-β signaling pathway in Streptozocin-induced diabetic mice

Journal of Functional Foods 36 (2017) 341–347

Contents lists available at ScienceDirect

Journal of Functional Foods journal homepage: www.elsevier.com/locate/jff

Polydatin exhibits the hepatoprotective effects through PPAR-a/-b signaling pathway in Streptozocin-induced diabetic mice Lai Xue a, Kun Wu b, Hongmei Qiu a, Bo Huang c, Rongchun Chen a, Wei Xie b, Qingsong Jiang a,⇑ a

Department of Pharmacology, Chongqing Key Laboratory of Biochemistry and Molecular Pharmacology, Chongqing Medical University, Chongqing 400016, China Department of Hepatobiliary Surgery, Chongqing General Hospital, Chongqing 40013, China c Key Laboratory of Basic Pharmacology of Ministry of Education and Joint International Research Laboratory of Ethnomedicine of Ministry of Education, Zunyi Medical University, Guizhou 563003, China b

a r t i c l e

i n f o

Article history: Received 21 November 2016 Received in revised form 5 June 2017 Accepted 6 July 2017

Chemical compounds studied in this article: 3,4,5-Trihydroxystilbene-3-beta-monogluco side (polydatin PubChem CID: 5281718) Keywords: Polydatin Diabetic hepatopathy PPARs Proinflammatory cytokines

a b s t r a c t Polydatin has a wide range of pharmacological activities, yet the underlying effects on diabetic hepatopathy remain unclear. Diabetic model was established by feeding mice a high-energy diet for 4 weeks combined with streptozotocin, then hepatopathy model was confirmed by histopathological observation after another 4 weeks. Polydatin supplementation (50 or 100 mg/kg/day, i.g.) for an additional 4 weeks improved signs of liver damage compared to untreated mice. The protein and mRNA expressions of PPARs were down-regulated, while of NF-jB, iNOS and COX-2 were up-regulated following diabetic hepatic injury, and TNF-a and IL-1b were increased in serum. Polydatin supplementation up-regulated PPARb expression, but elevated PPAR-a only at 100 mg/kg/day, while had no influence on PPAR-c. Polydatin also corrected the above abnormal proinflammatory cytokines levels. In conclusion, polydatin can improve hepatic injury in diabetic mice, which may be due to a reduction of proinflammatory cytokines through the promoted expressions of PPAR-b and -a. Ó 2017 Elsevier Ltd. All rights reserved.

1. Introduction Type 2 diabetes mellitus (T2DM) is usually preceded by insulin resistance, with disordered glucose and lipid levels. The liver, which is the most important organ regulating glucose and lipid metabolism, is closely associated with DM and recent studies have suggested that the prevalence of hepatopathy in obese adults with T2DM is greater than 70% (Petit et al., 2014; Stefan & Häring, 2011). In addition, the abnormal metabolism of glucose and lipids, as well as decreased insulin sensitivity in liver disease may also result in the occurrence and exacerbation of DM (Grundy et al., 2005). Therefore, DM is recognized as an independent risk factor for the development and progression of liver disease, which is also known as diabetic hepatopathy. Such diseases include non-alcoholic fatty Abbreviations: ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; COX-2, cyclooxygenase 2; DM, diabetes mellitus; FBG, fast blood glucose; HE, hematoxylin and eosin; IL-1b, interleukin 1b; iNOS, inducible nitric oxide synthase; NAFLD, non-alcoholic fatty liver disease; NASH, non-alcoholic steatohepatitis; NF-jB, nuclear factor-jB; PPAR, peroxisome proliferator-activated receptor; STZ, streptozotocin; TC, total cholesterol; TG, triglyceride; TNF-a, tumor necrosis factor a. ⇑ Corresponding author. E-mail address: [email protected] (Q. Jiang). http://dx.doi.org/10.1016/j.jff.2017.07.015 1756-4646/Ó 2017 Elsevier Ltd. All rights reserved.

liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), liver cirrhosis and hepatocellular carcinoma (Polimeni et al., 2015). Although many pharmacological targets have been identified, the pathophysiology of diabetic hepatopathy remains to be elucidated and the currently available treatments are not satisfactory. Polydatin, also known as piceid, is the major natural active compound isolated from the root and rhizome of Polygonum cuspidatum Siebold & Zucc., and it has also been detected in grapes, peanuts, hop cones, red wines, hop pellets and cocoa-containing products. Polydatin has been demonstrated to possess extensive medical activities, such as cardiovascular, neuroprotective, antiinflammatory and immunoregulatory effects, and it may be used as an anti-oxidant and anti-tumor agent, as well as for the protection of the liver and lung (Du, Peng, & Zhang, 2013). Furthermore, it shows hepatoprotective effects during multi-organ dysfunction and carbon tetrachloride-induced liver injury (Zeng et al., 2015; Zhang et al., 2012), yet relatively little is known about the functional value of polydatin on hepatic injury associated to DM. Recent evidence has suggested that peroxisome proliferatoractivated receptors (PPARs) are involved in the transcriptional regulation of lipid metabolism, as well as other biological functions (Brown & Plutzky, 2007). Three subtypes of the PPAR family have been identified: a, b and c. PPAR-a is believed to participate in

