and Table 1), the ZPnas4-depleted cells showed reduced dorsal migration (Fig. 6D). Thus, these data demonstrated that depletion of ZPnas4 activity cell-autonomously inhibits convergence, but not the anterior migration. In addition, we also tested these migration behaviors of cells received ectopic ZPnas4 mRNA. However, neither anterior (n = 18) nor dorsal migration (n = 22) was affected by excess ZPnas4 activity, revealing that the inhibition of convergence by excess ZPnas4 activity was a non-autonomous effect. 3.6. ZPnas4 acts in parallel with non-canonical Wnt pathway The non-canonical Wnt signaling pathway is conserved in many species to mediate mediolateral cell polarization and migration [23,24]. In zebrafish, both the convergent and extension movements are disrupted when non-canonical Wnt signal-
Table 1 ZPnas4-depleted cells show less convergence than control cells Transplantation
n
Normal convergence
Reduced convergence
1 2 3
4 11 8
1 4 3
3 7 5
Total
23
8
15
Normal or reduced convergence of the ZPnas4-depleted cells was judged form their relative position to control cells at tail-bud to 1 somite stage. Data were obtained from three independent experiments.
ing is disturbed. Similarly, inhibition of Pnas4 signaling suppressed both the convergent and extension movement. And the morphological change in embryos injected with ZPnas4-MO at the tail-bud stage resembles the phenotype resulting from non-canonical Wnt signaling disruption. So it is meaningful to address the genetic interaction between ZPnas4 and non-canonical Wnt signaling. We first examined if there is any alternation of ZPnas4 mRNA expression in embryos injected with Wnt11 mRNA to activate non-canonical Wnt signaling. However, the transcription of ZPnas4 was not altered by injection of a high dose of Wnt11 mRNA (two times more than the dose that was able to induce the gastrulation defects) (data not shown), revealing that ZPnas4 transcription was independent of the non-canonical Wnt activity. Then, we addressed whether ZPnas4 could modulate Wnt11 signaling during gastrulation. We injected ZPnas4 mRNA or ZPnas4 MO in embryos that received 8 ng Wnt11 MO previously shown to specifically inhibit Wnt11 function. However, neither various levels of excess nor deficit of ZPnas4 activity could suppress the gastrulation defect in Wnt11-MO injected embryos. Rather, both perturbations of ZPnas4 activity enhanced the Wnt11 depletion phenotype (Fig. 7). Similarly, neither inhibition nor activation of ZPnas4 could suppress the Wnt11 over-expression phenotype (data not shown). Therefore, it is likely that ZPnas4 acts in parallel with non-canonical Wnt signaling in the regulation of cell movement.
4. Discussion In this study, we investigate the function of ZPnas4 during zebrafish embryogenesis. Our results reveal that ZPnas4 regulates convergence and extension during gastrulation. We demonstrate that ZPnas4 acts autonomously to promote dorsal migration of the lateral cells but is not required within prechordal plate precursors to mediate anterior migration. Thus, our data clearly established that ZPnas4 is essential for the regulation of cell movement. During gastrulaion, the body plan is established through cell fate specification of different domains and a series of morphogenetic movements which were mainly driven by convergence and extension [25–27]. In zebrafish, the lateral tissues converge dorsally by directed migration at an increasing speed as they migrate closer to the notochord. While the axial and adjacent axial tissues engage in mediolateral intercalations to achieve strong extension movements [27–29]. Inhibition of ZPnas4 simultaneously suppresses convergence and extension, suggesting ZPnas4 activity is required within both lateral and dorsal regions. However, activation of ZPnas4 promotes extension but suppresses convergence. The discordant response of convergence and extension to under- or over-expression of Pnas4 led us to propose that the function of Pnas4 is complicated and varies within lateral and dorsal regions. The non-autonomous suppression of convergence by over-expression of ZPnas4 might be the result of the defects in extra-cellular factors, for instance the extra-cellular chemotatic factors derived from the dorsal region. The expression of human Pnas4 had been shown to be upregulated in peripheral blood mononuclear cells exposed to carcinogenic agent [3], as well as malignant tumors such as invasive cervical cancers and androgen-independent prostate
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
2331
Fig. 7. Genetic interaction between Wnt11 and ZPnas4. (A) Lateral views of tail bud stage living embryos, the treatments of embryos were indicated on the top of each panel. The distance between anterior and posterior structure is highlighted with arrow head and asterisk and the width of the notochord is indicated with arrows. (B) Lateral views of living embyos at 24 hpf. Note that either activation or inhibition of ZPnas4 significantly reduced the posterior structure in Wnt11 morphant embryos.
cancer [1,2], indicating that Pnas4 might be associated with tumor genesis and progression to malignancy. We observed that over-expression could induce S-phase arrest in several types of tumor cells and thus inhibit their proliferation (unpublished data). In fact, cell division and cell cycle are key parameters in the regulation of gastrulation movement. In xenopus, concomitant with the onset of convergent extension, cells of the dorsal mesoderm stop dividing [30,31] and artificial increment of the mitotic index will lead to the failure of convergence and extension [32–35]. For instance, morpholino-mediated depletion of Wee2, which is a kinase that prevents cell cycle progression by phosphorylating and thus inhibiting the activity of the Cdks, results in the failure of convergent extension. Furthermore, similar defects are observed if the cell cycle is inappropriately advanced by introducing Cdc25, antagonist of the Wee kinases, or constitutive active form of Cdk2 [34]. Given that tumor cells share many characteristics with embryonic progenitors, it is reasonable to further test that the abnormal cell cycle regulation might contribute to the improper convergence and extension induced by under- or over-expression of
Pnas4 and that Pnas4 might be involved in similar mechanism during metastasis of invasive cancers. In summary, we reported for the first time the developmental function of a novel gene, Pnas4. Either under- or over-expression of Pnas4 leads to gastrulation defects. We systematically investigated the embryonic phenotype and demonstrated that Pnas4 controls gastrulation mainly by the regulation of cell movements. In addition to expanding our understanding of the mechanisms regulating gastrulation movement, these data suggested that Pnas4 might be involved in other events linked with cell migration, including the subsequent developmental processes and tumor metastasis. References [1] Santin, A.D., Zhan, F., Bignotti, E., Siegel, E.R., Cane, S., Bellone, S., et al. (2005) Gene expression profiles of primary HPV16- and HPV18-infected early stage cervical cancers and normal cervical epithelium: identification of novel candidate molecular markers for cervical cancer diagnosis and therapy. Virology 331, 269–291.
