- Email: [email protected]
Polymerase Chain Reaction–Denaturing Gradient Gel Electrophoresis, Cloning, and Sequence Analysis of Bacteria Associated with Acute Periapical Abscesses in Children
Clinical Research
Polymerase Chain Reaction–Denaturing Gradient Gel Electrophoresis, Cloning, and Sequence Analysis of Bacteria Associated with Acute Periapical Abscesses in Children Qiu-Bo Yang, DDS, PhD,* Lu-Na Fan, DDS, MS,† and Qing Shi, DDS† Abstract Introduction: Polymerase chain reaction–denaturing gradient gel electrophoresis (PCR-DGGE), cloning, and sequencing were applied to the microbiologic study of acute periapical abscesses of endodontic origin in children to examine the predominant bacteria. Methods: Purulent material was collected from 11 children diagnosed with acute abscesses of endodontic origin, and DNA was extracted to evaluate the predominant bacteria by using PCR-DGGE, cloning, and sequence analysis. Results: Bacterial DNA was present in all of the 11 purulence samples. The microflora of clinical purulence samples were profiled by the PCR-DGGE method, and overall 17 bacterial genera were identified. The number of bacterial phylotypes in the purulence samples ranged from 1–8 (mean, 5.5). The most dominant genera found were Prevotella (24%), Fusobacterium (17.7%), Porphyromonas (13.9%), Lactobacillus (11.3%), Peptostreptococcus (8.3%), Streptococcus (6.4%), Eubacterium (3.8%), Campylobacter (3.3%), Treponema (2.6%), and Bulleidia (2.6%). Conclusions: The DGGE allowed visualization of the bacterial qualitative composition and revealed the major bacteria in the samples. The dominant bacteria associated with acute periapical abscess examined by PCR-DGGE, cloning, and sequencing methods are similar to those of culture-dependent studies. Although PCRDGGE, cloning, and sequencing methods detected some bacteria at lower proportions than are unreported by culture methods, the method has the disadvantage of low resolution and is too time-consuming and laborious and more expensive. (J Endod 2010;36:218–223)
Key Words Acute periapical abscess, endodontic microbiology, molecular biology, 16S rRNA gene
From the *Beijing Institute for Dental Research, †Department of Pediatric Dentistry, Capital Medical University School of Stomatology, Beijing, People’s Republic of China. Address requests for reprints to Dr Qing Shi, the Department of Pediatric Dentistry, Capital Medical University School of Stomatology, Tian Tan Xi Li No. 4, Chong Wen District, Beijing 100050, People’s Republic of China. E-mail address: dentshi@ yahoo.com.cn. 0099-2399/$0 - see front matter Copyright ª 2010 American Association of Endodontists. doi:10.1016/j.joen.2009.11.001
218
Yang et al.
A
n acute periapical abscess is an extension of infectious or necrotic pulp into the periapical area, which induces bone and tissue necrosis and accumulation of purulence. As the abscess develops, more tissue might be involved; particularly, it might provide a source of serious orofacial infection. Root canal treatment and drainage of purulence, which can be achieved by surgical incision or tooth extraction, are important in the treatment of acute periapical abscess. In addition, local drug administration can be used to improve the therapy outcome and prevent the spread of infection and onset of serious complications (1–4). The choice of the most eligible antimicrobial drug for acute periapical abscess should be based on the most probable microorganisms and susceptibility testing. Culture procedures have traditionally been used in the assessment of the bacteria associated with acute periapical abscess. Nonviable, uncultivable, slow-growing, or fastidious bacteria contribute to underestimation of microorganisms with culture methods. Studies investigating the bacterial diversity of the endodontic microbiota have revealed that 40%–55% of the taxa represent as yet uncultivated phylotypes, requiring a molecular approach to elucidate the composition of microflora associated with disease pathogenesis (5, 6). In contrast to conventional culture methods, molecular techniques have the advantage of often detecting uncultivable or difficult to grow bacteria. However, only expected species have been investigated with any frequency because the number of target bacteria is restricted for polymerase chain reaction (PCR) techniques or checkerboard DNA–DNA hybridization analysis (7). Many culturing studies reported that the microbiota associated with acute periapical abscesses are usually polymicrobial, with an average number of species ranging from <3–8.5 per purulence sample (8–12). Strict and facultative bacteria are the most frequently isolated, including members of the genera Porphyromonas, Streptococcus, Prevotella, Fusobacterium, Peptostreptococcus, and Eubacterium (13). Few studies have addressed the acute periapical abscess microbiota of deciduous teeth. PCR-based denaturing gradient gel electrophoresis (DGGE) has been one of the most commonly used techniques when fingerprinting microbial communities. With the DGGE approach, PCR-generated DNA fragments of the same length are separated according to nucleotide sequence specificity (14). PCR-DGGE has been used for the analysis of bacterial communities associated with different types of endodontic infections (15–17). Distinct amplicons can be excised from the gels, and these fragments of the 16S rRNA gene can be sequenced and analyzed against known sequences in an rRNA database (18). DGGE has great potential for revealing the dominant species that are seldom studied by PCR or checkerboard DNA–DNA hybridization analysis. The objective of this study, therefore, was to evaluate the microflora, including unculturable or fastidious bacteria, associated with acute periapical abscess in children by PCR-based 16S rRNA gene DGGE without the inherent biases of culture.
Materials and Methods Patients and Samples Purulence samples were obtained with parental informed consent from 11 patients with acute periapical abscesses seeking treatment at the Department of Pediatric Dentistry, Capital Medical University School of Stomatology, Beijing, China
JOE — Volume 36, Number 2, February 2010
Clinical Research (5 boys and 6 girls; age range, 5.4–7.6 years). The deciduous molars showed carious lesions, and radiographic evidence of periapical bone loss was included in this study. The status of pulp was diagnosed as necrosis or partial necrosis after the pulp was opened. Apical root resorption was less than 1/3 of the root length on standardized radiographs. Diagnosis of acute periapical abscess was based on the presence of spontaneous pain and localized fluctuation and swelling according to criteria established by Torabinejad and Walton (19). No apparent communication from the abscess to the oral cavity was observed. Before sample collection, the mucosa over each abscess was carefully cleaned with sterile cotton gauze to avoid salivary contamination of the sample. Purulence sample was collected from the abscesses by inserting paper points after the abscess was punctured with a blade. The paper points were placed into a tube containing 1 mL of phosphate-buffered saline (pH 7.4). The purulence samples were stored immediately at –20 C for DNA isolation.