342

L. Xue et al. / Journal of Functional Foods 36 (2017) 341–347

fatty acid uptake mainly in the liver and heart, while PPAR-b is involved in fatty acid oxidation in muscle. PPAR-c is highly expressed in fat to facilitate glucose and lipid uptake, stimulate glucose oxidation, decrease free fatty acid levels and ameliorate insulin resistance. Synthetic ligands for PPAR-a and -c, such as fibrates and thiazolidinediones, have been used in patients with dyslipidemia and T2DM with insulin resistance, respectively (Jay & Ren, 2007). Although the clinical use of PPAR-b ligands is absent, some research has shown that pharmacological activation of PPARb improves glucose handling and insulin sensitivity (Liu et al., 2011), and prevents or ameliorates liver disease associated to oxidative damage (Coleman et al., 2007). Furthermore, our previous investigations showed that the protective effects of polydatin on endothelial damage and cardiomyocyte hypertrophy under diabetic conditions were related to the activation of PPAR-b (Huang et al., 2015; Wu et al., 2015). However, the underlying mechanisms related to the PPARs remain largely unknown with regards to the hepatoprotective effects of polydatin in DM. It has been extensively demonstrated that inflammation is a major determinant of health complications, and it can be regulated by PPARs targets. PPAR-a, -b and -c exhibit their antiinflammatory effects by inhibiting the production of some proinflammatory cytokines, such as tumor necrosis factor a (TNF-a), interleukins 1 (IL-1), and IL-6, and the decreased expression of cyclooxygenase 2 (COX-2) and inducible nitric oxide synthase (iNOS) by inhibiting nuclear factor jB (NF-jB) signaling both in vitro and in vivo (Monsalve, Pyarasani, Delgado-Lopez, & Moore-Carrasco, 2013). DM is also believed to be related to inflammation, whereby multiple proinflammatory cytokines are released, including TNF-a, IL-1 and IL-6, which promote hepatic injury in DM, which proceeds from NAFLD to NASH (Perumpail, Liu, Wong, Ahmed, & Harrison, 2015). Previously, polydatin has been shown to exhibit prominent protective effects on renal injury and cardiomyocyte hypertrophy in diabetic models, and these protective effects were found to be closely related to polydatin’s inhibition of inflammation (Huang et al., 2015; Xie et al., 2012). However, the role of PPAR-related inflammation and the effects of polydatin on diabetic hepatopathy have not been fully clarified. Based on the above, the present study aimed to investigate the effects of polydatin on hepatic injury resulting from long-term high-energy feeding combined with streptozotocin (STZ)-induced DM mice. In addition, the possible influence of polydatin on the PPARs-related inflammatory signal pathway was studied. 2. Materials and methods 2.1. Chemicals and reagents Ploydatin (C20H22O8; MW: 390.38; purity
95%, HPLC-grade) and STZ were provided by Sigma Aldrich (St Louis, MO, USA). Polydatin was dissolved in 0.5% (w/v) carboxymethylcellulose sodium (CMC-Na) and STZ was dissolved in sterile sodium citrate buffer, pH 4.2–4.4. Radioimmunoprecipitation assay (RIPA) lysis buffer and the bicinchoninic acid (BCA) protein concentration assay kit (enhanced) were purchased from Beyotime (Jiangsu, China). TRIzol, the PrimeScriptTM RT reagent kit with gDNA Eraser and SYBR Green Supermix, as well as primers were from Takara Biotech Co. (Liaoning, China). Anti-PPAR-a, and anti-PPAR-c antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); anti-PPAR-b and anti-COX-2 antibodies were purchased from Cayman (Ann Arbor, MI, USA); anti-inducible nitric oxide synthase (anti-iNOS) and anti-b-actin antibodies were purchased from Abcam (Cambridge, UK); anti-p-NF-jB p65 antibody was purchased from Cell Signaling Technology (MA, USA). Chemiluminescence substrate was purchased from Thermo Fisher Scientific

