- Email: [email protected]
Polymerase chain reaction for identification of herpes simplex virus (HSV-1), cytomegalovirus (CMV) and human herpes virus-type 6 (HHV-6) in oral swabs
ARTICLE IN PRESS Microbiological Research 160 (2005) 61—65
www.elsevier.de/micres
Polymerase chain reaction for identification of herpes simplex virus (HSV-1), cytomegalovirus (CMV) and human herpes virus-type 6 (HHV-6) in oral swabs Ju `nia Maria Netto Victo ´riaa, Andre ´ Luiz Sena Guimara ˜esa, Luciano Marques da Silvaa,, Evanguedes Kalapothakisb, Ricardo Santiago Gomeza, a
Department of Oral Surgery and Pathology, School of Dentistry, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, CEP 31270 901 Belo Horizonte-MG, Brazil b Department of Pharmacology, Instituto de Cie ˆncias Biolo ´gicas, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil Accepted 24 September 2004
KEYWORDS Herpes simplex virus; Cytomegalovirus; Human herpes virus 6; Polymerase chain reaction; Oral swabs
Summary Considering that sensitive and specific methods to detect HSV-1, CMV and HHV-6 on oral mucosa have a great impact on oral diagnosis practice and research, together with the evidence that PCR is a rapid and reliable method, the purpose of the present study was to develop primer sets to detect HSV-1, CMV and HHV-6 in oral swabs by nested polymerase chain reaction (nested PCR). We developed a practical method for sample collection without tissue trauma, and the swabs were stored until used for DNA extraction. After the nested PCR a DNA fragment of 241 bp corresponding to HSV-1 was amplified. DNA fragments of 224 and 369 bp were amplified corresponding to CMV and HHV-6, respectively. DNA sequencing analysis confirmed the expected sequences of each virus. In conclusion, it was demonstrated that these new primer sets are able to identify HSV-1, CMV and HHV-6 in oral swab using nested PCR. & 2004 Elsevier GmbH. All rights reserved.
Corresponding author.
E-mail address: [email protected] (R.S. Gomez). 0944-5013/$ - see front matter & 2004 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2004.09.011
ARTICLE IN PRESS 62
Introduction Infections by herpes simplex virus (HSV-1), cytomegalovirus (CMV) and human herpes virus-type 6 (HHV-6) have been associated with many different oral lesions (Langford et al., 1990; Ghodratnama et al., 1999; Brice et al., 2000). Rapid, specific and sensitive methods to identify such agents are important not only in oral diagnosis practice, but also in the investigation of the pathogenesis of some oral diseases. Nested polymerase chain reaction (PCR) is the ideal technique for the detection of virus, bacterial and fungal species (Ghodratnama et al., 1999; Khan and Mustafa, 2001). Several methods, Western and Northern blotting, immunological assays, viral cultures and oral smears, have been studied or used in oral medicine (Sun and Chiang, 1996; Scott et al., 1997; Yadav et al., 1997). HSV-1 belongs to the Herpesviridae family, genus simplexvirus and contains a 152,000 bp doublestranded DNA genome (Roizman, 1996). Latent HSV1 has been detected in 50% of individuals, principally resident in trigeminal ganglia (Roizman and Sears, 1990). HSV-1 DNA has also been detected in human spiral ganglia, in skin specimens taken from the healed sites of recurrent cutaneous HSV infections and in blood and bone marrow cells (Cantin et al., 1994). HSV-1 in saliva has been considered to play an important role in HSV horizontal transmission (Tateishi et al., 1994). Previous studies have demonstrated that recurrent oral herpes infection has an important impact on bone marrow transplantation survival (Gomez et al., 2001). CMV is a frequent cause of asymptomatic infection in humans; the virus is transmitted during birth via contact with CMV-positive vaginal secretions, via saliva in young children, via contaminated blood transfusion or transplanted organs and sexual transmission (Ho, 1991). CMV has been related to chronic graft versus host disease and bone marrow transplantation mortality (Broers et al., 2000). Intraoral CMV ulceration has been reported in immunocompromised and HIV-infected patients and apparently immunocompetent adults (Glick et al., 1991; Schubert et al., 1993). Human herpes virus 6 (HHV-6), a herpesvirus first discovered in 1986, is commonly isolated from saliva (Salahuddin et al., 1986). The virus has also been reported to infect a wide variety of cells types (Ablashi et al., 1992) and is frequently detected and reactivated in epithelial tumours of the oral cavity (Yadav et al., 1994). Considering that sensitive and specific methods to detect HSV-1, CMV and HHV-6 on oral mucosa
J.M.N. Victo ´ria et al. have a great impact on oral diagnosis practice and research, together with the evidence that PCR is a rapid and reliable method, the purpose of the present study was to develop primer sets of to detect HSV-1, CMV and HHV-6 in oral swabs.