2332 [2] Best, C.J., Gillespie, J.W., Yi, Y., Chandramouli, G.V., Perlmutter, M.A., Gathright, Y., et al. (2005) Molecular alterations in primary prostate cancer after androgen ablation therapy. Clin. Cancer Res. 11, 6823–6834. [3] Forrest, M.S., Lan, Q., Hubbard, A.E., Zhang, L., Vermeulen, R., Zhao, X., et al. (2005) Discovery of novel biomarkers by microarray analysis of peripheral blood mononuclear cell gene expression in benzene-exposed workers. Environ. Health Perspect. 113, 801–807. [4] Topczewska, J.M., Postovit, L.M., Margaryan, N.V., Sam, A., Hess, A.R., Wheaton, W.W., et al. (2006) Embryonic and tumorigenic pathways converge via Nodal signaling: role in melanoma aggressiveness. Nat. Med. 12, 925–932. [5] Lee, J.T. and Herlyn, M. (2006) Embryogenesis meets tumorigenesis. Nat. Med. 12, 882–884. [6] Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B. and Schilling, T.F. (1995) Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253–310. [7] Nasevicius, A. and Ekker, S.C. (2000) Effective targeted geneÕknockdownÕ in zebrafish. Nat. Genet. 26, 216–220. [8] Jowett, T. (1999) Analysis of protein and gene expression. Meth. Cell Biol. 59, 63–85. [9] Schulte-Merker, S., van Eeden, F.J., Halpern, M.E., Kimmel, C.B. and Nusslein-Volhard, C. (1994) No tail (ntl) is the zebrafish homologue of the mouse T (Brachyury) gene. Development 120, 1009–1015. [10] Weinberg, E.S., Allende, M.L., Kelly, C.S., Abdelhamid, A., Murakami, T., Andermann, P., et al. (1996) Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail embryos. Development 122, 271–280. [11] Stachel, S.E., Grunwald, D.J. and Myers, P.Z. (1993) Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117, 1261–1274. [12] Yamamoto, A., Amacher, S.L., Kim, S.H., Geissert, D., Kimmel, C.B. and De Robertis, E.M. (1998) Zebrafish paraxial protocadherin is a downstream target of spadetail involved in morphogenesis of gastrula mesoderm. Development 125, 3389– 3397. [13] Akimenko, M.A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994) Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J. Neurosci. 14, 3475–3486. [14] Thisse, C., Thisse, B., Halpern, M.E. and Postlethwait, J.H. (1994) Goosecoid expression in neurectoderm and mesendoderm is disrupted in zebrafish cyclops gastrulas. Dev. Biol. 164, 420– 429. [15] Jessen, J.R., Topczewski, J., Bingham, S., Sepich, D.S., Marlow, F., Chandrasekhar, A., et al. (2002) Zebrafish trilobite identifies new roles for Strabismus in gastrulation and neuronal movements. Nat. Cell Biol. 4, 610–615. [16] Formstone, C.J. and Mason, I. (2005) Combinatorial activity of Flamingo proteins directs convergence and extension within the early zebrafish embryo via the planar cell polarity pathway. Dev. Biol. 282, 320–335. [17] Warga, R.M. and Kimmel, C.B. (1990) Cell movements during epiboly and gastrulation in zebrafish. Development 108, 569–580. [18] Solnica-Krezel, L., Stemple, D.L., Mountcastle-Shah, E., Rangini, Z., Neuhauss, S.C., Malicki, J., et al. (1996) Mutations
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
[19] [20] [21]
[22]
[23] [24] [25] [26] [27] [28] [29] [30]
[31] [32] [33]
[34]
[35]
affecting cell fates and cellular rearrangements during gastrulation in zebrafish. Development 123, 67–80. Carmany-Rampey, A. and Schier, A.F. (2001) Single-cell internalization during zebrafish gastrulation. Curr. Biol. 11, 1261– 1265. Yamashita, S., Miyagi, C., Carmany-Rampey, A., Shimizu, T., Fujii, R., Schier, A.F., et al. (2002) Stat3 controls cell movements during zebrafish gastrulation. Dev. Cell 2, 363–375. Miyagi, C., Yamashita, S., Ohba, Y., Yoshizaki, H., Matsuda, M. and Hirano, T. (2004) STAT3 noncell-autonomously controls planar cell polarity during zebrafish convergence and extension. J. Cell Biol. 166, 975–981. Yamashita, S., Miyagi, C., Fukada, T., Kagara, N., Che, Y.S. and Hirano, T. (2004) Zinc transporter LIVI controls epithelialmesenchymal transition in zebrafish gastrula organizer. Nature 429, 298–302. Mlodzik, M. (2002) Planar cell polarization: do the same mechanisms regulate Drosophila tissue polarity and vertebrate gastrulation? Trend Genet. 18, 564–571. Seifert, J.R. and Mlodzik, M. (2007) Frizzled/PCP signalling: a conserved mechanism regulating cell polarity and directed motility. Nat. Rev. Genet. 