(Rockford, IL, USA). Total cholesterol (TC), triglyceride (TG) and alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) commercial kits were obtained from Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). TNFa and IL-1b enzyme-linked immunosorbent assay (ELISA) kits were obtained from Shanghai Yuanye Bio Technology Co. Ltd. (Shanghai, China). The gel imaging system, the quantitative polymerase chain reaction (PCR) instrument and the i-mark microplate reader were purchased from Bio-Rad (Hercules, CA, USA). 2.2. Animal model Male Mus musculus castaneus mice (weight 15–20 g, 4–6 weeks old) were supplied by the Animal Laboratory Center of Chongqing Medical University (Chongqing, China). All experiments involving mice were reviewed and approved by the Animal Laboratory Administration Center and Ethics Committee of Chongqing Medical University [SYXK (Chongqing) 2012-0001]. All animals were kept under controlled environmental conditions (12:12 h light and dark cycle, humidity 50%, room temperature 23 ± 1 °C) and mice had free access to food and water during the experimental periods. The mice were fed a high-fat and high-sugar diet (containing 10% sucrose, 10% yolk, 10% axungia, 1.5% cholesterol, 0.5% bile salt and 68% basic forage). After 4 weeks, the mice were given by STZ (40 mg/kg/day for 5 days, i.p.) and fasting blood glucose (FBG) levels were assayed using a One Touch Glucometer (Johnson, USA) after 7 days. Mice with FBG levels above 199.8 mg/dL were considered diabetic (Liu et al., 2010). Diabetic mice continued on the high-energy-diet for 4 weeks. Then, diabetic hepatopathy was confirmed by histopathological observation in six diabetic mice which were randomly selected. The remaining diabetic mice, i.e. diabetic hepatopathy mice, were then randomly assigned to three groups (n = 8 per group): (1) diabetic hepatopathy model (model group); (2) 50 mg/kg/day polydatin i.g. (PDL group); and (3) 100 mg/kg/day polydatin i.g. (PDH group). Normal control mice and diabetic hepatopathy model mice were given an equal volume of 0.5% CMC-Na, and treatment was continued for 4 weeks. The experiment was summarized by the flow chart in Fig. 1. 2.3. Biochemical analysis The FBG level was measured every week after the start of the polydatin treatment. At the end of the experiment, all mice were fasted for 18 h and blood was collected from the retro-orbital venous plexus. Serum was then obtained by centrifugation at 3000g for 15 min and stored at 80 °C. Then, all mice were euthanized after anesthesia with 4% chloral hydrate (1 ml/100 g, i.p.). Liver samples were excised, washed in physiological saline, frozen in liquid nitrogen and then stored at 80 °C. The TC and TG levels were detected using commercial kits, the serum ALT and AST levels were measured by the Reitman–Frankel method and ALP was detected by visible light colorimetry. 2.4. Measurement of TNF-a and IL-1b According to the manufacturer’s instructions, levels of TNF-a and IL-1b in serum were determined using ELISA kits. The optical density values were measured at a wavelength of 450 nm using a microplate reader and then the concentrations of TNF-a and IL1b were calculated by standard curves. 2.5. Histopathological analysis by hematoxylin and eosin (HE) staining The livers were fixed in 4% paraformaldehyde in a centrifuge tube for 6 h and preserved in 70% ethanol. Fixed tissues were dehydrated with a graded series of ethanol to propylene oxide,

L. Xue et al. / Journal of Functional Foods 36 (2017) 341–347

343

Fig. 1. Timeline of the animal experiments.

embedded in paraffin and then 3–5 lm thick sections of paraffinembedded tissues were stained with H.E. The histopathological changes were examined under light microscopy at a magnification 200. 2.6. Analysis of mRNA via real-time quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver homogenates using TRIzol reagent, quantified by ultraviolet spectrometric detection and reverse transcribed into cDNA using a PrimeScriptTM RT reagent kit with gDNA Eraser, according to the manufacturer’s instructions. qRT-PCR was performed according to the protocol of SYBRÒ Premix Ex TaqTM II. The primers used for the qRT-PCR were shown in Table 1. The cycle parameters were 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The housekeeping gene b-actin was used for internal normalization. The results of three independent experiments were used for statistical analysis by the DDCt (Ct = cycle threshold) method: relative expression = 2DDCt, DDCt = DCt (text samples)  DCt (standard samples), DCt = Ct (target gene)  Ct (b-actin). 2.7. Western blotting analysis of proteins The concentrations of the isolated proteins from the liver tissues were detected using an enhanced BCA protein assay kit. Equal amounts of isolated protein samples were separated by 10% (v/v) sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. The blots were probed with rabbit polyclonal antibodies [PPAR-a (1:500 dilution), PPAR-b (1:300 dilution) or iNOS (1:1000 dilution)], rabbit monoclonal antibodies [NF-jB p65 (1:500 dilution) or COX-2 (1:1000 dilution)] or mouse monoclonal antibody [PPAR-c (1:500 dilution)], b-actin (1:1000 dilution) and then with the corresponding peroxidase-conjugated secondary antibodies (1:3000 dilution) for 1 h and visualized using a chemiluminescence substrate. The intensities of the protein bands were assessed using a quantitative imaging system. All Western blot experiments were repeated three times. 2.8. Statistical analysis Results were expressed as the mean ± S.E. and the data were assessed by SPSS 20.0 and Graph Pad Prism 5.0 software. Statistical Table 1 Primer sequences for real-time quantitative RT-PCR. Name

Forward primer (50 –30 )

Reverse primer (30 –50 )

PPAR-a PPAR-b PPAR-c NF-jB p65 iNOS COX-2 b-actin

GTGCCTGTCTGTCGGGATGT GCTCACAGGCAGAGTTGCTA GAACGTGAAGCCCATCGAGG GGAGACAGCCCACTGCTATC CAGATCGAGCCCTGGAAGAC TGCTGGTGGAAAAACCTCGT CCACCATGTACCCAGGCATT

TCTTCAGGTAGGCTTCGTGGAT AGCCACTTGAAGCAGCAGAT TGGAGCACCTTGGCGAACA ATGGACTGTCAGGGCTTTGG CTGGTCCATGCAGACAACCT GGTGCTCGGCTTCCAGTATT AGGGTGTAAAACGCAGCTCA

differences were determined using one-way analysis of variance (ANOVA) and P < 0.05 was considered to be statistically significant.