DNA Extraction The collected purulence sample was released from the paper points by vigorous shaking in a mixer for 60 minutes. The total bacterial genomic DNA of each sample was isolated by means of a Wizard Genomic DNA Purification kit (Promega Corporation, Madison, WI) in accordance with the manufacturer’s instructions. In brief, 480 mL of 50 mmol/L ethylenediaminetetraacetic acid (EDTA), 60 mL of 10 mg/mL lysozyme, and 60 mL of 10 mg/mL lysostaphin were added to the cell pellet. That solution was incubated at 37 C for 1 hour and centrifuged to remove the supernatant. A total of 600 mL of Nuclei Lysis Solution was added to the pellet and incubated at 80 C for 5 minutes to lyse the cells. Three microliters of RNase Solution was then added, and the mixture was incubated at 37 C for 30 minutes. The samples were then placed on ice for 3–5 minutes, and 200 mL of protein precipitation reagent was added and vortex-mixed vigorously for 20 seconds; this was followed by an isopropanol precipitation procedure. The DNA was then washed and dried. The concentration of the purified DNA was determined by spectrophotometric measurement of the absorbance at 260 nm. DNA quality was assessed by the ratio of DNA to protein as measured by the ratio of the absorbances at 260 and 280 nm. PCR Assay The V2-V3 hypervariable region (240 base pair [bp]) of the 16S rRNA gene locus was amplified for all DNA extracts from bacteria in the specimens with a set of universal 16S rRNA sequence primers. A forward primer, with a 39-bp GC clamp at its 50 -end (HAD-1-GC, 50 CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAGCAGT-30 , nt 339-360 in the Escherichia coli 16S rRNA gene), and a reverse primer (HAD-2, 50 - GTATTACCGCGGCTGCTGGCAC -30 , nt 539-518 in the E. coli 16S rRNA gene) were prepared for the PCR (20). In the PCR, each reaction mixture (total volume, 50 mL) contained a standardized 100 ng of the total genomic DNA, 200 mmol/L of each deoxynucleoside triphosphate (Applied Biosystems, Foster City, CA), 50 pmol of HAD-1-GC and HAD-2 primers, 1.5 mmol/L MgCl2, 5 mL of 10 PCR buffer II, and 2.5 U of Taq DNA polymerase (Clontech, Mountain View, CA). The thermocycling program was as follows: 10 minutes at 95 C, then 35 cycles of 94 C for 1 minute, 56 C for 2 minutes, and 72 C for 1 minute, followed by 10 minutes at 72 C and a holding temperature of 4 C. All PCR procedures were performed with the GeneAmp PCR System 9700 (Applied Biosystems). PCR products were evaluated by electrophoresis in 1.5% agarose gels that were run at 60 V for 100 minutes, and the sizes of all amplicons were confirmed according to a molecular size standard. The quantity JOE — Volume 36, Number 2, February 2010
of each PCR-amplified product was measured with a UV spectrophotometer at 260 and 280 nm. The final concentration of each DNA sample was adjusted to 10 ng/mL for all DGGE applications.
DGGE Assay A standardized 35 mL of each PCR-amplified product was separated on gradient gels. A 30%–60% linear DNA denaturing gradient was formed in an 8% (wt/vol) polyacrylamide gel. PCR products were directly loaded in each lane and were run for 3 hours at 150 V in 1 TAE buffer (0.04 mol/L Tris-acetate/1 mmol/L EDTA, pH 8.5) at a constant temperature of 60 C. After electrophoresis, the gels were rinsed and stained for 30 minutes in 0.5 mg/mL GelRed (Biotium, Inc, Hayward, CA). The DGGE images were digitally captured and recorded (Fluor-S MultiImager; Bio-Rad, Hercules, CA). Cloning and 16S rRNA Gene Sequencing Distinct amplicons from DGGE gels for all samples were excised from the gels, and the excised DNA was eluted, purified, and reamplified with the same HAD-1-GC and HAD-2 primers but without the GC clamp. PCR products were cloned into a pGEM-T vector (Promega Corporation, Madison, WI) according to the manufacturer’s instructions. The transformed cells were then plated onto Luria-Bertani agar plates supplemented with kanamycin (50 mg/mL), and the plates were incubated overnight at 37 C. After cloning of the 16S rRNA gene product amplified by PCR for each excised DNA, 8 clones from each generated library were randomly selected. Plasmid DNA from recombinant clones was purified with the Qiagen Plasmid Purification Kit (Qiagen, Crawley, UK). Purified plasmid DNA with 16S rRNA gene inserts was sequenced with the ABI Prism cycle sequencing kit (Applied Biosystems) and universal T7 primer. The sequences of the 16S rRNA gene PCR amplicons obtained from the DGGE of acute periapical abscess samples were submitted to the BLASTN algorithm (BLAST 2.0; http://www.ncbi.nlm.nih.gov/blast), allowing comparison with sequences present in the GenBank databases. Only the highest-scored BLAST result was considered for phylotype identification, with 99% minimum similarity (21).
Results DGGE Banding Pattern DNA extracted from purulence samples was amplified by using primers directed toward the V2 to V3 regions of the 16S rRNA gene, and amplicons of the expected size were present in all samples as visualized on agarose gels. The DGGE profiles of the amplified 16S rRNA gene of acute periapical abscess samples are shown in Fig. 1. Profiles contained bands ranging from 3–8 (mean, 4.8) per sample, and efforts were made to excise and sequence all of them. The profiles of the predominant bacteria appeared to be unique for each individual. Sequence Analysis of the Individual Bands To determine the dominant bacteria in the specimens, the DGGE bands were cloned and sequenced. A total of 53 discrete PCR amplicons detected in the DGGE profiles were excised from the gels (Fig. 1), after which the DNA was purified, reamplified, and cloned. Eight clones were isolated and sequenced from each band (for a total of 424 clones). All sequence data for the clones allowed close matches with the presently existing sequences in GenBank. The similarity values of a clone’s sequences to the databases ranged between 99% and 100%. Data are summarized in Table 1. From the 424 sequences examined, 17 genera were identified, 67% of which were gram-negative, and 33% gram-positive. On average, 3.0 (1–5) genera per band sequenced were found. Two bands in PCR-DGGE Analysis of Bacteria in Children With Acute Periapical Abscesses
219
Clinical Research
Figure 1. DGGE profiles of PCR-amplified bacterial 16S rRNA gene segments and illustration of the DGGE bands cut for sequence analysis. The DGGE gel images were obtained from the total genomic DNA of the purulence samples of 11 children with acute periapical abscesses. For each individual lane, the number of detected amplicons ranged from 1–5, with a mean of 3.0. A total of 53 discrete PCR amplicons were excised from the DGGE gels, after which the DNA was extracted, reamplified, and cloned. A total of 424 clones were selected and sequenced, and 17 genera were identified.