8, 126–138. Narasimha, M. and Leptin, M. (2000) Cell movements during gastrulation: come in and be induced. Trend Cell Biol. 10, 169– 172. Keller, R., Davidson, L.A. and Shook, D.R. (2003) How we are shaped: the biomechanics of gastrulation. Differentiation 71, 171– 205. Myers, D.C., Sepich, D.S. and Solnica-Krezel, L. (2002) Convergence and extension in vertebrate gastrulae: cell movements according to or in search of identity? Trend Genet. 18, 447–455. Wood, A. and Thorogood, P. (1994) Patterns of cell behaviour underlying somitogenesis and notochord formation in intact vertebrate embryos. Dev. Dyn. 201, 151–167. Glickman, N.S., Kimmel, C.B., Jones, M.A. and Adams, R.J. (2003) Shaping the zebrafish notochord. Development 130, 873– 887. Cooke, J. (1979) Cell number in relation to primary pattern formation in the embryo of Xenopus laevis. II. Sequential cell recruitment, and control of the cell cycle, during mesoderm formation. J. Embryol. Exp. Morphol. 53, 269–289. Saka, Y. and Smith, J.C. (2001) Spatial and temporal patterns of cell division during early Xenopus embryogenesis. Dev. Biol. 229, 307–318. Hashiguchi, A., Okabayashi, K. and Asashima, M. (2004) Role of TSC-22 during early embryogenesis in Xenopus laevis. Dev. Growth Differ. 46, 535–544. Murakami, M.S., Moody, S.A., Daar, I.O. and Morrison, D.K. (2004) Morphogenesis during Xenopus gastrulation requires Wee1-mediated inhibition of cell proliferation. Development 131, 571–580. Leise 3rd, W.F. and Mueller, P.R. (2004) Inhibition of the cell cycle is required for convergent extension of the paraxial mesoderm during Xenopus neurulation. Development 131, 1703–1715. Hashiguchi, A., Hitachi, K., Inui, M., Okabayashi, K. and Asashima, M. (2007) TSC-box is essential for the nuclear localization and antiproliferative effect of XTSC-22. Dev. Growth Differ. 49, 197–204.
Pnas4 is a novel regulator for convergence and extension during vertebrate gastrulation Shaohua Yao, Lifang Xie, Meilin Qian, Hanshuo Yang, Lang Zhou, Qian Zhou, Fei Yan, Lantu Gou, Yuquan Wei, Xia Zhao*, Xianming Mo* State Key Laboratory of Biotherapy, West China Hospital and Life Science College, Sichuan University, Chengdu 610041, China Received 31 March 2008; revised 25 May 2008; accepted 26 May 2008 Available online 4 June 2008 Edited by Daniela Ruffell
Abstract Recent studies show that human Pnas4 might be tumor associated, while its function remains unknown. Here, we investigate the developmental function of Pnas4 using zebrafish as a model system. Knocking down Pnas4 causes gastrulation defects with a shorter and broader axis, as well as a posteriorly mis-positioned prechordal plate, due to the defective convergence and extension movement. Conversely, over-expression of Pnas4 mRNA leads to an elongated body axis. We further demonstrate that Pnas4 is required cell-autonomously for dorsal convergence but not for anterior migration. In addition, genetic interaction assays indicate that Pnas4 might act in parallel with non-canonical Wnt signal in the regulation of cell movement. Our data suggest that Pnas4 is a key regulator of cell movement during gastrulation. Ó 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Gastrulation; Convergence and extension; Anterior migration; Pnas4
1. Introduction The Pnas4 gene was previously identified as a putative apoptosis-related protein in human acute promyelocytic leukemia cell line NB4. Recent evidence shows that Pnas4 is up-regulated in human papillomavirus-infected invasive cervical cancer and androgen-independent prostate cancer [1,2]. In addition, it is also up-regulated in peripheral blood mononuclear cells exposed to benzene which is an established cause of leukemia [3]. These findings indicate Pnas4 might be linked with tumor genesis and development. However, to date the biological function of Pnas4 in these processes is still unclear. It has been widely proven that the genesis of cancer often uses similar mechanisms to embryogenesis, and aggressive tumor cells share many behaviors with embryonic progenitors [4,5]. Furthermore, members of Pnas4 family of various organisms share high homology of protein sequence, and all of them contain a conserved DUF862 domain with unknown function, suggesting Pnas4 may be functionally conserved. Considering
*
Corresponding authors. Fax: +86 28 85164047. E-mail addresses: [email protected] (X. Zhao), [email protected] (X. Mo).