3. Results 3.1. Effects of polydatin on diabetic hepatopathy mice After 7 days of treatment with STZ, the FBG level of mice significantly increased to (369.54 ± 23.4) mg/dL and remained at this level until the end of the experiment (P < 0.01; Table 2), which suggested DM was established in mice. After 4 weeks, diabetic hepatic injury was observed as hepatic fat accumulation with the infiltration of several inflammatory cells by histopathological observation (Fig. 2B). At the end of the experiment (i.e., after another 4 weeks), the structure of the hepatic lobules was obviously destroyed, the dividing lines between the hepatic lobules were dim and the hepatic cord in the liver was disordered. Hepatocytes containing abundant fat vacuoles were swollen and filtrated by inflammatory cells (Fig. 2C). TC, TG, ALT, AST and ALP levels in serum were significantly elevated in diabetic mice (P < 0.01; Table 3). Polydatin treatment at 50 or 100 mg/kg/d reduced the FBG level until the end of the experiment (P < 0.01), but it was still far higher than the normal level (Table 2). Polydatin treatment also markedly decreased the TC, TG, ALT, AST and ALP levels compared with model mice (P < 0.01), but they were still increase compared with the normal mice (P < 0.01; Table 3). Polydatin supplementation also ameliorated hepatic pathological damage (Fig. 2D and E). In this regard, the degree of disorder in the hepatic lobules and hepatic cord was relieved, the number of fat vacuoles was decreased and the hepatocytes were less swollen. 3.2. Effect of polydatin on PPARs mRNA and protein expression in the livers of diabetic hepatopathy mice Both the mRNA and protein expressions of the PPARs were down-regulated following the induction of diabetic hepatopathy (P < 0.05; Fig. 3), whereby the mRNA and protein expressions of PPAR-a, -b and -c were decreased by 64.3% and 54.3%, 73.0% and 50.3%, and 26.0% and 20.7%, respectively, in diabetic mice (P < 0.05). Treatment with polydatin for 4 weeks significantly upregulated the mRNA and protein levels of PPAR-b in the PDL and PDH groups (P < 0.01), and the levels of PPAR-a were elevated only in the PDH group (P < 0.05). However, polydatin had no significant effect on the expression of PPAR-c (P > 0.05). 3.3. Effect of polydatin on the mRNA and protein expressions of NF-jB p65, COX-2 and iNOS in the livers of diabetic hepatopathy mice The mRNA and protein expressions of NF-jB p65 (Fig. 4A and D), COX-2 (Fig. 4B and E) and iNOS (Fig. 4C and F) in diabetic hepatopathy mice were higher than in control mice to 3.62 and 2.22 times, 2.07 and 1.89 times, and 1.68 and 1.55 times, respectively (P < 0.01). Treatment with polydatin visibly decreased the expres-

344

L. Xue et al. / Journal of Functional Foods 36 (2017) 341–347

Table 2 Effect of polydatin on fasting blood glucose (FBG) level in diabetic mice (mg/dL) (mean ± S.E., n = 8). Group

Before STZ

STZ for 7 days

Control Model PDL PDH

92.7 ± 5.4 93.6 ± 4.5 93.6 ± 4.0 93.6 ± 4.5

91.8 ± 5.9 369.5 ± 23.4aa 369.5 ± 20.1aa 369.5 ± 23.4aa

Polydatin administration 1w

2w

3w

4w

83.5 ± 6.1 407.3 ± 41.4aa 381.8 ± 21.8aa 369.2 ± 35.8aa

71.8 ± 9.2 400.7 ± 38.7aa 366.3 ± 23.8aa 350.6 ± 21.1aab

84.8 ± 7.0 425.5 ± 26.6aa 357.1 ± 16.6aabb 342.7 ± 27.4aabb

85.3 ± 10.5 425.3 ± 31.9aa 360.5 ± 28.1aa,bb 326.5 ± 18.7aabb

STZ: streptozotocin; Control: normal mice; Model: diabetic hepatopathy mice; PDL/PDH: polydatin at doses of 50 or 100 mg/kg/d i.g. was given for 4 weeks in diabetic hepatopathy mice. aa P < 0.01 vs control. b P < 0.05. bb P < 0.01 vs model.