Material and methods Sample collection Thirty healthy volunteers attending at the Dental Clinics and 15 subjects submitted to bone marrow transplantation were included in the study. The study protocol was approved by local Ethical Committee and informed consent was obtained from all patients. Sterile plastic sticks were used to perform the oral swabs. After been immediately suspended in 250 ml Krebs–Ringer solution (in mM): NaCl (118.4), KCl (4.7), KH2PO4 (1.2), MgSO4 7H2O (1.2), CaCl2 2H2O (2.5), NaHCO3 (25,0) and glucose (11.7), the swabs were stored at 4–10 1C for 48 h or at 20 1C until the solution was used for DNA extraction. After centrifugation of the samples at 10,000 g for 10 min, the sediments were submitted to DNA extraction. Recurrent oral herpes lesion in bone marrow transplantation patient was used as positive control for HSV-1. CMV-DNA was taken from new-born contaminated urine and HHV-6 material used in this study was taken from American Tissue Culture Collection (ATCC). DNA sequencing from control and patients was carried out as described below.
DNA isolation DNA extraction was carried out as described by Boom et al. (1990) and modified as follows: 450 ml lysis buffer (6.0 M Gunidinium-SCN, 0.1 M Tris-Cl, 0.2 M EDTA, 10% TritonX-100) and 20 ml silica (SiO2, Sigma S5631, washed with H2O, pH 2.5, corrected with HCl) in the pellet. The tubes were mixed for 10 s, incubated for 10 min at 56 1C, centrifuged for 1 min and the supernatant was discarded. The pellet was washed twice with 450 ml washing buffer (6.0 M Guanidinium-SCN, 0.1 M Tris-Cl), twice with 70% ethanol and once with 450 ml acetone. After these steps the pellet was dried at 56 1C for 10 min or until the silica became completely dry. Finally, 100 ml TE buffer (10 mM Tris-Cl pH 8.0, 1.0 mM EDTA) was added and incubated at 56 1C for a minimum of 10 min and maximum of 24 h. The solution containing the silica and DNA was mixed for 5 s, centrifuged for 2 min and the supernatant was carefully transferred to new tube. The
ARTICLE IN PRESS Polymerase chain reaction for identification of HSV-1, CMV and HHV-6 in oral swabs manipulation was carried out using a PCR-hood to avoid contamination. Alternatively, DNA was purified using proteinase K and phenol as described by Herrmann and Frischauf (1987).
HSV-1, CMV and HHV-6 primers and PCR reaction The DNA sequence used in the present work was obtained from National Center for Biotechnology Information. The MacVector program was used to construct and analyse the primers. Primers were selected according to annealing temperature and size of PCR products. Two sets of primers were used for each virus characterizing a typical reaction of nested PCR (Table 1). The PCR was performed according to standard techniques (Saiki et al., 1985). Two microliter DNA solution were subjected to PCR using outer primers. PCR was carried out in a 50 ml mixture containing Taq DNA polymerase (1 unit/reaction), PCR buffer (50 mM KCl, 10 mM TrisCl pH 8.4, 1.5 mM MgCl2), 0.1 mM deoxynucleoside triphosphates, and 10 pmol/reaction primers. All samples were amplified using a DNA thermal cycler (PTC—Programmable Thermal Controller). After PCR, 2 ml of the final product were transferred to the reaction mixture of the second PCR and reamplified with the inner pair of primers. Positive (see sample collection) and negative (PCR reagents without DNA) controls were routinely included. Table 1.
DNA purified from Varicella zoster virus and Epstein-Barr obtained from the American Tissue Culture Collection (ATCC VR-586 and ATCC VR-602) was used as negative control.
Agarose gel eletrophoresis Ten microliter of each reaction product were added to 2 ml gel loading dye (0.25% bromophenol blue, 30% glycerol, 10 mM EDTA), loaded on 1.5% agarose gels and electrophoresis carried out in 1 TAE buffer. DNA fragments were visualized after staining with 0.5 mg/ml ethidium bromide by the photodocumentation system BIO-RAD GEL-DOC 1000. The molecular weight of the DNA was estimated using l Hind III DNA and 100 bp ladder markers.
DNA sequencing and computer analysis DNA sequencing reactions were performed on both strands using the chain termination method of Sanger et al. (1977). All reactions were carried out on the DNA Sequencer ABI PRISM 310 Genetic Analyzer (PE Biosystems) and the BigDye terminator kit. Nucleic acid sequences were analysed using the MacVectorTM 5.0 program (Oxford Molecular Group PLC). After editing, the sequences were compared to sequences in the GenBanK databases (Altschul et al., 1990).
Primers and PCR conditions
Virus
Primer pair
PCR program
HSV-1
Outer primers F: 50 TGC TGG AGG ATC ACG AGT TTG 30 R: 50 CAT CGT CTT TGT TGG GAA CTT 30
95 1C/30 s 61 1C/45 s 72 1C/30 s
30 cycles
Inner primers F: 50 TGCAGAGCAACCCCATGAAG 30 R: 50 ATGACCATGTCGGTGACCTTGG 30
95 1C/30 s 60 1C/45 s 72 1C/30 s
30 cycles
Outer primers F: 50 ACATGGAATCCAGGATCTGGTGCC 30 R: 50 CCCTATGATATGCCACGAAAACCG 30
95 1C/30 s 58 1C/45 s 72 1C/30 s
30 cycles
Inner primers F: 50 CAACACGTAACGTCTTCTGAAGCC 30 R: 50 TAGACCACCATGATGCCCTCATCC 30
95 1C/30 s 57 1C/45 s 72 1C/30 s
30 cycles
Outer primers F: 50 CGCAGAGACATATCGTTCCGATGG 30 R: 50 AGAACCGTCGCATCAATTACTCGC 30
95 1C/30 s 56 1C/45 s 72 1C/30 s
30 cycles
Inner primers F: 50 AATAGGAGCCTTGCTGGTCAGAAC 30 R: 50 CCTGGAACCCCACAAAACCTAACG 30
95 1C/30 s 55 1C/45 s 72 1C/30 s
30 cycles
CMV
HHV-6
63
Product size 663 bp
241 bp
612 bp
224 bp
814 bp
369 bp
ARTICLE IN PRESS 64
J.M.N. Victo ´ria et al.