this, we hypothesize that Pnas4 may also play an important role in early vertebrate development. Zebrafish is an excellent model organism to study vertebrate development and establish disease models. Reverse-genetic approaches, especially the morpholino oligo knocking-down technique, facilitate in vivo functional analysis of interesting genes. To test our hypothesis, we used zebrafish as a model system to investigate the developmental function of Pnas4. We show that Pnas4 is both maternally and zygotically expressed and is broadly distributed in early development. Knocking-down zebrafish Pnas4 (ZPnas4) protein expression by amplification of specific antisense morphorlino caused gastrulation defects, characterized by shorter and broader anteroposterior (AP) axes. Over-expression of ZPnas4 mRNA leads to the elongation of the AP axis. With in situ hybridization and cell transplantation experiments, we demonstrated that these phenotypes resulted from defective convergence and extension movement. Furthermore, analysis of genetic interaction between ZPnas4 and non-canonical Wnt signal revealed that they might act in parallel to regulate cell movement. These results established a role for ZPnas4 in the control of cell movement during gastrulation. 2. Materials and methods 2.1. Zebrafish maintenance Wild-type embryos of the Tuebingen strain were used. Embryos were obtained from natural mating and staged according to morphology as described [6]. 2.2. DNA, RNA and antisense MO injections Plasmids were purified with QIAGEN Plasmid Mini Kit, and injected into embryos at one-cell stage. Capped sense RNAs encoding full-length zebrafish Pnas4 and xenopus Pnas4 were synthesized using mMessage Machine system (Ambion). Antisense MOs (Gene-Tools) targeted against the ZPnas4 transcript was designed to inhibit RNA translation, and was obtained from Gene Tools. The sequences were as follows: standard control-MO, 5 0 CCTCTTACCTCAGTTACAATTTATA3 0 ; ZPnas4-MO, 5 0 CAGGATAACCGGCTCGTTTGCCATC 3 0 ; Wnt11-MO, 5 0 GTTCCTGTATTCTGTCATGTCGCTC3 0 . MO or mRNA solution in Danieau buffer [7] was injected into zebrafish or xenopus embryos at one-cell stage. 2.3. In situ hybridization Whole-mount in situ hybridization was performed as described [8]. Antisense RNA probes for no tail (ntl) [9], Myod [10], groosecoid (gsc) [11], paraxial protocadherin (Papc) [12] distal-less3 (dlx3) [13] and hatching gland 1 (hgg1) [14] were synthesized with a digoxygenin RNA labeling kit (Roche, Switzerland) according to the manufacturerÕs instructions.
0014-5793/$34.00 Ó 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2008.05.036
2326 2.4. Cell transplantation For migration behavior analysis of the ZPnas4-depleted cells, donor cells from embryos injected with control-MO together with Rhodamine-dextran (10 000 MW, invitrogen) or ZPnas4-MO together with FITC-dextran (10 000 MW, invitrogen) were transplanted into wildtype host embryos as described [15,16]. For analysis of cells with excess level of ZPnas4 activity, donor embryos were injected with Rhodamine-dextran alone or ZPnas4 mRNA together with FITC-dextran. Both groups of the donor embryos were grown until shield stage. Then about 10–30 cells from two embryos, one of each type, were sequentially aspirated into a micropipette and transplanted simultaneously into the deep cells of the shield or into the lateral germ ring of wildtype shield stage hosts, as indicated by Fig. 6.
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
3. Results 3.1. Cloning and expression of zebrafish Pnas4 In order to identify zebrafish Pnas4, we queried the zebrafish protein data base with the human Pnas4 protein sequence. One zebrafish protein sequence (GenBank accession no: NM_001003532) was identified that showed high homology with the input sequence. The predicted protein encoded by zebrafish Pnas4 shares about 81% amino acid identity to human Pnas4 and 86% to xenopus Pnas4 (XPnas4) (Fig. 1A). The multiple sequence alignment revealed that Pnas4 is highly con-
Fig. 1. Isolation and characterization of zebrafish Pnas4. (A) Multiple sequence alignment and (B) phylogenetic analysis of Pnas4 protein in vertebrates.
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
served in almost all vertebrate and ZPnas4 mostly closes to XPnas4 (Fig. 1B). We investigated the spatiotemporal expression pattern of ZPnas4 in zebrafish embryos by whole-mount in situ hybridization. ZPnas4 transcripts were detected before the 1k cell stage (Fig. 2A), suggesting that it is maternally loaded. At the shield stage stronger staining was detected in the dorsal region (Fig. 2C); then Pnas4 transcripts were found in the whole gastrula (Fig. 2E). At tail bud stage and 24 h post fertilization (hpf), stronger staining was detected in the anterior structure (Fig. 2F and G). 3.2. Knocking-down of ZPnas4 caused gastrulation defects To investigate the function of ZPnas4 during zebrafish embryonic development, we blocked its expression by means of antisense morpholino oligonucleotides against translational initiation site of the targeted transcripts (ZPnas4-MO). Standard control morpholino (control-MO) was used as negative control. Fig. 3A shows that both control-MO and ZPnas4MO had no effect on the expression of GFP protein, but ZPnas4-MO specifically inhibited the expression of ZPnas4GFP, suggesting that ZPnas4-MO was able to efficiently block the translation of ZPnas4 in vivo. Following injection of ZPnas4-MO, the earliest phenotype occurred at the late gastrula stage. Embryos injected with ZPnas4-MO displayed shorter and wider AP axis than control-MO injected ones. In addition, the prechordal plate was vegetally mis-positioned (Fig. 3C, F and I). At somite stage, the anterior structure seemed normal, while the elongation and protrusion of the tail bud was inhibited in ZPnas4-MO-injected embryos (data not shown), which in turn led to ventrally curved tails at 2 days post fertilization (dpf) (Fig. 3L–N). We quantified the phenotypes induced byZPnas4-MO according to the severity of the tail defects. As shown in Fig. 3O, both severity and penetrance of the phenotypes increased with the dosage of ZPnas4-MO. To verify that these phenotypes produced by the injection of ZPnas4-MO were the result of the depletion of ZPnas4 but not non-specific effects, we performed rescue experiments using XPnas4 mRNA which did not contain the ZPnas4-MO targeted
2327