Fig. 2. Effect of polydatin on hepatic histopathology in diabetic hepatopathy mice (H.E. staining, 200). A: normal control group (showed normal morphological structure of liver); B: hepatic injury was appearance after the onset of DM for 4 weeks (hepatic fat vacuoles and swollen hepatocytes are indicated by arrows); C: hepatic injury for 4 weeks (swollen hepatocytes with inflammatory cell infiltration and abundant fat vacuoles are indicated by arrows, the structure of the hepatic lobules was destroyed); D: polydatin at 50 mg/kg/day for 4 weeks after hepatic injury (compared with panel C, fat vacuoles were decreased and inflammatory cell infiltration was alleviated, as indicated by arrows); E: polydatin at 100 mg/kg/day for 4 weeks after hepatic injury (compared with panel C, the degree of disorder in the hepatic lobules and hepatic cord was relieved, the number of fat vacuoles was decreased and the hepatocytes were less swollen).

Table 3 Effect of polydatin on TC, TG, ALT, AST and ALP levels (mean ± S.E., n = 8). Group

TC (mg/dL)

TG (mg/dL)

ALT (U/L)

AST (U/L)

ALP (U/L)

Control Model PDL PDH

3.31 ± 0.15 13.94 ± 1.19aa 11.33 ± 1.45aab 10.13 ± 1.03aabb

1.60 ± 0.18 4.27 ± 0.27aa 3.60 ± 0.18aab 3.06 ± 0.20aabb

39.55 ± 4.77 74.87 ± 9.37aa 53.94 ± 7.35aab 44.91 ± 10.12 aabb

41.31 ± 3.85 86.63 ± 4.71aa 65.46 ± 2.61 aabb 58.75 ± 3.28 aabb

0.87 ± 0.15 2.99 ± 0.41aa 1.97 ± 0.16 aabb 1.75 ± 0.32 aabb

TC: total cholesterol; TG: triglyceride; ALT: alanine aminotransferase; AST: aspartate aminotransferase; ALP: alkaline phosphatase; Control: normal mice; Model: diabetic hepatopathy mice; PDL/PDH: polydatin at doses of 50 or 100 mg/kg/d i.g. was given for 4 weeks in diabetic hepatopathy mice. aa P < 0.01 vs control. b P < 0.05. bb P < 0.01 vs model.

sion of both mRNA and protein in a dose-dependent manner (P < 0.01).

the induction of DM in mice. However, polydatin administration obviously decreased TNF-a and IL-1b levels in a dose-dependent manner compared to diabetic hepatopathy model mice (P < 0.05).

3.4. Effect of polydatin on TNF-a and IL-1b levels in the serum of diabetic hepatopathy mice

4. Discussion

The serum TNF-a and IL-1b levels were significantly increased by 67.86% and 91.89%, respectively (P < 0.01; Fig. 5), following

In addition to the well-known complications of DM, such as nephropathy, neuropathy and retinopathy, diabetic hepatopathy

L. Xue et al. / Journal of Functional Foods 36 (2017) 341–347

345

Fig. 3. Effect of polydatin on PPAR-a, -b and -c mRNA and protein expression in the livers of diabetic hepatopathy mice. Compared with the control group, the mRNA and protein expressions of PPAR-a (A, D), PPAR-b (B, E) and PPAR-c (C, F) were reduced in diabetic hepatopathy mice. Treatment with polydatin for 4 weeks significantly upregulated the levels of PPAR-b in the PDL and PDH groups, but elevated of PPAR-a only in the PDH group, and had no influence on PPAR-c expression (mean ± S.E., n = 3). a P < 0.05, aaP < 0.01 vs control; bP < 0.05, bbP < 0.01 vs model.

occurs frequently and is often ignored in diabetic patients. NAFLD is widely accepted as a ‘benign’ adaptation to lipid loading in the liver, characterized by the excessive accumulation of lipids within hepatocytes. In some cases, NAFLD may progress from steatosis to steatohepatitis (with evidence of inflammation and cell injury), cirrhosis (hepatic fibrosis) and, ultimately, liver failure (Bhatt & Smith, 2015). In the present study, long-term high-energy feeding combined with STZ resulted in hepatic histological changes, for example, hepatic fat accumulation with the infiltration of several inflammatory cells were noted 4 weeks after the diabetic model was established, which suggested the diabetic hepatopathy model (from NAFLD to NASH) was constructed successfully. At the end of the experiment, fat vacuoles were abundant in hepatocytes with extensive inflammatory cells infiltration. Polydatin is a monocrystalline component, which is widely existed in the natural plant and our daily diet. A great number of pharmacological investigations have demonstrated that polydatin has favorable therapeutic properties, including its action as an anti-diabetic and its hepatoprotective effects (Pace et al., 2015). However, the effect of polydatin on diabetic hepatopathy has not been reported. In this study, polydatin administration had a beneficial effect on DM-associated liver injury, which was confirmed by the decreased levels of ALT, AST and ALP, and the improved hepatocytic histopathology. Although polydatin did decrease the abnormally elevated levels of the FBG, TC and TG in diabetic mice, the levels were still far higher than levels in normal mice, which suggested that the improved blood glucose and lipids induced by poly-