Results Figure 1 shows representative results following agarose gel electrophoresis of PCR products obtained from the samples. After the first round a DNA fragment of 663 bp was amplified to confirm the expected size of the product, and the second round generated a fragment of 241 bp corresponding to the gene of HSV-1. DNA fragments of 224 and 369 bp were amplified corresponding to the genes of CMV and HHV-6, respectively. As no amplification with CMV primers was visualized in the healthy volunteer group, we analysed oral swabs of immunodepressed patients. Oral swabs from 3 out of 15 patients submitted to bone marrow transplantation were positive for CMV. Positive amplification of HSV-1 and HHV-6 was observed in 24 healthy subjects. DNA sequencing analysis confirmed the expected sequences of each virus.
Discussion The identification of HSV-1, CMV and HHV-6 in the oral cavity is an important aspect to understand the involvement of such virus in oral lesions. Several authors have described methods to detect these virus. Nevertheless, we decided to develop a system that could combine high sensitivity and specificity. In addition, we used a simplified method for sample collection that could be used in any place, such as a dental clinic or even in the field, without the trauma of tissue removal by surgery or drastic scrapings. Our results indicated that collected samples, transferred to the Krebs solution, is stable for 24 h at 4 1C or up to 30 days at 20 1C. Regarding CMV 1 2 3 4 5
HSV-1 1 2 3 4 5
1
→ 663 bp → 241 bp
HHV-6 3 2
→ 814 bp → 224 bp
→ 369 bp
Figure 1. PCR products from HSV-1. Lane 1: molecular size marker—100 bp; lanes 2–3: first round; lanes 4–5: nested. PCR products from CMV. Lane 1: molecular size marker—100 bp; lane 2: negative control; lanes 3–5: nested. PCR products from HHV-6: Lane 1: l HindIII/pUC/ TaqI/Sau3AI—molecular size marker; lane 2: first round; lane 3: nested.
the method used for DNA extraction, the best results were obtained using the method adapted from Boom et al. (1990), whereas the proteinase K/phenol method did not work properly, probably due to the necessarily limited amount of sample associated with loss of DNA during phenol extraction. The best conditions for the PCR assay were achieved after several rounds of calibration using the buffer described in Table 1 and optimising the concentrations of magnesium ions, NaCl, and (NH4)2SO4 instead of KCl, and by applying optimal annealing temperatures for each primer set. Once calibrated, the PCR product of each virus was submitted to DNA sequencing and the sequence obtained confirmed the one expected for each virus. Methods based in cell culture are useful for the diagnosis of HSV-1 and other herpesvirus infections in some clinical situations, but they are timeconsuming and have a low sensitivity, when low amounts of viable virus are expected. Although serologic testing for type-specific antibodies has been considered as a standard method, it has limitations. Measuring the presence of type-specific antibodies cannot determine the location of the infection (e.g., orolabial or genital; Yeung-Yue et al., 2002). Considering that HSV-1 induces epithelial changes, oral cytology has been used for diagnosis of oral herpes infection. On the other hand, previous studies have demonstrated low sensitivity (54%) of oral cytology for the diagnosis of orofacial herpetic infections (Bagg et al., 1989). In addition, cellular changes induced by HSV-1 are indistinguishable from HSV-2 and Varicella-zoster virus (the etiologic agent of chickenpox and shingles). Molecular characterisation of viral infections or other etiologic agents by nested PCR could provide important information regarding the etiopathogenesis of many diseases. Nested PCR is often criticised for higher risk of contamination. However, the risk of contamination is a problem for any PCR-based procedure, so any laboratory must set up precautions against contamination. In our experience, nested PCR has higher sensitivity than single-step PCR. It is possible to identify HSV-1, CMV and HHV-6 in oral swabs by amplification of a herpesvirus DNA segment. The method is sensitive, specific and can be done in a single working day. Furthermore, it is technically simple and permits simultaneous processing of large sample numbers. This is in contrast to other methods of identification, which take considerably more time and are technically more demanding.