distinct positions in the same sample were identified as Prevotella (99% similarity). In another clinical sample, 3 distinct bands were identified as Prevotella (99% similarity). The number of bacterial genera in the purulence samples ranged from 1–8 (mean, 5.5). Prevotella was the most dominant genus, representing 24% of analyzed clones, followed by Fusobacterium (17.7%). The next most dominant genera were Porphyromonas (13.9%), Lactobacillus (11.3%), Peptostreptococcus (8.3%), Streptococcus (6.4%), Eubacterium (3.8%), Campylobacter (3.3%), Treponema (2.6%), and Bulleidia (2.6%) (Table 2). In decreasing order of prevalence, the most prevalent phylotypes of bacteria found were Prevotella (90.9%), Fusobacterium (81.8%), Peptostreptococcus (63.6%), Porphyromonas (45.5%), Streptococcus (45.5%), Eubacterium (45.5%), Lactobacillus (27.3%), Campylobacter (27.3%), Treponema (27.3%), and Bulleidia (27.3%) (Table 3).
Discussion Previously, studies of microorganisms associated with periapical abscesses relied heavily on culture methods. Because about 50% of the microbiota in the oral cavity are uncultivable (22), conventional culture approaches are severely limited for investigation of uncultivable bacteria. In addition, nonviable or fastidious bacteria contribute to the failure of a culture method (5, 23, 24). Checkerboard DNA–DNA hybridization, a molecular technique, does not require culturing bacteria and has been applied in the investigation of pathogenic bacteria in oral infectious diseases. However, DNA–DNA hybridization usually detects only target microbial species. The PCR-DGGE procedure can detect unexpected or difficult to grow bacteria. Here, in an effort to contribute to the characterization of acute periapical abscess microbiota, we report the results of an investigation of the pathogenic bacteria of 11 acute periapical abscesses by using a PCR-DGGE, cloning, and sequence procedure. DGGE analysis allows easy and quick comparison of profiles from related microbial assemblages and is now used in many microbiologic studies. Furthermore, an advantage of DGGE is that selected bands can be cloned and sequenced, allowing identification of a specific phylotype. Bacterial 16S rRNA gene hypervariable regions (V1–V8) were characterized for differentiation among bacteria. V2 and V3 were most suitable for distinguishing bacterial species to 220
Yang et al.
the genus level. The sequence lengths generated from the DGGE gels are short (240 bp in this study), however, and sequence information from manually excised DGGE bands thus does not always allow reliable phylogenetic analyses, as compared with 1500 bp of the whole 16S DNA sequence. In this study, efforts have targeted investigating the bacterial composition of acute periapical abscesses through DGGE, cloning, and sequencing. The DGGE method allowed visualization of the bacterial qualitative composition of the purulence samples from the acute periapical abscesses. The profiles of the predominant bacterial composition appeared to be unique for each individual. All abscesses evaluated were positive for the presence of bacteria. In the 11 samples, multiple DGGE bands, varying in number from 3–8, were observed. Siqueira et al (25) used PCR-DGGE to examine the structure of bacterial communities in samples taken from asymptomatic and symptomatic endodontic infections. The mean number of bands in asymptomatic cases was 6.7 2.7 (range, 2–11), and it was 12.1 9.4 (range, 2–29) in asymptomatic cases. Machado de Oliveira et al (26) reported that the mean diversity of bands detected in the 16S rRNA gene community profiles of endodontic abscesses was 7.4 4 (range, 1–20) for Brazilian samples and 10.4 3.4 (range, 5–19) for U.S. samples. The number of bands in abscesses from adults was higher than that identified in the present study. The reason for these differences might be the different sensitivities of PCR-DGGE methods. In the previous 2 studies, the sensitivity of the staining and photography procedures for DGGE might have been greater than in our study. Extensive cloning and sequencing of bands from each patient were performed to identify dominant members of the microbial population. The identification of each amplicon was to the genus level because it is based on a partial 16S rRNA gene sequence, which is insufficient for species level assignment. Reamplification, cloning, and sequencing of amplicons recovered from the individual DGGE bands revealed that each band represented 3 phylotypes on average (range, 1–5). The findings indicated that the number of species per purulent sample in this study ranged from 1–8. This figure is comparable with those of other studies, which have observed a mean number of species in acute periapical abscesses of endodontic origin ranging from 3–8.5 (8–12). The results of our study with the molecular fingerprinting technique allowed visual confirmation of the findings of culture studies in which the microbiota associated with acute periapical abscesses are usually polymicrobial. On the basis of cloning and sequencing of the DGGE products, in all patients the predominant microorganisms were identified as strict and facultative anaerobic bacteria, a finding similar to those of other studies. In this study, aerobes were not detected in the purulence samples from the acute periapical abscesses. In contrast, Lewis et al (8) and Brook et al (27) isolated aerobes from periapical abscesses, although with less frequency and mixed with anaerobes. The possible reason for the discrepancy between the results of this study and of previous culture studies is that the aerobes were absent or were present in quantities below the threshold of the PCR-DGGE detection used in this study. Another explanation for the discrepancy between our current results and previous findings might be differences in sampling or patients in different studies. Some investigators have reported diversity in the compositions of microbiota in different individuals. Nevertheless, acute periapical abscesses harbored a far greater proportion of strict and facultative anaerobic bacteria than aerobic bacteria. In this study, the dominant taxa were Prevotella spp. (24.0%), Fusobacterium spp. (17.7%), Porphyromonas spp. (13.9%), Lactobacillus spp. (11.3%), Peptostreptococcus spp. (8.3%), and Streptococcus spp. (6.4%). The general microbial composition of the periapical abscesses examined in this study is in agreement with