datin may not be the main mechanisms of hepatoprotection in the established model. Some investigators have suggested that DM may lead to the release of multiple pro-inflammatory agents, including TNF-a, IL1 and IL-6, which promote the development of inflammation and hepatic steatosis within the liver, leading to liver disease (Perumpail et al., 2015). Consistent with this, the present study found that the levels of TNF-a and IL-1b were increased in the serum, and this finding was accompanied by the hepatic infiltration of inflammatory cells in diabetic mice. This suggested that inflammation-related mechanisms may be involved in the pathogenesis of diabetic hepatopathy aside from pathoglycemia and dislipidemia. A series of studies have demonstrated that polydatin has an effect on the inflammatory response and oxidative stress (Du et al., 2013; Li et al., 2014; Lou, Jiang, Xu, Chen, & Fu, 2015). In this study, the abnormal elevation of TNF-a and IL-1b levels in diabetic mice was relieved by polydatin treatment. Simultaneously, polydatin also lessened the infiltration of inflammatory cells in the livers of diabetic mice. These results indicated that the antiinflammatory properties of polydatin may be responsible for its hepatoprotective effects in diabetic mice. The PPARs are ligand-activated transcription factors belonging to the nuclear receptor superfamily, which modulate several biological processes that are perturbed by obesity, including inflammation, lipid and glucose metabolisms and overall energy homeostasis (Gross, Pawlak, Lefebvre, & Staels, 2017). They are, therefore, important targets for metabolic syndrome, DM, dyslipi-

346

L. Xue et al. / Journal of Functional Foods 36 (2017) 341–347

Fig. 4. Effect of polydatin on NF-jB p65, COX-2 and iNOS mRNA and protein expression in the livers of diabetic hepatopathy mice. Treatment with polydatin down-regulated the increased mRNA and protein expressions of NF-jB p65 (A, D), COX-2 (B, E) and iNOS (C, F) induced by diabetic hepatic injury (mean ± SE, n = 3). aP < 0.05, aaP < 0.01 vs control; bP < 0.05, bbP < 0.01 vs model.

Fig. 5. Effect of polydatin on the levels of TNF-a and IL-1b in the serum of diabetic hepatopathy mice. The concentrations of TNF-a and IL-1b were significantly increased in diabetic hepatopathy mice, but were decreased by polydatin (50 and 100 mg/kg/day) (mean ± S.E., n = 8). aaP < 0.01 vs control; bP < 0.05, bbP < 0.01 vs model.

demia, inflammation, atheromatosis and neoplasias. Because of their pleiotropic effects, they have been identified as active in a number of diseases and are targets for the development of a broad range of therapies for a variety of diseases (Usuda & Kanda, 2014). PPARs play crucial role in the regulation of the systemic inflammatory response. Whereby activated PPARs, including PPAR-a, -b and -c, inhibit the activation of transcription factors, such as NF-jB signal transducers, and subsequently attenuate the formation of chemokines, cytokines and adhesion molecules. Consequently, these receptors exert an anti-inflammatory effect and ameliorate tissue damage (Kamei et al., 1996). Our results showed that the mRNA and protein expressions of PPAR-a, -b and -c declined following the onset of DM, while the mRNA and protein levels of NF-jB increased, indicating that the PPARs-NF-jB signaling pathway was involved in the pathophysiological process of diabetic hepatopathy. Our previous study also showed that polydatin restored impaired endothelium-dependent relaxation induced by

high glucose through the activation of PPAR-b (Wu et al., 2015). In this study, treatment with 50 mg/kg/day polydatin significantly up-regulated the mRNA and protein expression levels of PPAR-b and this effect was more pronounced when the dose was increased to 100 mg/kg/day. At this higher dose, the expression levels of PPAR-a were also up-regulated. However, treatment with either dose of polydatin had little effect on PPAR-c. The differences with regards to the effects of polydatin on the PPARs were consistent with the receptor binding characteristics of polydatin, which were assessed by radioligand binding competition assays and transactivation reporter gene assays in the previous investigation in our laboratory (Li, 2008). Based on these results, the regulation of PPAR-b may be more important than of PPAR-a or PPAR-c on the effect of polydatin. However, more investigations are still necessary for certain confirmation. In addition, polydatin reduced NF-jB expression in a concentration-dependent manner. Taken together, these results suggested that the anti-inflammatory effect