ARTICLE IN PRESS Polymerase chain reaction for identification of HSV-1, CMV and HHV-6 in oral swabs
References Ablashi, D.V., Krueger, G.R.F., Salahuddin, S.Z., 1992. Human herpesvirus-6: epidemiology, molecular biology and clinical pathology. Elsevier Science Publishers, Amsterdam. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Bagg, J., Mannings, A., Walker, D.M., 1989. Rapid diagnosis of oral herpes simplex or zoster virus infections by immunofluorescence: comparison with Tzanck cell preparations and viral culture. Br. Dent. J. 167, 235–238. Boom, R., Sol, C.J.A., Salismans, M.M.M., Jansen, C.L., Wertheim-van Dillen, P.M.E., Van De Noordaa, J., 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28, 495–503. Brice, S.L., Cook, D., Leahy, M., Huff, C., Weston, W.L., 2000. Examination of the oral mucosa and peripheral blood cells of patients with recurrent aphthous ulceration for humam herpesvirus DNA. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 89, 193–198. Broers, A.E.C., Holt, R.V., Esser, J.W.J., Gratama, J., Henzen-Logmans, S., Kuenen-Boumeester, V., Lowenberg, B., Cornelissen, J., 2000. Increased transplant-related morbidity and mortality in CMVseropositive patients despite highly effective prevention of CMV disease after allogeneic T-cell-depleted stem cell transplantation. Blood 95, 2240–2245. Cantin, E., Chen, J., Gaidulis, L., Valo, Z., McLaughlinTaylor, E., 1994. Detection of herpes simplex virus DNA sequences in human blood and bone marrow cells. Med. Virol. 42, 279–286. Ghodratnama, F., Wray, D., Bagg, J., 1999. Detection of serum antibodies against cytomegalovirus, varicella zoster virus and humam herpesvirus 6 in patients with recurrent aphthous stomatitis. J. Oral Pathol. Med. 28, 12–15. Glick, M., Cleveland, D.B., Salkin, L.M., Alfaro-Miranda, M., Fielding, A.F., 1991. Intraoral cytomegalovirus lesion and HIV-associated periodontitis in a patient with acquired immunodeficiency syndrome. Oral Surg. Oral Med. Oral Pathol. 72, 716–720. Gomez, R.S., Carneiro, M.A., Souza, L.N., Victo ´ria, J.M.N., Azevedo, W.M., De Marco, L., Kalapothakis, E., 2001. Oral recurrent human herpes virus infection and bone marrow transplantation survival. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 91, 552–556. Herrmann, B.G., Frischauf, A.M., 1987. Isolation of genomic DNA. Methods Enzymol. 152, 180–183. Ho, M., 1991. Cytomegalovirus infection and indirect sequelae in the immunocompromised transplant patient. Transplant. Proc. 23, 2–7.
65
Khan, Z.U., Mustafa, A.S., 2001. Detection of Candida species by polymerase chain reaction (PCR) in blood samples experimentally infected mice and patients with suspected candidemia. Microbiol. Res. 156, 95–102. Langford, A., Kunze, R., Ruf, B., Reichart, P., 1990. Cytomegalovirus associated ulcerations in HIV-infected patients. J. Oral Pathol. Med. 19, 71–76. Roizman, B., 1996. Herpesviridae. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Fields Virology. LippincottRaven, Philadelphia, pp. 2221–2230. Roizman, B., Sears, A.E., 1990. Herpes simplex virus and their replication. In: Fields, B.N., Knipe, D.M. (Eds.), Virology. Raven Press, New York, pp. 1795–1841. Saiki, R.K., Scharf, S.J., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A., Arnheim, N., 1985. Enzimatic amplification of beta-globin sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350–1354. Salahuddin, S.Z., Ablashi, D.V., Markhan, P.D., Josephs, S.F., Sturzenegger, S., Kaplan, M., Hallingan, G., Biberfeld, P., Wong-Stall, F., 1986. Isolation of new virus, HBLV, in patients with lymphoproliferative disorder. Science 234, 596–601. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain terminator inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–5467. Schubert, M.M., Epstein, J.B., Lloyd, M.E., Cooney, E., 1993. Oral infections due to cytomegalovirus in immunocompromised patients. J. Oral Pathol. Med. 22, 268–273. Scott, D.A., Couter, W.A., Biagione, P.A., O’Neill, H., Lamey, P.J., 1997. Detection of herpes simplex virus type1 shedding in the oral cavity by polymerase chain reaction and enzyme-linked inmunosorbent assay at the prodromal stage of recrudescent herpes labialis. J. Oral Pathol. Med. 26, 305–309. Sun, A., Chiang, C.P., 1996. Human cytomegalovirus as a potential etiologic agent in recurrent aphthous ulcers and Bec-et’s disease. J. Oral Pathol. Med. 25, 212–218. Tateishi, K., Toh, Y., Minagawa, H., Tashiro, H., 1994. Detection of herpes simples virus (HSV) in the saliva from 1000 outpatients by the polymerase chain reaction (PCR) and virus isolation. J. Oral Pathol. Med 23, 80–84. Yadav, M., Chandrashekran, A., Vasudevan, D.M., Ablashi, D.V., 1994. Frequent detection of human herpesvirus 6 in oral carcinoma. J. Natl. Cancer Inst. 86, 1792–1794. Yadav, M., Arivanathan, M., Chandrashekran, A., Tan, B.S., Hashim, B.Y., 1997. Human herpesvirus-6 (HHV6) DNA and virus encoded antigen in oral lesions. J. Oral Pathol. Med. 26, 393–401. Yeung-Yue, K.A., Brentjens, M.H., Lee, P.C., Tyring, S.K., 2002. Herpes simplex viruses 1 and 2. Dermatol. Clin. 20, 249–266.