JOE — Volume 36, Number 2, February 2010
Clinical Research TABLE 1. Identification of genera in the DGGE bands cut for sequence analysis Band no. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47
Genus (no. of clones) Lactobacillus (8) Lactobacillus (8) Lactobacillus (6), Prevotella (2) Bacteroidales genomosp. P4 oral clone MB2_G17 (8) Porphyromonas (8) Porphyromonas (6), Fusobacterium (2) Treponema (4), Fusobacterium (4) Prevotella (5), Treponema (1), Fusobacterium (1), Peptostreptococcus (1) Porphyromonas (3), Prevotella (3), Catonella (2) Porphyromonas (4), Prevotella (4) Porphyromonas (6), Prevotella (2) Peptostreptococcus (3), Porphyromonas (2), Treponema (2), Prevotella (1) Peptostreptococcus (3), Prevotella (2), Campylobacter (2), Treponema (1) Campylobacter (4), Peptostreptococcus (1), Prevotella (1), Treponema (1), Streptococcus (1) Eubacterium (5), Peptostreptococcus (1), Prevotella (1) ,Campylobacter (1) Eubacterium (5), Prevotella (1), Fusobacterium (1), Treponema (1) Lactobacillus (8) Lactobacillus (8) Lactobacillus (8) Prevotella (4), Porphyromonas (2), Fusobacterium (1), Peptostreptococcus (1) Fusobacterium (4), Porphyromonas (3), Peptostreptococcus (1) Bulleidia (6), Fusobacterium (1), Prevotella (1) Peptostreptococcus (8) Porphyromonas (8) Peptostreptococcus (5), Prevotella (3) Fusobacterium (8) Peptostreptococcus (4), Prevotella (1), Streptococcus (1), Fusobacterium (1), Dialister (1) Prevotella (4), Bulleidia (3), Dialister (1) Prevotella (6), Fusobacterium (1), Eubacterium (1) Prevotella (3), Fusobacterium (3), Peptostreptococcus (2) Fusobacterium (7), Prevotella (1) Porphyromonas (4), Fusobacterium (4) Peptostreptococcus (3), Prevotella (3), Fusobacterium (2) Prevotella (4), Bulleidia (2), Fusobacterium (1), Porphyromonas (1) Fusobacterium (4), Prevotella (2), Porphyromonas (2) Fusobacterium (6), Prevotella (1), Catonella (1) Prevotella (8) Prevotella (4), Streptococcus (2), Fusobacterium (1), Neisseria (1) Porphyromonas (6), Actinobacillus (1), Fusobacterium (1) Actinobacillus (6), Fusobacterium (2) Prevotella (3), Fusobacterium (2), Peptostreptococcus (1), Actinobacillus (1), Treponema (1) Campylobacter (3), Prevotella (2), Porphyromonas (2), Eubacterium (1) Prevotella (4), Porphyromonas (2), Eubacterium (2) Fusobacterium (8) Streptococcus (3), Prevotella (2), Fusobacterium (2), Actinobacillus (1) Prevotella (5), Streptococcus (3) Streptococcus (3), Campylobacter (3), Prevotella (2) (Continued )
JOE — Volume 36, Number 2, February 2010
TABLE 1. (Continued ) Band no. 48 49 50 51 52 53
Genus (no. of clones) Prevotella (4), Fusobacterium (2), Eubacterium (1), Campylobacter (1) Fusobacterium (6), Eubacterium (1), Prevotella (1) Streptococcus (7), Prevotella (1) Prevotella (4), Streptococcus (2), Peptostreptococcus (1), Lactobacillus (1) Streptococcus (4), Prevotella (2), Veillonella (1), Lactobacillus (1) Prevotella (5), Anoxybacillus (2), Streptococcus (1)
those of culture-dependent or culture-independent studies. Brook et al (27) cultured purulence samples from acute periapical abscesses in 39 patients, including 6 children. The predominant isolates were Prevotella spp., Porphyromonas spp., Peptostreptococcus spp., and Fusobacterium spp. Siqueira et al (7) examined the occurrence of 49 bacterial species in purulence samples from acute periapical abscesses by using checkerboard DNA–DNA hybridization analysis and reported, in decreasing order of prevalence, that the species were Tannerella forsythensis (29.6%), Porphyromonas gingivalis (29.6%), Streptococcus constellatus (25.9%), Prevotella intermedia (22.2%), Prevotella nigrescens (22.2%), Fusobacterium periodonticum (18.5%), Fusobacterium nucleatum subspecies nucleatum (18.5%), and Eikenella corrodens (18.5%). Furthermore, acute orofacial odontogenic infections are primarily composed of gram-positive anaerobic cocci and anaerobic gram-negative rods. The most commonly isolated gram-positive cocci include Peptostreptococcus spp. and the Streptococcus anginosus group. The most frequently detected gram-negative rods within acute odontogenic infections include Prevotella spp., Porphyromonas spp., Tannerella forsythensis, and F. nucleatum (8, 28). Of particular significance in the current study was the abundance of the Prevotella genus from the purulence samples. In a recent study with PCR, cloning, and sequence analysis, Riggio et al (29) reported that the Prevotella genus constituted approximately half of all clones analyzed from 4 patients with spreading odontogenic infections. The precise role that Prevotella spp. play in acute periapical abscesses is unknown. Further work is necessary to elucidate the significance of their involvement in disease progression. Although some similarity was found between the bacteria studied by PCR-DGGE and by culture methods, anomalies did exist. For example, Treponema was present in 2 of 10 abscesses evaluated in this study. It is apparent that the prevalence of T. denticola in acute periapical abscesses had been underestimated because of its fastidiousness about growing on culture media. In contrast to the conventional culture procedures, molecular techniques do not depend on sampling under carefully controlled anaerobic conditions, do