L. Xue et al. / Journal of Functional Foods 36 (2017) 341–347

of polydatin in diabetic hepatopathy may occur through the activation of PPAR-a and -b, and the subsequent deactivation of NF-jB. NF-jB activation leads to the regulation of many genes, including pro-inflammatory cytokines [e.g. IL-1, IL-2, IL-6, IL-12, TNF-a, lymphotoxin a (LT-a), LT-b and granulocyte-macrophage colonystimulating factor (GM-CSF)], inducible effectors enzymes (e.g. iNOS and COX-2), chemokines, adhesion molecules and acute phase proteins, which further amplify and perpetuate the inflammatory response (Ghosh & Karin, 2002). As the most important downstream factors of NF-jB, the expression of iNOS and COX-2 can be induced by several pro-inflammatory cytokines, such as IL-1b and TNF-a (Akarasereenont, Bakhle, Thiemermann, & Vane, 1995). In this study, along with the elevation of NF-jB expression at the mRNA and protein levels, the levels of IL-1b and TNF-a in serum also increased, as did the mRNA and protein expression levels of iNOS and COX-2 in diabetic mice, which suggested that iNOS and COX-2 were also involved in the progression of the inflammatory injury of diabetic hepatopathy. However, polydatin down-regulated the expressions of NF-jB, iNOS and COX-2, and decreased the concentrations of IL-1b and TNF-a, which accordingly ameliorated the inflammatory response in the diabetic liver. Similar results have previously been reported with regards to the nephroprotective effects of polydatin against ischemia/reperfusion injury (Liu, Meng, Huang, Wang, & Liu, 2015) and in lipopolysaccharide-stimulated RAW264.7 cells (Lou et al., 2015). These findings provide the first evidence demonstrating that polydatin exhibits prominent hepatoprotective effects in diabetic mice by attenuating the inflammatory response associated with the NFjB signaling pathway. 5. Conclusion The results of the present study showed that polydatin can improve hepatic injury in diabetic mice model. The mechanistic studies revealed that polydatin acts via activation of the PPAR-a and -b signaling pathway, which may, at least partly, reduce the transcriptional activity of NF-jB, inhibit the production of cytokines, such as IL-1b and TNF-a, and decrease the expressions of iNOS and COX-2. In other words, the hepatoprotective effect of polydatin in DM may result from its anti-inflammatory effect induced by the activation of PPAR-a and -b, especially of PPAR-b. We believe that our findings will stimulate further interest in polydatin as a potential therapeutic drug against DM-associated liver disease. However, many of the aforementioned effects of polydatin require further confirmation and validation in humans. Conflict of interest The authors declare no competing financial interest. Acknowledgment This work was supported by the Science and Technology Program of Yuzhong District, Chongqing, China (grant number 20160127 and 20160130). References Akarasereenont, P., Bakhle, Y. S., Thiemermann, C., & Vane, J. R. (1995). Cytokinemediated induction of cyclo-oxygenase-2 by activation of tyrosine kinase in bovine endothelial cells stimulated by bacterial lipopolysaccharide. British Journal of Pharmacology, 115(3), 401–408. Bhatt, H. B., & Smith, R. J. (2015). Fatty liver disease in diabetes mellitus. Hepatobiliary Surgery and Nutrition, 4(2), 101–108. Brown, J. D., & Plutzky, J. (2007). Peroxisome proliferator-activated receptors as transcriptional nodal points and therapeutic targets. Circulation, 115(4), 518–533.