sequence. Co-injection of XPnas4 mRNA with ZPnas4-MO could efficiently suppress the ZPnas4-MO phenotype, as judged by the reduction of embryos with gastrulation and tail defects. (Fig. 3D, G, J and O). The results demonstrated that introduction of exogenous Pnas4 activity can compromise the effect of injection of ZPnas4-MO, which supported the notion that ZPnas4-MO specifically impairs endogenous ZPnas4 activity. 3.3. Over-expression of ZPnas4 led to an elongated body axis To complement our analysis of phenotypes induced by the inhibition of ZPnas4 activity, we investigated the consequences of increased levels of ZPnas4 by injection of ZPnas4 mRNA. At tail bud stage, embryos that received ectopic ZPnas4 mRNA exhibited elongated animal-vegetal (AV) and narrowed mediolateral (ML) axis. The AV/ML ratio of ZPnas4mRNA-injected embryos was significantly increased (1.41 ± 0.05) compared with GFP-mRNA-injected embryos (1.17 ± 0.05). The phenotype of ZPnas4 over-expression became more dramatic during somitogenesis, with the somites expanded mediolaterally (Fig. 4B and D). The penetrance of the elongated body axis phenotype depended on the dose of ZPnas4 mRNA (Fig. 4G). In comparison, embryos injected with the same dose of GFP mRNA were normal in morphology. When 4 ng ZPnas4-MO with 80pg ZPnas4 mRNA was coinjected, the percentage of injected embryos exhibiting AP axis elongation at tail-bud stage was significantly reduced (Fig. 4G). This result provided another line of evidence that ZPnas4-MO does functionally block the translation of ZPnas4 mRNA and further demonstrated the specificity of the phenotype produced by ZPnas4 mRNA injection was the result of activation of ZPnas4 signaling. Taken together, these results indicate that Pnas4 protein levels must be maintained within a defined range, as under- or over-expression causes gastrulation defects. 3.4. Loss or gain of function of ZPnas4 altered the expression pattern of marker genes To further characterize gastrulation defects caused by inhibition or activation of ZPnas4, we examined the expression of a variety of marker genes in ZPnas4 morphants by whole-mount
Fig. 2. Expression pattern of Pnas4 in zebrafish embryos. Whole-mount in situ hybridization with Pnas4 anti-sense probe at two-cell (A), dome (B), shield (C), 70% epiboly (E), tail-bud (F) and 24 hpf (G) stages. (D) shield-stage embryo hybridized with control sense probe. (A–E) Lateral views with dorsal to the right; (G) lateral views with anterior to the left.
2328
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
Fig. 3. Inhibition of ZPnas4 leads to gastrulation defects. (A) Western blot analysis of the inhibition of ZPnas4-GFP translation by ZPnas4-MO, using anti-GFP antibody. (B–G) lateral view and (H–J) dorsal view of living embryos at tail bud stage. The AP axial length was highlighted with arrow head and asterisk. (K–N) Range of phenotypes at 2 dpf induced by injection of ZPnas4-MO, lateral view. (O) Quantification of ZPnas4-MO morphant and mRNA rescue phenotype.
in situ hybridization. In wild-type embryos at tail bud stage, the neural plate, marked by dlx3, became narrow due to the convergent movement of the ectoderm. However, the neural plate was much broader in ZPnas4-MO-injected embryos at the same stage (73.9%, n = 23, Fig. 5E and H). The anterior
end of prechordal plate, the polster, which is marked with hgg1, had migrated to the tip of the head (delimited by the dlx3 domain) in wild-type, but not in ZPnas4-MO-injected embryos whose polster was positioned more vegetally and within the anterior edge of the neural plate. Analogously, the expres-
Fig. 4. Over-expression of ZPnas4 mRNA promotes body axis elongation. One somite stage living GFP mRNA (A, C, E) and ZPnas 4 mRNA (B, D, F) injected embryos. (A, B, E, F) lateral views, and (C, D) dorsal views. Note that ZPnas4 mRNA injected embryos display more elongated body axis than control embryos. Arrow highlighted the expanded somite in ZPnas4 mRNA injected embryo. (G) Quantification of phenotype produced by gradient dose of ZPnas mRNA.
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
Fig. 5. In situ hybridization analysis of a variety of marker genes in ZPnas4 morphant embryos. (A–C) Lateral views of tail bud stage living wild-type (A), ZPnas4-MO (B) and ZPnas4 mRNA (C) embryos. The ZPnas4-MO injected embryo (B) shows shorter AP body axes, while ZPnas4 mRNA injected embryo (C) shows longer body axes as compared to wild-type embryo. (D–F, M–R) dorsal views, (G–I) animal pole views, and (J–L) lateral views of tail-bud stage wild-type, ZPnas4-MO and ZPnas4-mRNA-injected embryos labeled with a variety of marker genes which were indicated at the left of each panel. Changes of the expression pattern of those marker genes were indicated with arrow or arrow head, and described in detail in the text.
sion of gsc, marking prechordal plate, is also vegetally mispositioned in ZPnas4-MO-injected embryos (56.3%, n = 32, Fig. 5K). In addition, the expression domain of ntl in the posterior axial mesendoderm was shorter but wider in ZPnas4MO-injected embryos (Fig. 5E). It was also apparent that injection of ZPnas4-MO resulted in less convergence and
2329
Fig. 6. ZPnas4 cell-autonomously controls the convergence but not the anterior migration. (A, B) Schematic diagram of cell transplantation procedure. (A) Prechordal mesendodermal (PCME) cells from a normal control donor (red), and PCME cells from a donor received ZPnas4-MO or ZPnas4 mRNA (green) were transplanted into the inner domain of the shield of a wild-type host. (B) Lateral mesendodermal (LME) cells from a control donor (red) and a donor received ZPnas4-MO or ZPnas4-mRNA (green) were transplanted into the lateral side of a wild-type host at shield stage. (C) Wild-type host embryo received PCME cells from a control and ZPnas4-MO-injected donor, dorsal to the right. After transplantation, control PCME cells and ZPnas4-depletion PCME cells migrate anteriorly, and are restricted in the prechordal plate at tail bud stage. (D) Wild-type host embryo received LME cells from a control and ZPnas4-MO-injected donor, dorsal to the right. Cells of both groups migrate dorsally and radiately to become an arc line parallel with the notochord at tail-bud stage. However, ZPnas4-depleted cells show less dorsal convergence. (E, F) Wild-type host embryo received PCME or LME cells from a control and ZPnas4-mRNA-injected donor, dorsal to the right. PCME cells and LME cell from both the control and ZPnas4-mRNA-injected donor migrate in a similar manner. These data are representative of three separate experiments.