www.elsevier.de/micres
Polymerase chain reaction for identification of herpes simplex virus (HSV-1), cytomegalovirus (CMV) and human herpes virus-type 6 (HHV-6) in oral swabs Ju `nia Maria Netto Victo ´riaa, Andre ´ Luiz Sena Guimara ˜esa, Luciano Marques da Silvaa,, Evanguedes Kalapothakisb, Ricardo Santiago Gomeza, a
Department of Oral Surgery and Pathology, School of Dentistry, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, CEP 31270 901 Belo Horizonte-MG, Brazil b Department of Pharmacology, Instituto de Cie ˆncias Biolo ´gicas, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil Accepted 24 September 2004
KEYWORDS Herpes simplex virus; Cytomegalovirus; Human herpes virus 6; Polymerase chain reaction; Oral swabs
Summary Considering that sensitive and specific methods to detect HSV-1, CMV and HHV-6 on oral mucosa have a great impact on oral diagnosis practice and research, together with the evidence that PCR is a rapid and reliable method, the purpose of the present study was to develop primer sets to detect HSV-1, CMV and HHV-6 in oral swabs by nested polymerase chain reaction (nested PCR). We developed a practical method for sample collection without tissue trauma, and the swabs were stored until used for DNA extraction. After the nested PCR a DNA fragment of 241 bp corresponding to HSV-1 was amplified. DNA fragments of 224 and 369 bp were amplified corresponding to CMV and HHV-6, respectively. DNA sequencing analysis confirmed the expected sequences of each virus. In conclusion, it was demonstrated that these new primer sets are able to identify HSV-1, CMV and HHV-6 in oral swab using nested PCR. & 2004 Elsevier GmbH. All rights reserved.
Corresponding author.
E-mail address: [email protected] (R.S. Gomez). 0944-5013/$ - see front matter & 2004 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2004.09.011
ARTICLE IN PRESS 62
Introduction Infections by herpes simplex virus (HSV-1), cytomegalovirus (CMV) and human herpes virus-type 6 (HHV-6) have been associated with many different oral lesions (Langford et al., 1990; Ghodratnama et al., 1999; Brice et al., 2000). Rapid, specific and sensitive methods to identify such agents are important not only in oral diagnosis practice, but also in the investigation of the pathogenesis of some oral diseases. Nested polymerase chain reaction (PCR) is the ideal technique for the detection of virus, bacterial and fungal species (Ghodratnama et al., 1999; Khan and Mustafa, 2001). Several methods, Western and Northern blotting, immunological assays, viral cultures and oral smears, have been studied or used in oral medicine (Sun and Chiang, 1996; Scott et al., 1997; Yadav et al., 1997). HSV-1 belongs to the Herpesviridae family, genus simplexvirus and contains a 152,000 bp doublestranded DNA genome (Roizman, 1996). Latent HSV1 has been detected in 50% of individuals, principally resident in trigeminal ganglia (Roizman and Sears, 1990). HSV-1 DNA has also been detected in human spiral ganglia, in skin specimens taken from the healed sites of recurrent cutaneous HSV infections and in blood and bone marrow cells (Cantin et al., 1994). HSV-1 in saliva has been considered to play an important role in HSV horizontal transmission (Tateishi et al., 1994). Previous studies have demonstrated that recurrent oral herpes infection has an important impact on bone marrow transplantation survival (Gomez et al., 2001). CMV is a frequent cause of asymptomatic infection in humans; the virus is transmitted during birth via contact with CMV-positive vaginal secretions, via saliva in young children, via contaminated blood transfusion or transplanted organs and sexual transmission (Ho, 1991). CMV has been related to chronic graft versus host disease and bone marrow transplantation mortality (Broers et al., 2000). Intraoral CMV ulceration has been reported in immunocompromised and HIV-infected patients and apparently immunocompetent adults (Glick et al., 1991; Schubert et al., 1993). Human herpes virus 6 (HHV-6), a herpesvirus first discovered in 1986, is commonly isolated from saliva (Salahuddin et al., 1986). The virus has also been reported to infect a wide variety of cells types (Ablashi et al., 1992) and is frequently detected and reactivated in epithelial tumours of the oral cavity (Yadav et al., 1994). Considering that sensitive and specific methods to detect HSV-1, CMV and HHV-6 on oral mucosa
J.M.N. Victo ´ria et al. have a great impact on oral diagnosis practice and research, together with the evidence that PCR is a rapid and reliable method, the purpose of the present study was to develop primer sets of to detect HSV-1, CMV and HHV-6 in oral swabs.