not require special transport media, and do not require cultivation of the isolates. In a recent study, Siqueira et al (7), by using checkerboard DNA–DNA hybridization, found that T. denticola was present in 1 of 27 acute periapical abscesses. Gomes et al (30) verified the occurrence of T. denticola in primary endodontic infections in 38% of the symptomatic cases with necrotic pulp tissues by nested PCR assay. Sassone et al (31) found that T. socranskii was present in 7 105 counts in symptomatic teeth with primary endodontic infections by using the checkerboard DNA–DNA hybridization method. By using PCR, Foschi et al (32) reported that T. denticola was detected in 24% of infected root canals and 56% of teeth with symptoms and radiolucency. The high prevalence of T. denticola in endodontic PCR-DGGE Analysis of Bacteria in Children With Acute Periapical Abscesses
221
Clinical Research TABLE 2. Distribution of bacteria identified according to genera by PCRDGGE, cloning, and sequence analysis of the 16S rRNA gene from purulence samples obtained from 11 children with acute periapical abscesses Genus Prevotella Fusobacterium Porphyromonas Lactobacillus Peptostreptococcus Streptococcus Eubacterium Campylobacter Treponema Bulleidia Actinobacillus Bacteroidales genomosp. P4 oral clone MB2_G17 Catonella Dialister Anoxybacillus Neisseria Veillonella
No. of clones analyzed (%) (N = 424) 102 (24.0) 75 (17.7) 59 (13.9) 48 (11.3) 35 (8.3) 27 (6.4) 16 (3.8) 14 (3.3) 11 (2.6) 11 (2.6) 9 (2.1) 8 (1.9) 3 (0.7) 2 (0.5) 2 (0.5 1 (0.2) 1 (0.2)
infections suggests that these bacteria are related to the etiology of acute periapical abscesses. Bulleidia have not been encountered in acute periapical abscesses by using culture methods. Another study reporting the molecular characterization of the microflora in acute periapical abscesses used the checkerboard DNA–DNA hybridization technique (7) by using whole genomic DNA probes for 49 cultured bacterial species to analyze the microflora of 27 acute periapical abscesses. In that study, Bulleidia were not investigated. In the present study, we found it in 11 of 424 clones (2.6%). In another study, purulence samples from 4 cases of spreading odontogenic infections were analyzed by PCR amplification, cloning, and sequencing of bacterial 16S rRNA genes, and Bulleidia represented 4% of clones analyzed (29). The PCR-DGGE procedure has an advantage in detecting the unexpected bacteria. The present study demonstrated the potential of DGGE for qualitative analysis of microbial constituents, including fastidious bacteria, in acute periapical abscesses, especially for revealing dominant bacteria. TABLE 3. Occurrence of bacteria identified according to genera by PCR-DGGE, cloning, and sequence analysis of 16S rRNA gene from purulence samples obtained from 11 children with acute periapical abscesses Genus
No. of patients (%) (N = 11)
Prevotella Fusobacterium Peptostreptococcus Porphyromonas Streptococcus Eubacterium Lactobacillus Campylobacter Treponema Bulleidia Catonella Actinobacillus Dialister Veillonella Neisseria Bacteroidales genomosp. P4 oral clone MB2_G17 Anoxybacillus
10 (90.9) 9 (81.8) 7 (63.6) 5 (45.5) 5 (45.5) 5 (45.5) 3 (27.3) 3 (27.3) 3 (27.3) 3 (27.3) 2 (18.2) 2 (18.2) 1 (9.1) 1 (9.1) 1 (9.1) 1 (9.1)
222
Yang et al.
1 (9.1)
These findings confirm that the etiology of acute periapical abscesses is polymicrobial and show that strict and facultative anaerobic bacterial infection is important in the pathogenesis of acute periapical abscesses.
Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (Grant 30572037 to Qiu-Bo Yang) and the Beijing Natural Science Foundation (Grant 7062028 to Qiu-Bo Yang).
References 1. Heimdahl A, Nord CE. Treatment of orofacial infections of odontogenic origin. Scand J Infect Dis Suppl 1985;46:101–5. 2. Kuriyama T, Absi EG, Williams DW. An outcome audit of the treatment of acute dentoalveolar infection: impact of penicillin resistance. Br Dent J 2005;198:759–63. 3. Peterson LJ. Principles of management and prevention of odontogenic infections. In: Peterson LJ, Ellis E, Hupp JR, Tucker MR, eds. Contemporary oral and maxillofacial surgery. St Louis: MO :Mosby; 1998:392–417. 4. Sandor GK, Low DE, Judd PL. Antimicrobial treatment options in the management of odontogenic infections. J Can Dent Assoc 1998;64:508–14. 5. Munson MA, Pitt-Ford T, Chong B. Molecular and cultural analysis of the microflora associated with endodontic infections. J Dent Res 2002;81:761–6. 6. Sakamoto M, Roˆc¸as IN, Siqueira JF Jr. Molecular analysis of bacteria in asymptomatic and symptomatic endodontic infections. Oral Microbiol Immunol 2006;21: 112–22. 7. Siqueira JF Jr, Roˆc¸as IN, Souto R. Microbiological evaluation of acute periradicular abscesses by DNA-DNA Hybridization. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2001;92:451–7. 8. Lewis MA, MacFarlane TW, McGowan DA. Quantitative bacteriology of acute dentoalveolar abscesses. J Med Microbiol 1986;21:101–4. 9. Wasfy MO, McMahon KT, Minah GE. Microbiological evaluation of periapical infections in Egypt. Oral Microbiol Immunol 1992;7:100–5. 10. Williams BL, McCann GF, Schoenknecht FD. Bacteriology of dental abscesses of endodontic origin. J Clin Microbiol 1983;18:770–4. 11. Sundqvist G, Johansson E, Sjo¨gren U. Prevalence of blackpigmented Bacteroides species in root canal infections. J Endod 1989;15:13–9. 12. Kuriyama T, Karasawa T, Nakagawa K. Bacteriologic features and antimicrobial susceptibility in isolates from orofacial odontogenic infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2000;90:600–8. 13. Brook I, Frazier EH, Gher ME Jr. Microbiology of periapical abscesses and associated maxillary sinusitis. J Periodontol 1996;67:608–10. 14. Muyzer G, de Waal EC, Uitterlinden AG. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 1993; 59:695–700. 