extension of the paraxial and lateral mesoderm, as evident from the expression pattern alternation of myoD (62.8%, n = 43, Fig. 5N) and papc (67.9%, n = 53, Fig. 5Q) respectively. At the same time, we further examined the expression of these marker genes in embryos with increased level of Pnas4 activity. In ZPnas4-mRNA-injected embryos, the expression domain of gsc (n = 34, Fig. 5L) and hgg1 (n = 32, Fig. 5I) was normal. However, the expression domain of ntl (65.6%, n = 32, Fig. 5F), myoD (76.5%, n = 34, Fig. 5O) and papc (67.3%, n = 49, Fig. 5R) became longer in AP axis, (Fig. 5F, I and L). Additionally, dlx3, myoD and papc expression domains showed less convergence in ZPnas4-mRNA-injected embryos. Consistent
2330
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
with this, we had observed that somites were expanded mediolaterally in embryos that received ectopic ZPnas4 mRNA (Fig. 2D). Taken together, over-expression of Pnas4 promotes extension and suppresses convergence, while inhibition suppresses both convergence and extension, suggesting that proper Pnas4 activity is critical for the coordination of convergence and extension. 3.5. ZPnas4 cell-autonomously controls convergence but not the anterior migration Depending on the position within the gastrula, cells exhibit different movements under the control of different cellular and molecular mechanisms [17]. Prechordal plate precursors appear to actively migrate and might be independent of convergence and extension movements, which was supported by the phenotypic analysis of the nodal [18,19] and stat3 [20–22] signal mutants. To further characterize functions of ZPnas4 in anterior migration and convergent extension, we performed cell transplantation assays to analyze these migration behaviors of cells with under- or over-expression of ZPnas4. Prechordal mesendodermal (PCME) cells from the shield of ZPnas4-MO-injected embryos and control-MO-injected embryos were co-transplanted deeply into the shield of a wildtype host embryo (Fig. 6A). Following transplantation, these PCME cells, either from ZPnas4-MO or control-MO-injected donors, migrated anteriorly. We took time lapse observations and found no differences between the migration velocity of ZPnas4-MO and control-MO donor cells, and all the cells were restricted in the prechordal plate at the end of gastrulation (n = 13, Fig. 6C). Next, we thought to examine the effects of Pnas4 depletion on the migration ability of lateral mesodermal (LME) cells (Fig. 6B). After cell transplantation, all the donor LME cells began to converge towards the dorsal side. However, in a significant proportion of transplanted embryos (65.3%, n = 23 and Table 1), the ZPnas4-depleted cells showed reduced dorsal migration (Fig. 6D). Thus, these data demonstrated that depletion of ZPnas4 activity cell-autonomously inhibits convergence, but not the anterior migration. In addition, we also tested these migration behaviors of cells received ectopic ZPnas4 mRNA. However, neither anterior (n = 18) nor dorsal migration (n = 22) was affected by excess ZPnas4 activity, revealing that the inhibition of convergence by excess ZPnas4 activity was a non-autonomous effect. 3.6. ZPnas4 acts in parallel with non-canonical Wnt pathway The non-canonical Wnt signaling pathway is conserved in many species to mediate mediolateral cell polarization and migration [23,24]. In zebrafish, both the convergent and extension movements are disrupted when non-canonical Wnt signal-
Table 1 ZPnas4-depleted cells show less convergence than control cells Transplantation
n
Normal convergence
Reduced convergence
1 2 3
4 11 8
1 4 3
3 7 5
Total
23
8
15
Normal or reduced convergence of the ZPnas4-depleted cells was judged form their relative position to control cells at tail-bud to 1 somite stage. Data were obtained from three independent experiments.
ing is disturbed. Similarly, inhibition of Pnas4 signaling suppressed both the convergent and extension movement. And the morphological change in embryos injected with ZPnas4-MO at the tail-bud stage resembles the phenotype resulting from non-canonical Wnt signaling disruption. So it is meaningful to address the genetic interaction between ZPnas4 and non-canonical Wnt signaling. We first examined if there is any alternation of ZPnas4 mRNA expression in embryos injected with Wnt11 mRNA to activate non-canonical Wnt signaling. However, the transcription of ZPnas4 was not altered by injection of a high dose of Wnt11 mRNA (two times more than the dose that was able to induce the gastrulation defects) (data not shown), revealing that ZPnas4 transcription was independent of the non-canonical Wnt activity. Then, we addressed whether ZPnas4 could modulate Wnt11 signaling during gastrulation. We injected ZPnas4 mRNA or ZPnas4 MO in embryos that received 8 ng Wnt11 MO previously shown to specifically inhibit Wnt11 function. However, neither various levels of excess nor deficit of ZPnas4 activity could suppress the gastrulation defect in Wnt11-MO injected embryos. Rather, both perturbations of ZPnas4 activity enhanced the Wnt11 depletion phenotype (Fig. 7). Similarly, neither inhibition nor activation of ZPnas4 could suppress the Wnt11 over-expression phenotype (data not shown). Therefore, it is likely that ZPnas4 acts in parallel with non-canonical Wnt signaling in the regulation of cell movement.