Material and methods Sample collection Thirty healthy volunteers attending at the Dental Clinics and 15 subjects submitted to bone marrow transplantation were included in the study. The study protocol was approved by local Ethical Committee and informed consent was obtained from all patients. Sterile plastic sticks were used to perform the oral swabs. After been immediately suspended in 250 ml Krebs–Ringer solution (in mM): NaCl (118.4), KCl (4.7), KH2PO4 (1.2), MgSO4 7H2O (1.2), CaCl2 2H2O (2.5), NaHCO3 (25,0) and glucose (11.7), the swabs were stored at 4–10 1C for 48 h or at 20 1C until the solution was used for DNA extraction. After centrifugation of the samples at 10,000 g for 10 min, the sediments were submitted to DNA extraction. Recurrent oral herpes lesion in bone marrow transplantation patient was used as positive control for HSV-1. CMV-DNA was taken from new-born contaminated urine and HHV-6 material used in this study was taken from American Tissue Culture Collection (ATCC). DNA sequencing from control and patients was carried out as described below.
DNA isolation DNA extraction was carried out as described by Boom et al. (1990) and modified as follows: 450 ml lysis buffer (6.0 M Gunidinium-SCN, 0.1 M Tris-Cl, 0.2 M EDTA, 10% TritonX-100) and 20 ml silica (SiO2, Sigma S5631, washed with H2O, pH 2.5, corrected with HCl) in the pellet. The tubes were mixed for 10 s, incubated for 10 min at 56 1C, centrifuged for 1 min and the supernatant was discarded. The pellet was washed twice with 450 ml washing buffer (6.0 M Guanidinium-SCN, 0.1 M Tris-Cl), twice with 70% ethanol and once with 450 ml acetone. After these steps the pellet was dried at 56 1C for 10 min or until the silica became completely dry. Finally, 100 ml TE buffer (10 mM Tris-Cl pH 8.0, 1.0 mM EDTA) was added and incubated at 56 1C for a minimum of 10 min and maximum of 24 h. The solution containing the silica and DNA was mixed for 5 s, centrifuged for 2 min and the supernatant was carefully transferred to new tube. The
ARTICLE IN PRESS Polymerase chain reaction for identification of HSV-1, CMV and HHV-6 in oral swabs manipulation was carried out using a PCR-hood to avoid contamination. Alternatively, DNA was purified using proteinase K and phenol as described by Herrmann and Frischauf (1987).
HSV-1, CMV and HHV-6 primers and PCR reaction The DNA sequence used in the present work was obtained from National Center for Biotechnology Information. The MacVector program was used to construct and analyse the primers. Primers were selected according to annealing temperature and size of PCR products. Two sets of primers were used for each virus characterizing a typical reaction of nested PCR (Table 1). The PCR was performed according to standard techniques (Saiki et al., 1985). Two microliter DNA solution were subjected to PCR using outer primers. PCR was carried out in a 50 ml mixture containing Taq DNA polymerase (1 unit/reaction), PCR buffer (50 mM KCl, 10 mM TrisCl pH 8.4, 1.5 mM MgCl2), 0.1 mM deoxynucleoside triphosphates, and 10 pmol/reaction primers. All samples were amplified using a DNA thermal cycler (PTC—Programmable Thermal Controller). After PCR, 2 ml of the final product were transferred to the reaction mixture of the second PCR and reamplified with the inner pair of primers. Positive (see sample collection) and negative (PCR reagents without DNA) controls were routinely included. Table 1.
DNA purified from Varicella zoster virus and Epstein-Barr obtained from the American Tissue Culture Collection (ATCC VR-586 and ATCC VR-602) was used as negative control.
Agarose gel eletrophoresis Ten microliter of each reaction product were added to 2 ml gel loading dye (0.25% bromophenol blue, 30% glycerol, 10 mM EDTA), loaded on 1.5% agarose gels and electrophoresis carried out in 1 TAE buffer. DNA fragments were visualized after staining with 0.5 mg/ml ethidium bromide by the photodocumentation system BIO-RAD GEL-DOC 1000. The molecular weight of the DNA was estimated using l Hind III DNA and 100 bp ladder markers.
DNA sequencing and computer analysis DNA sequencing reactions were performed on both strands using the chain termination method of Sanger et al. (1977). All reactions were carried out on the DNA Sequencer ABI PRISM 310 Genetic Analyzer (PE Biosystems) and the BigDye terminator kit. Nucleic acid sequences were analysed using the MacVectorTM 5.0 program (Oxford Molecular Group PLC). After editing, the sequences were compared to sequences in the GenBanK databases (Altschul et al., 1990).
Primers and PCR conditions
Virus
Primer pair
PCR program
HSV-1
Outer primers F: 50 TGC TGG AGG ATC ACG AGT TTG 30 R: 50 CAT CGT CTT TGT TGG GAA CTT 30
95 1C/30 s 61 1C/45 s 72 1C/30 s
30 cycles
Inner primers F: 50 TGCAGAGCAACCCCATGAAG 30 R: 50 ATGACCATGTCGGTGACCTTGG 30
95 1C/30 s 60 1C/45 s 72 1C/30 s
30 cycles
Outer primers F: 50 ACATGGAATCCAGGATCTGGTGCC 30 R: 50 CCCTATGATATGCCACGAAAACCG 30
95 1C/30 s 58 1C/45 s 72 1C/30 s
30 cycles
Inner primers F: 50 CAACACGTAACGTCTTCTGAAGCC 30 R: 50 TAGACCACCATGATGCCCTCATCC 30
95 1C/30 s 57 1C/45 s 72 1C/30 s
30 cycles
Outer primers F: 50 CGCAGAGACATATCGTTCCGATGG 30 R: 50 AGAACCGTCGCATCAATTACTCGC 30
95 1C/30 s 56 1C/45 s 72 1C/30 s
30 cycles
Inner primers F: 50 AATAGGAGCCTTGCTGGTCAGAAC 30 R: 50 CCTGGAACCCCACAAAACCTAACG 30
95 1C/30 s 55 1C/45 s 72 1C/30 s
30 cycles
CMV
HHV-6
63
Product size 663 bp
241 bp
612 bp
224 bp
814 bp
369 bp
ARTICLE IN PRESS 64
J.M.N. Victo ´ria et al.