15. Siqueira JF Jr, Roˆc¸as IN, Rosado AS. Application of denaturing gradient gel electrophoresis (DGGE) to the analysis of endodontic infections. J Endod 2005;31:775–82. 16. Alves FR, Siqueira JF Jr, Carmo FL. Bacterial community profiling of cryogenically ground samples from the apical and coronal root segments of teeth with apical periodontitis. J Endod 2009;35:486–92. 17. Siqueira JF Jr, Roˆc¸as IN, Debelian G. Profiling of root canal bacterial communities associated with chronic apical periodontitis from Brazilian and Norwegian subjects. J Endod 2008;34:1457–61. 18. Li Y, Ge Y, Saxena D. Genetic profiling of the oral microbiota associated with severe early-childhood caries. J Clin Microbiol 2007;45:81–7. 19. Torabinejad M, Walton RE. Periradicular lesions. In: Ingle JI, Bakland LK, eds. Endodontics. Baltimore, MD: Williams and Wilkins; 1994:439–64. 20. Burton JP, Cadieux PA, Reid G. Improved understanding of the bacterial vaginal microbiota of women before and after probiotic instillation. Appl Environ Microbiol 2003;69:97–101. 21. Stackebrandt E, Goebel BM. A place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol 1994;44:846–9. 22. Aas JA, Paster BJ, Stokes LN. Defining the normal bacterial flora of the oral cavity. J Clin Microbiol 2005;42:5721–32. 23. Rolph HJ, Lennon A, Riggio MP. Molecular identification of microorganisms from endodontic infections. J Clin Microbiol 2001;39:3282–9. 24. Siqueira JF Jr, Roˆc¸as IN. Exploiting molecular methods to explore endodontic infections: part 2–redefining the endodontic microbiota. J Endod 2005;31:488–98. 25. Siqueira JF Jr, Roˆc¸as IN, Rosado AS. Investigation of bacterial communities associated with asymptomatic and symptomatic endodontic infections by denaturing
JOE — Volume 36, Number 2, February 2010
Clinical Research gradient gel electrophoresis fingerprinting approach. Oral Microbiol Immunol 2004;19:363–70. 26. Machado de Oliveira JC, Siqueira JF Jr, Roˆc¸as IN. Bacterial community profiles of endodontic abscesses from Brazilian and USA subjects as compared by denaturing gradient gel electrophoresis analysis. Oral Microbiol Immunol 2007;22: 14–8. 27. Brook I, Frazier EH, Gher ME. Aerobic and anaerobic microbiology of acute periapical abscess. Oral Microbiol Immunol 1991;6:123–5. 28. Stefanopoulos PK, Kolokotronis AE. The clinical significance of anaerobia bacteria in acute orofacial odontogenic infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;98:398–408.
29. Riggio MP, Aga H, Murray CA. Identification of bacteria associated with spreading odontogenic infections by 16S rRNA gene sequencing. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2007;103:610–7. 30. Gomes BPFA, Montagner F, Jacinto RC. Polymerase chain reaction of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia in primary endodontic infections. J Endod 2007;33:1049–52. 31. Sassone LM, Fidel RA, Faveri M. A microbiological profile of symptomatic teeth with primary endodontic infections. J Endod 2008;34:541–5. 32. Foschi F, Cavrini F, Montebugnoli L. Detection of bacteria in endodontic samples by polymerase chain reaction assays and association with defined clinical signs in Italian patients. Oral Microbiol Immunol 2005;20:289–95.
JOE — Volume 36, Number 2, February 2010
PCR-DGGE Analysis of Bacteria in Children With Acute Periapical Abscesses
223
Polymerase Chain Reaction–Denaturing Gradient Gel Electrophoresis, Cloning, and Sequence Analysis of Bacteria Associated with Acute Periapical Abscesses in Children Qiu-Bo Yang, DDS, PhD,* Lu-Na Fan, DDS, MS,† and Qing Shi, DDS† Abstract Introduction: Polymerase chain reaction–denaturing gradient gel electrophoresis (PCR-DGGE), cloning, and sequencing were applied to the microbiologic study of acute periapical abscesses of endodontic origin in children to examine the predominant bacteria. Methods: Purulent material was collected from 11 children diagnosed with acute abscesses of endodontic origin, and DNA was extracted to evaluate the predominant bacteria by using PCR-DGGE, cloning, and sequence analysis. Results: Bacterial DNA was present in all of the 11 purulence samples. The microflora of clinical purulence samples were profiled by the PCR-DGGE method, and overall 17 bacterial genera were identified. The number of bacterial phylotypes in the purulence samples ranged from 1–8 (mean, 5.5). The most dominant genera found were Prevotella (24%), Fusobacterium (17.7%), Porphyromonas (13.9%), Lactobacillus (11.3%), Peptostreptococcus (8.3%), Streptococcus (6.4%), Eubacterium (3.8%), Campylobacter (3.3%), Treponema (2.6%), and Bulleidia (2.6%). Conclusions: The DGGE allowed visualization of the bacterial qualitative composition and revealed the major bacteria in the samples. The dominant bacteria associated with acute periapical abscess examined by PCR-DGGE, cloning, and sequencing methods are similar to those of culture-dependent studies. Although PCRDGGE, cloning, and sequencing methods detected some bacteria at lower proportions than are unreported by culture methods, the method has the disadvantage of low resolution and is too time-consuming and laborious and more expensive. (J Endod 2010;36:218–223)
Key Words Acute periapical abscess, endodontic microbiology, molecular biology, 16S rRNA gene
From the *Beijing Institute for Dental Research, †Department of Pediatric Dentistry, Capital Medical University School of Stomatology, Beijing, People’s Republic of China. Address requests for reprints to Dr Qing Shi, the Department of Pediatric Dentistry, Capital Medical University School of Stomatology, Tian Tan Xi Li No. 4, Chong Wen District, Beijing 100050, People’s Republic of China. E-mail address: dentshi@ yahoo.com.cn. 0099-2399/$0 - see front matter Copyright ª 2010 American Association of Endodontists. doi:10.1016/j.joen.2009.11.001
218
Yang et al.