4. Discussion In this study, we investigate the function of ZPnas4 during zebrafish embryogenesis. Our results reveal that ZPnas4 regulates convergence and extension during gastrulation. We demonstrate that ZPnas4 acts autonomously to promote dorsal migration of the lateral cells but is not required within prechordal plate precursors to mediate anterior migration. Thus, our data clearly established that ZPnas4 is essential for the regulation of cell movement. During gastrulaion, the body plan is established through cell fate specification of different domains and a series of morphogenetic movements which were mainly driven by convergence and extension [25–27]. In zebrafish, the lateral tissues converge dorsally by directed migration at an increasing speed as they migrate closer to the notochord. While the axial and adjacent axial tissues engage in mediolateral intercalations to achieve strong extension movements [27–29]. Inhibition of ZPnas4 simultaneously suppresses convergence and extension, suggesting ZPnas4 activity is required within both lateral and dorsal regions. However, activation of ZPnas4 promotes extension but suppresses convergence. The discordant response of convergence and extension to under- or over-expression of Pnas4 led us to propose that the function of Pnas4 is complicated and varies within lateral and dorsal regions. The non-autonomous suppression of convergence by over-expression of ZPnas4 might be the result of the defects in extra-cellular factors, for instance the extra-cellular chemotatic factors derived from the dorsal region. The expression of human Pnas4 had been shown to be upregulated in peripheral blood mononuclear cells exposed to carcinogenic agent [3], as well as malignant tumors such as invasive cervical cancers and androgen-independent prostate
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
2331
Fig. 7. Genetic interaction between Wnt11 and ZPnas4. (A) Lateral views of tail bud stage living embryos, the treatments of embryos were indicated on the top of each panel. The distance between anterior and posterior structure is highlighted with arrow head and asterisk and the width of the notochord is indicated with arrows. (B) Lateral views of living embyos at 24 hpf. Note that either activation or inhibition of ZPnas4 significantly reduced the posterior structure in Wnt11 morphant embryos.
cancer [1,2], indicating that Pnas4 might be associated with tumor genesis and progression to malignancy. We observed that over-expression could induce S-phase arrest in several types of tumor cells and thus inhibit their proliferation (unpublished data). In fact, cell division and cell cycle are key parameters in the regulation of gastrulation movement. In xenopus, concomitant with the onset of convergent extension, cells of the dorsal mesoderm stop dividing [30,31] and artificial increment of the mitotic index will lead to the failure of convergence and extension [32–35]. For instance, morpholino-mediated depletion of Wee2, which is a kinase that prevents cell cycle progression by phosphorylating and thus inhibiting the activity of the Cdks, results in the failure of convergent extension. Furthermore, similar defects are observed if the cell cycle is inappropriately advanced by introducing Cdc25, antagonist of the Wee kinases, or constitutive active form of Cdk2 [34]. Given that tumor cells share many characteristics with embryonic progenitors, it is reasonable to further test that the abnormal cell cycle regulation might contribute to the improper convergence and extension induced by under- or over-expression of
Pnas4 and that Pnas4 might be involved in similar mechanism during metastasis of invasive cancers. In summary, we reported for the first time the developmental function of a novel gene, Pnas4. Either under- or over-expression of Pnas4 leads to gastrulation defects. We systematically investigated the embryonic phenotype and demonstrated that Pnas4 controls gastrulation mainly by the regulation of cell movements. In addition to expanding our understanding of the mechanisms regulating gastrulation movement, these data suggested that Pnas4 might be involved in other events linked with cell migration, including the subsequent developmental processes and tumor metastasis. References [1] Santin, A.D., Zhan, F., Bignotti, E., Siegel, E.R., Cane, S., Bellone, S., et al. (2005) Gene expression profiles of primary HPV16- and HPV18-infected early stage cervical cancers and normal cervical epithelium: identification of novel candidate molecular markers for cervical cancer diagnosis and therapy. Virology 331, 269–291.