Results Figure 1 shows representative results following agarose gel electrophoresis of PCR products obtained from the samples. After the first round a DNA fragment of 663 bp was amplified to confirm the expected size of the product, and the second round generated a fragment of 241 bp corresponding to the gene of HSV-1. DNA fragments of 224 and 369 bp were amplified corresponding to the genes of CMV and HHV-6, respectively. As no amplification with CMV primers was visualized in the healthy volunteer group, we analysed oral swabs of immunodepressed patients. Oral swabs from 3 out of 15 patients submitted to bone marrow transplantation were positive for CMV. Positive amplification of HSV-1 and HHV-6 was observed in 24 healthy subjects. DNA sequencing analysis confirmed the expected sequences of each virus.
Discussion The identification of HSV-1, CMV and HHV-6 in the oral cavity is an important aspect to understand the involvement of such virus in oral lesions. Several authors have described methods to detect these virus. Nevertheless, we decided to develop a system that could combine high sensitivity and specificity. In addition, we used a simplified method for sample collection that could be used in any place, such as a dental clinic or even in the field, without the trauma of tissue removal by surgery or drastic scrapings. Our results indicated that collected samples, transferred to the Krebs solution, is stable for 24 h at 4 1C or up to 30 days at 20 1C. Regarding CMV 1 2 3 4 5
HSV-1 1 2 3 4 5
1
→ 663 bp → 241 bp
HHV-6 3 2
→ 814 bp → 224 bp
→ 369 bp
Figure 1. PCR products from HSV-1. Lane 1: molecular size marker—100 bp; lanes 2–3: first round; lanes 4–5: nested. PCR products from CMV. Lane 1: molecular size marker—100 bp; lane 2: negative control; lanes 3–5: nested. PCR products from HHV-6: Lane 1: l HindIII/pUC/ TaqI/Sau3AI—molecular size marker; lane 2: first round; lane 3: nested.
the method used for DNA extraction, the best results were obtained using the method adapted from Boom et al. (1990), whereas the proteinase K/phenol method did not work properly, probably due to the necessarily limited amount of sample associated with loss of DNA during phenol extraction. The best conditions for the PCR assay were achieved after several rounds of calibration using the buffer described in Table 1 and optimising the concentrations of magnesium ions, NaCl, and (NH4)2SO4 instead of KCl, and by applying optimal annealing temperatures for each primer set. Once calibrated, the PCR product of each virus was submitted to DNA sequencing and the sequence obtained confirmed the one expected for each virus. Methods based in cell culture are useful for the diagnosis of HSV-1 and other herpesvirus infections in some clinical situations, but they are timeconsuming and have a low sensitivity, when low amounts of viable virus are expected. Although serologic testing for type-specific antibodies has been considered as a standard method, it has limitations. Measuring the presence of type-specific antibodies cannot determine the location of the infection (e.g., orolabial or genital; Yeung-Yue et al., 2002). Considering that HSV-1 induces epithelial changes, oral cytology has been used for diagnosis of oral herpes infection. On the other hand, previous studies have demonstrated low sensitivity (54%) of oral cytology for the diagnosis of orofacial herpetic infections (Bagg et al., 1989). In addition, cellular changes induced by HSV-1 are indistinguishable from HSV-2 and Varicella-zoster virus (the etiologic agent of chickenpox and shingles). Molecular characterisation of viral infections or other etiologic agents by nested PCR could provide important information regarding the etiopathogenesis of many diseases. Nested PCR is often criticised for higher risk of contamination. However, the risk of contamination is a problem for any PCR-based procedure, so any laboratory must set up precautions against contamination. In our experience, nested PCR has higher sensitivity than single-step PCR. It is possible to identify HSV-1, CMV and HHV-6 in oral swabs by amplification of a herpesvirus DNA segment. The method is sensitive, specific and can be done in a single working day. Furthermore, it is technically simple and permits simultaneous processing of large sample numbers. This is in contrast to other methods of identification, which take considerably more time and are technically more demanding.