A
n acute periapical abscess is an extension of infectious or necrotic pulp into the periapical area, which induces bone and tissue necrosis and accumulation of purulence. As the abscess develops, more tissue might be involved; particularly, it might provide a source of serious orofacial infection. Root canal treatment and drainage of purulence, which can be achieved by surgical incision or tooth extraction, are important in the treatment of acute periapical abscess. In addition, local drug administration can be used to improve the therapy outcome and prevent the spread of infection and onset of serious complications (1–4). The choice of the most eligible antimicrobial drug for acute periapical abscess should be based on the most probable microorganisms and susceptibility testing. Culture procedures have traditionally been used in the assessment of the bacteria associated with acute periapical abscess. Nonviable, uncultivable, slow-growing, or fastidious bacteria contribute to underestimation of microorganisms with culture methods. Studies investigating the bacterial diversity of the endodontic microbiota have revealed that 40%–55% of the taxa represent as yet uncultivated phylotypes, requiring a molecular approach to elucidate the composition of microflora associated with disease pathogenesis (5, 6). In contrast to conventional culture methods, molecular techniques have the advantage of often detecting uncultivable or difficult to grow bacteria. However, only expected species have been investigated with any frequency because the number of target bacteria is restricted for polymerase chain reaction (PCR) techniques or checkerboard DNA–DNA hybridization analysis (7). Many culturing studies reported that the microbiota associated with acute periapical abscesses are usually polymicrobial, with an average number of species ranging from <3–8.5 per purulence sample (8–12). Strict and facultative bacteria are the most frequently isolated, including members of the genera Porphyromonas, Streptococcus, Prevotella, Fusobacterium, Peptostreptococcus, and Eubacterium (13). Few studies have addressed the acute periapical abscess microbiota of deciduous teeth. PCR-based denaturing gradient gel electrophoresis (DGGE) has been one of the most commonly used techniques when fingerprinting microbial communities. With the DGGE approach, PCR-generated DNA fragments of the same length are separated according to nucleotide sequence specificity (14). PCR-DGGE has been used for the analysis of bacterial communities associated with different types of endodontic infections (15–17). Distinct amplicons can be excised from the gels, and these fragments of the 16S rRNA gene can be sequenced and analyzed against known sequences in an rRNA database (18). DGGE has great potential for revealing the dominant species that are seldom studied by PCR or checkerboard DNA–DNA hybridization analysis. The objective of this study, therefore, was to evaluate the microflora, including unculturable or fastidious bacteria, associated with acute periapical abscess in children by PCR-based 16S rRNA gene DGGE without the inherent biases of culture.
Materials and Methods Patients and Samples Purulence samples were obtained with parental informed consent from 11 patients with acute periapical abscesses seeking treatment at the Department of Pediatric Dentistry, Capital Medical University School of Stomatology, Beijing, China
JOE — Volume 36, Number 2, February 2010
Clinical Research (5 boys and 6 girls; age range, 5.4–7.6 years). The deciduous molars showed carious lesions, and radiographic evidence of periapical bone loss was included in this study. The status of pulp was diagnosed as necrosis or partial necrosis after the pulp was opened. Apical root resorption was less than 1/3 of the root length on standardized radiographs. Diagnosis of acute periapical abscess was based on the presence of spontaneous pain and localized fluctuation and swelling according to criteria established by Torabinejad and Walton (19). No apparent communication from the abscess to the oral cavity was observed. Before sample collection, the mucosa over each abscess was carefully cleaned with sterile cotton gauze to avoid salivary contamination of the sample. Purulence sample was collected from the abscesses by inserting paper points after the abscess was punctured with a blade. The paper points were placed into a tube containing 1 mL of phosphate-buffered saline (pH 7.4). The purulence samples were stored immediately at –20 C for DNA isolation.
DNA Extraction The collected purulence sample was released from the paper points by vigorous shaking in a mixer for 60 minutes. The total bacterial genomic DNA of each sample was isolated by means of a Wizard Genomic DNA Purification kit (Promega Corporation, Madison, WI) in accordance with the manufacturer’s instructions. In brief, 480 mL of 50 mmol/L ethylenediaminetetraacetic acid (EDTA), 60 mL of 10 mg/mL lysozyme, and 60 mL of 10 mg/mL lysostaphin were added to the cell pellet. That solution was incubated at 37 C for 1 hour and centrifuged to remove the supernatant. A total of 600 mL of Nuclei Lysis Solution was added to the pellet and incubated at 80 C for 5 minutes to lyse the cells. Three microliters of RNase Solution was then added, and the mixture was incubated at 37 C for 30 minutes. The samples were then placed on ice for 3–5 minutes, and 200 mL of protein precipitation reagent was added and vortex-mixed vigorously for 20 seconds; this was followed by an isopropanol precipitation procedure. The DNA was then washed and dried. The concentration of the purified DNA was determined by spectrophotometric measurement of the absorbance at 260 nm. DNA quality was assessed by the ratio of DNA to protein as measured by the ratio of the absorbances at 260 and 280 nm. PCR Assay The V2-V3 hypervariable region (240 base pair [bp]) of the 16S rRNA gene locus was amplified for all DNA extracts from bacteria in the specimens with a set of universal 16S rRNA sequence primers. A forward primer, with a 39-bp GC clamp at its 50 -end (HAD-1-GC, 50 CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAGCAGT-30 , nt 339-360 in the Escherichia coli 16S rRNA gene), and a reverse primer (HAD-2, 50 - GTATTACCGCGGCTGCTGGCAC -30 , nt 539-518 in the E. coli 16S rRNA gene) were prepared for the PCR (20). In the PCR, each reaction mixture (total volume, 50 mL) contained a standardized 100 ng of the total genomic DNA, 200 mmol/L of each deoxynucleoside triphosphate (Applied Biosystems, Foster City, CA), 50 pmol of HAD-1-GC and HAD-2 primers, 1.5 mmol/L MgCl2, 5 mL of 10 PCR buffer II, and 2.5 U of Taq DNA polymerase (Clontech, Mountain View, CA). The thermocycling program was as follows: 10 minutes at 95 C, then 35 cycles of 94 C for 1 minute, 56 C for 2 minutes, and 72 C for 1 minute, followed by 10 minutes at 72 C and a holding temperature of 4 C. All PCR procedures were performed with the GeneAmp PCR System 9700 (Applied Biosystems). PCR products were evaluated by electrophoresis in 1.5% agarose gels that were run at 60 V for 100 minutes, and the sizes of all amplicons were confirmed according to a molecular size standard. The quantity JOE — Volume 36, Number 2, February 2010
of each PCR-amplified product was measured with a UV spectrophotometer at 260 and 280 nm. The final concentration of each DNA sample was adjusted to 10 ng/mL for all DGGE applications.