347

Coleman, J. D., Prabhu, K. S., Thompson, J. T., Reddy, P. S., Peters, J. M., Peterson, B. R., ... Vanden Heuvel, J. P. (2007). The oxidative stress mediator 4-hydroxynonenal is an intracellular agonist of the nuclear receptor peroxisome proliferatoractivated receptor-beta/delta (PPAR beta/delta). Free Radical Biology & Medcine, 42(8), 1155–1164. Du, Q. H., Peng, C., & Zhang, H. (2013). Polydatin: A review of pharmacology and pharmacokinetics. Pharmaceutical Biology, 51(11), 1347–1354. Ghosh, S., & Karin, M. (2002). Missing pieces in the NF-kappaB puzzle. Cell, 109 (Suppl), S81–S96. Gross, B., Pawlak, M., Lefebvre, P., & Staels, B. (2017). PPARs in obesity-induced T2DM, dyslipidaemia and NAFLD. Nature Reviews Endocrinology, 13(1), 36–49. Grundy, S. M., Cleeman, J. I., Daniels, S. R., Donato, K. A., Eckel, R. H., Franklin, B. A., ... Costa, Fernando. (2005). Diagnosis and management of the metabolic syndrome: An American Heart Association/National Heart, Lung, and Blood Institute scientific statement: Executive Summary. Critical Pathways in Cardiology, 4(4), 198–203. Huang, B., Jiang, F., Xue, L., Wu, Y., Du, W. M., Qiu, H. M., & Jiang, Q. S. (2015). PPAR b-related signal pathway involves in the effect of polydatin on high glucoseand insulin-induced cardiomyocyte hypertrophy] [Article in Chinese. Chinese Pharmacological Bulletin, 31(9), 1264–1269. Jay, M. A., & Ren, J. (2007). Peroxisome proliferator-activated receptor (PPAR) in metabolic syndrome and type 2 diabetes mellitus. Current Diabetes Reviews, 3 (1), 33–39. Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., ... Rosenfeld, M. G. (1996). A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell, 85(3), 403–414. Li, C. Q. (2008). [Establishment and Application of a screening platform for hPPARs natural ligands] [Article in Chinese]. Chongqing Medical University, Chongqing, China. Available: . Li, T., Cai, S., Zeng, Z., Zhang, J., Gao, Y., Wang, X., & Chen, Z. (2014). Protective effect of polydatin against burn-induced lung injury in rats. Respiratory Care, 59(9), 1412–1421. Liu, S., Hatano, B., Zhao, M., Yen, C. C., Kang, K., Reilly, S. M., ... Lee, C. H. (2011). Role of peroxisome proliferator-activated receptor delta}/{beta in hepatic metabolic regulation. Journal of Biological Chemistry, 286(2), 1237–1347. Liu, H. B., Meng, Q. H., Huang, C., Wang, J. B., & Liu, X. W. (2015). Nephroprotective effects of polydatin against ischemia/reperfusion injury: A role for the PI3K/Akt signal pathway. Oxidative Medicine and Cell Longevity, 2015, 362158. http://dx. doi.org/10.1155/2015/362158. Liu, W., Zhang, X., Liu, P., Shen, X., Lan, T., Li, W., ... Huang, H. (2010). Effects of berberine on matrix accumulation and NF-kappa B signal pathway in alloxaninduced diabetic mice with renal injury. European Journal of Pharmacology, 638 (1–3), 150–155. Lou, T., Jiang, W., Xu, D., Chen, T., & Fu, Y. (2015). Inhibitory effects of polydatin on lipopolysaccharide-stimulated RAW 264.7 Cells. Inflammation, 38(3), 1213–1220. Monsalve, F. A., Pyarasani, R. D., Delgado-Lopez, F., & Moore-Carrasco, R. (2013). Peroxisome proliferator-activated receptor targets for the treatment of metabolic diseases. Mediators of Inflammation, 2013, 549627. http://dx.doi.org/ 10.1155/2013/549627. Pace, M. C., Passavanti, M. B., Aurilio, C., Sansone, P., Aurilio, R., Maria S, D. E., Lama, S., Federico, A., Ravagnan, G., Caraglia, M., & Stiuso, P. (2015). Polydatin administration improves serum biochemical parameters and oxidative stress markers during chronic alcoholism: A pilot study. Vivo, 29(3), 405–408. Perumpail, R. B., Liu, A., Wong, R. J., Ahmed, A., & Harrison, S. A. (2015). Pathogenesis of hepatocarcinogenesis in non-cirrhotic nonalcoholic fatty liver disease: Potential mechanistic pathways. World Journal of Hepatology, 7(22), 2384–2388. Petit, J. M., Hamza, S., Rollot, F., Sigonney, V., Crevisy, E., Duvillard, L., ... Hillon, P. (2014). Impact of liver disease severity and etiology on the occurrence of diabetes mellitus in patients with liver cirrhosis. Acta Diabetologica, 51(3), 455–460. Polimeni, L., Del Ben, M., Baratta, F., Perri, L., Albanese, F., Pastori, D., ... Angelico, F. (2015). Oxidative stress: New insights on the association of non-alcoholic fatty liver disease and atherosclerosis. World Journal of Hepatology, 7(10), 1325–1336. Stefan, N., & Häring, H. U. (2011). The metabolically benign and malignant fatty liver. Diabetes, 60(8), 2011–2017. Usuda, D., & Kanda, T. (2014). Peroxisome proliferator-activated receptors for hypertension. World Journal of Cardiology, 6(8), 744–754. Wu, Y., Xue, L., Du, W., Huang, B., Tang, C., Liu, C., ... Jiang, Q. (2015). Polydatin restores endothelium-dependent relaxation in rat aorta rings impaired by high glucose: A novel insight into the PPARb-NO signaling pathway. PLoS ONE, 10(e0126249), 2015. http://dx.doi.org/10.1371/journal.pone.0126249. eCollection. Xie, X., Peng, J., Huang, K., Huang, J., Shen, X., Liu, P., & Huang, H. (2012). Polydatin ameliorates experimental diabetes-induced fibronectin through inhibiting the activation of NF-jB signaling pathway in rat glomerular mesangial cells. Molecular and Cellular Endocrinology, 362(1–2), 183–193. Zeng, Z., Chen, Z., Li, T., Zhang, J., Gao, Y., Xu, S., ... Zhao, K. S. (2015). Polydatin: A new therapeutic agent against multiorgan dysfunction. Journal of Surgical Research, 198(1), 192–199. Zhang, H., Yu, C. H., Jiang, Y. P., Peng, C., He, K., Tang, J. Y., & Xin, H. L. (2012). Protective effects of polydatin from Polygonum cuspidatum against carbon tetrachloride-induced liver injury in mice. PLoS ONE, 7, e46574. http://dx.doi. org/10.1371/journal.pone.0046574pone.0046574.