2332 [2] Best, C.J., Gillespie, J.W., Yi, Y., Chandramouli, G.V., Perlmutter, M.A., Gathright, Y., et al. (2005) Molecular alterations in primary prostate cancer after androgen ablation therapy. Clin. Cancer Res. 11, 6823–6834. [3] Forrest, M.S., Lan, Q., Hubbard, A.E., Zhang, L., Vermeulen, R., Zhao, X., et al. (2005) Discovery of novel biomarkers by microarray analysis of peripheral blood mononuclear cell gene expression in benzene-exposed workers. Environ. Health Perspect. 113, 801–807. [4] Topczewska, J.M., Postovit, L.M., Margaryan, N.V., Sam, A., Hess, A.R., Wheaton, W.W., et al. (2006) Embryonic and tumorigenic pathways converge via Nodal signaling: role in melanoma aggressiveness. Nat. Med. 12, 925–932. [5] Lee, J.T. and Herlyn, M. (2006) Embryogenesis meets tumorigenesis. Nat. Med. 12, 882–884. [6] Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B. and Schilling, T.F. (1995) Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253–310. [7] Nasevicius, A. and Ekker, S.C. (2000) Effective targeted geneÕknockdownÕ in zebrafish. Nat. Genet. 26, 216–220. [8] Jowett, T. (1999) Analysis of protein and gene expression. Meth. Cell Biol. 59, 63–85. [9] Schulte-Merker, S., van Eeden, F.J., Halpern, M.E., Kimmel, C.B. and Nusslein-Volhard, C. (1994) No tail (ntl) is the zebrafish homologue of the mouse T (Brachyury) gene. Development 120, 1009–1015. [10] Weinberg, E.S., Allende, M.L., Kelly, C.S., Abdelhamid, A., Murakami, T., Andermann, P., et al. (1996) Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail embryos. Development 122, 271–280. [11] Stachel, S.E., Grunwald, D.J. and Myers, P.Z. (1993) Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117, 1261–1274. [12] Yamamoto, A., Amacher, S.L., Kim, S.H., Geissert, D., Kimmel, C.B. and De Robertis, E.M. (1998) Zebrafish paraxial protocadherin is a downstream target of spadetail involved in morphogenesis of gastrula mesoderm. Development 125, 3389– 3397. [13] Akimenko, M.A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994) Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J. Neurosci. 14, 3475–3486. [14] Thisse, C., Thisse, B., Halpern, M.E. and Postlethwait, J.H. (1994) Goosecoid expression in neurectoderm and mesendoderm is disrupted in zebrafish cyclops gastrulas. Dev. Biol. 164, 420– 429. [15] Jessen, J.R., Topczewski, J., Bingham, S., Sepich, D.S., Marlow, F., Chandrasekhar, A., et al. (2002) Zebrafish trilobite identifies new roles for Strabismus in gastrulation and neuronal movements. Nat. Cell Biol. 4, 610–615. [16] Formstone, C.J. and Mason, I. (2005) Combinatorial activity of Flamingo proteins directs convergence and extension within the early zebrafish embryo via the planar cell polarity pathway. Dev. Biol. 282, 320–335. [17] Warga, R.M. and Kimmel, C.B. (1990) Cell movements during epiboly and gastrulation in zebrafish. Development 108, 569–580. [18] Solnica-Krezel, L., Stemple, D.L., Mountcastle-Shah, E., Rangini, Z., Neuhauss, S.C., Malicki, J., et al. (1996) Mutations
S. Yao et al. / FEBS Letters 582 (2008) 2325–2332
[19] [20] [21]
[22]
[23] [24] [25] [26] [27] [28] [29] [30]
[31] [32] [33]
[34]
[35]
affecting cell fates and cellular rearrangements during gastrulation in zebrafish. Development 123, 67–80. Carmany-Rampey, A. and Schier, A.F. (2001) Single-cell internalization during zebrafish gastrulation. Curr. Biol. 11, 1261– 1265. Yamashita, S., Miyagi, C., Carmany-Rampey, A., Shimizu, T., Fujii, R., Schier, A.F., et al. (2002) Stat3 controls cell movements during zebrafish gastrulation. Dev. Cell 2, 363–375. Miyagi, C., Yamashita, S., Ohba, Y., Yoshizaki, H., Matsuda, M. and Hirano, T. (2004) STAT3 noncell-autonomously controls planar cell polarity during zebrafish convergence and extension. J. Cell Biol. 166, 975–981. Yamashita, S., Miyagi, C., Fukada, T., Kagara, N., Che, Y.S. and Hirano, T. (2004) Zinc transporter LIVI controls epithelialmesenchymal transition in zebrafish gastrula organizer. Nature 429, 298–302. Mlodzik, M. (2002) Planar cell polarization: do the same mechanisms regulate Drosophila tissue polarity and vertebrate gastrulation? Trend Genet. 18, 564–571. Seifert, J.R. and Mlodzik, M. (2007) Frizzled/PCP signalling: a conserved mechanism regulating cell polarity and directed motility. Nat. Rev. Genet. 8, 126–138. Narasimha, M. and Leptin, M. (2000) Cell movements during gastrulation: come in and be induced. Trend Cell Biol. 10, 169– 172. Keller, R., Davidson, L.A. and Shook, D.R. (2003) How we are shaped: the biomechanics of gastrulation. Differentiation 71, 171– 205. Myers, D.C., Sepich, D.S. and Solnica-Krezel, L. (2002) Convergence and extension in vertebrate gastrulae: cell movements according to or in search of identity? Trend Genet. 18, 447–455. Wood, A. and Thorogood, P. (1994) Patterns of cell behaviour underlying somitogenesis and notochord formation in intact vertebrate embryos. Dev. Dyn. 201, 151–167. Glickman, N.S., Kimmel, C.B., Jones, M.A. and Adams, R.J. (2003) Shaping the zebrafish notochord. Development 130, 873– 887. Cooke, J. (1979) Cell number in relation to primary pattern formation in the embryo of Xenopus laevis. II. Sequential cell recruitment, and control of the cell cycle, during mesoderm formation. J. Embryol. Exp. Morphol. 53, 269–289. Saka, Y. and Smith, J.C. (2001) Spatial and temporal patterns of cell division during early Xenopus embryogenesis. Dev. Biol. 229, 307–318. Hashiguchi, A., Okabayashi, K. and Asashima, M. (2004) Role of TSC-22 during early embryogenesis in Xenopus laevis. Dev. Growth Differ. 46, 535–544. Murakami, M.S., Moody, S.A., Daar, I.O. and Morrison, D.K. (2004) Morphogenesis during Xenopus gastrulation requires Wee1-mediated inhibition of cell proliferation. Development 131, 571–580. Leise 3rd, W.F. and Mueller, P.R. (2004) Inhibition of the cell cycle is required for convergent extension of the paraxial mesoderm during Xenopus neurulation. Development 131, 1703–1715. Hashiguchi, A., Hitachi, K., Inui, M., Okabayashi, K. and Asashima, M. (2007) TSC-box is essential for the nuclear localization and antiproliferative effect of XTSC-22. Dev. Growth Differ. 49, 197–204.