ARTICLE IN PRESS Polymerase chain reaction for identification of HSV-1, CMV and HHV-6 in oral swabs
References Ablashi, D.V., Krueger, G.R.F., Salahuddin, S.Z., 1992. Human herpesvirus-6: epidemiology, molecular biology and clinical pathology. Elsevier Science Publishers, Amsterdam. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Bagg, J., Mannings, A., Walker, D.M., 1989. Rapid diagnosis of oral herpes simplex or zoster virus infections by immunofluorescence: comparison with Tzanck cell preparations and viral culture. Br. Dent. J. 167, 235–238. Boom, R., Sol, C.J.A., Salismans, M.M.M., Jansen, C.L., Wertheim-van Dillen, P.M.E., Van De Noordaa, J., 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28, 495–503. Brice, S.L., Cook, D., Leahy, M., Huff, C., Weston, W.L., 2000. Examination of the oral mucosa and peripheral blood cells of patients with recurrent aphthous ulceration for humam herpesvirus DNA. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 89, 193–198. Broers, A.E.C., Holt, R.V., Esser, J.W.J., Gratama, J., Henzen-Logmans, S., Kuenen-Boumeester, V., Lowenberg, B., Cornelissen, J., 2000. Increased transplant-related morbidity and mortality in CMVseropositive patients despite highly effective prevention of CMV disease after allogeneic T-cell-depleted stem cell transplantation. Blood 95, 2240–2245. Cantin, E., Chen, J., Gaidulis, L., Valo, Z., McLaughlinTaylor, E., 1994. Detection of herpes simplex virus DNA sequences in human blood and bone marrow cells. Med. Virol. 42, 279–286. Ghodratnama, F., Wray, D., Bagg, J., 1999. Detection of serum antibodies against cytomegalovirus, varicella zoster virus and humam herpesvirus 6 in patients with recurrent aphthous stomatitis. J. Oral Pathol. Med. 28, 12–15. Glick, M., Cleveland, D.B., Salkin, L.M., Alfaro-Miranda, M., Fielding, A.F., 1991. Intraoral cytomegalovirus lesion and HIV-associated periodontitis in a patient with acquired immunodeficiency syndrome. Oral Surg. Oral Med. Oral Pathol. 72, 716–720. Gomez, R.S., Carneiro, M.A., Souza, L.N., Victo ´ria, J.M.N., Azevedo, W.M., De Marco, L., Kalapothakis, E., 2001. Oral recurrent human herpes virus infection and bone marrow transplantation survival. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 91, 552–556. Herrmann, B.G., Frischauf, A.M., 1987. Isolation of genomic DNA. Methods Enzymol. 152, 180–183. Ho, M., 1991. Cytomegalovirus infection and indirect sequelae in the immunocompromised transplant patient. Transplant. Proc. 23, 2–7.
65
Khan, Z.U., Mustafa, A.S., 2001. Detection of Candida species by polymerase chain reaction (PCR) in blood samples experimentally infected mice and patients with suspected candidemia. Microbiol. Res. 156, 95–102. Langford, A., Kunze, R., Ruf, B., Reichart, P., 1990. Cytomegalovirus associated ulcerations in HIV-infected patients. J. Oral Pathol. Med. 19, 71–76. Roizman, B., 1996. Herpesviridae. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Fields Virology. LippincottRaven, Philadelphia, pp. 2221–2230. Roizman, B., Sears, A.E., 1990. Herpes simplex virus and their replication. In: Fields, B.N., Knipe, D.M. (Eds.), Virology. Raven Press, New York, pp. 1795–1841. Saiki, R.K., Scharf, S.J., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A., Arnheim, N., 1985. Enzimatic amplification of beta-globin sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350–1354. Salahuddin, S.Z., Ablashi, D.V., Markhan, P.D., Josephs, S.F., Sturzenegger, S., Kaplan, M., Hallingan, G., Biberfeld, P., Wong-Stall, F., 1986. Isolation of new virus, HBLV, in patients with lymphoproliferative disorder. Science 234, 596–601. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain terminator inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–5467. Schubert, M.M., Epstein, J.B., Lloyd, M.E., Cooney, E., 1993. Oral infections due to cytomegalovirus in immunocompromised patients. J. Oral Pathol. Med. 22, 268–273. Scott, D.A., Couter, W.A., Biagione, P.A., O’Neill, H., Lamey, P.J., 1997. Detection of herpes simplex virus type1 shedding in the oral cavity by polymerase chain reaction and enzyme-linked inmunosorbent assay at the prodromal stage of recrudescent herpes labialis. J. Oral Pathol. Med. 26, 305–309. Sun, A., Chiang, C.P., 1996. Human cytomegalovirus as a potential etiologic agent in recurrent aphthous ulcers and Bec-et’s disease. J. Oral Pathol. Med. 25, 212–218. Tateishi, K., Toh, Y., Minagawa, H., Tashiro, H., 1994. Detection of herpes simples virus (HSV) in the saliva from 1000 outpatients by the polymerase chain reaction (PCR) and virus isolation. J. Oral Pathol. Med 23, 80–84. Yadav, M., Chandrashekran, A., Vasudevan, D.M., Ablashi, D.V., 1994. Frequent detection of human herpesvirus 6 in oral carcinoma. J. Natl. Cancer Inst. 86, 1792–1794. Yadav, M., Arivanathan, M., Chandrashekran, A., Tan, B.S., Hashim, B.Y., 1997. Human herpesvirus-6 (HHV6) DNA and virus encoded antigen in oral lesions. J. Oral Pathol. Med. 26, 393–401. Yeung-Yue, K.A., Brentjens, M.H., Lee, P.C., Tyring, S.K., 2002. Herpes simplex viruses 1 and 2. Dermatol. Clin. 20, 249–266.