DGGE Assay A standardized 35 mL of each PCR-amplified product was separated on gradient gels. A 30%–60% linear DNA denaturing gradient was formed in an 8% (wt/vol) polyacrylamide gel. PCR products were directly loaded in each lane and were run for 3 hours at 150 V in 1 TAE buffer (0.04 mol/L Tris-acetate/1 mmol/L EDTA, pH 8.5) at a constant temperature of 60 C. After electrophoresis, the gels were rinsed and stained for 30 minutes in 0.5 mg/mL GelRed (Biotium, Inc, Hayward, CA). The DGGE images were digitally captured and recorded (Fluor-S MultiImager; Bio-Rad, Hercules, CA). Cloning and 16S rRNA Gene Sequencing Distinct amplicons from DGGE gels for all samples were excised from the gels, and the excised DNA was eluted, purified, and reamplified with the same HAD-1-GC and HAD-2 primers but without the GC clamp. PCR products were cloned into a pGEM-T vector (Promega Corporation, Madison, WI) according to the manufacturer’s instructions. The transformed cells were then plated onto Luria-Bertani agar plates supplemented with kanamycin (50 mg/mL), and the plates were incubated overnight at 37 C. After cloning of the 16S rRNA gene product amplified by PCR for each excised DNA, 8 clones from each generated library were randomly selected. Plasmid DNA from recombinant clones was purified with the Qiagen Plasmid Purification Kit (Qiagen, Crawley, UK). Purified plasmid DNA with 16S rRNA gene inserts was sequenced with the ABI Prism cycle sequencing kit (Applied Biosystems) and universal T7 primer. The sequences of the 16S rRNA gene PCR amplicons obtained from the DGGE of acute periapical abscess samples were submitted to the BLASTN algorithm (BLAST 2.0; http://www.ncbi.nlm.nih.gov/blast), allowing comparison with sequences present in the GenBank databases. Only the highest-scored BLAST result was considered for phylotype identification, with 99% minimum similarity (21).
Results DGGE Banding Pattern DNA extracted from purulence samples was amplified by using primers directed toward the V2 to V3 regions of the 16S rRNA gene, and amplicons of the expected size were present in all samples as visualized on agarose gels. The DGGE profiles of the amplified 16S rRNA gene of acute periapical abscess samples are shown in Fig. 1. Profiles contained bands ranging from 3–8 (mean, 4.8) per sample, and efforts were made to excise and sequence all of them. The profiles of the predominant bacteria appeared to be unique for each individual. Sequence Analysis of the Individual Bands To determine the dominant bacteria in the specimens, the DGGE bands were cloned and sequenced. A total of 53 discrete PCR amplicons detected in the DGGE profiles were excised from the gels (Fig. 1), after which the DNA was purified, reamplified, and cloned. Eight clones were isolated and sequenced from each band (for a total of 424 clones). All sequence data for the clones allowed close matches with the presently existing sequences in GenBank. The similarity values of a clone’s sequences to the databases ranged between 99% and 100%. Data are summarized in Table 1. From the 424 sequences examined, 17 genera were identified, 67% of which were gram-negative, and 33% gram-positive. On average, 3.0 (1–5) genera per band sequenced were found. Two bands in PCR-DGGE Analysis of Bacteria in Children With Acute Periapical Abscesses
219
Clinical Research
Figure 1. DGGE profiles of PCR-amplified bacterial 16S rRNA gene segments and illustration of the DGGE bands cut for sequence analysis. The DGGE gel images were obtained from the total genomic DNA of the purulence samples of 11 children with acute periapical abscesses. For each individual lane, the number of detected amplicons ranged from 1–5, with a mean of 3.0. A total of 53 discrete PCR amplicons were excised from the DGGE gels, after which the DNA was extracted, reamplified, and cloned. A total of 424 clones were selected and sequenced, and 17 genera were identified.
distinct positions in the same sample were identified as Prevotella (99% similarity). In another clinical sample, 3 distinct bands were identified as Prevotella (99% similarity). The number of bacterial genera in the purulence samples ranged from 1–8 (mean, 5.5). Prevotella was the most dominant genus, representing 24% of analyzed clones, followed by Fusobacterium (17.7%). The next most dominant genera were Porphyromonas (13.9%), Lactobacillus (11.3%), Peptostreptococcus (8.3%), Streptococcus (6.4%), Eubacterium (3.8%), Campylobacter (3.3%), Treponema (2.6%), and Bulleidia (2.6%) (Table 2). In decreasing order of prevalence, the most prevalent phylotypes of bacteria found were Prevotella (90.9%), Fusobacterium (81.8%), Peptostreptococcus (63.6%), Porphyromonas (45.5%), Streptococcus (45.5%), Eubacterium (45.5%), Lactobacillus (27.3%), Campylobacter (27.3%), Treponema (27.3%), and Bulleidia (27.3%) (Table 3).
Discussion Previously, studies of microorganisms associated with periapical abscesses relied heavily on culture methods. Because about 50% of the microbiota in the oral cavity are uncultivable (22), conventional culture approaches are severely limited for investigation of uncultivable bacteria. In addition, nonviable or fastidious bacteria contribute to the failure of a culture method (5, 23, 24). Checkerboard DNA–DNA hybridization, a molecular technique, does not require culturing bacteria and has been applied in the investigation of pathogenic bacteria in oral infectious diseases. However, DNA–DNA hybridization usually detects only target microbial species. The PCR-DGGE procedure can detect unexpected or difficult to grow bacteria. Here, in an effort to contribute to the characterization of acute periapical abscess microbiota, we report the results of an investigation of the pathogenic bacteria of 11 acute periapical abscesses by using a PCR-DGGE, cloning, and sequence procedure. DGGE analysis allows easy and quick comparison of profiles from related microbial assemblages and is now used in many microbiologic studies. Furthermore, an advantage of DGGE is that selected bands can be cloned and sequenced, allowing identification of a specific phylotype. Bacterial 16S rRNA gene hypervariable regions (V1–V8) were characterized for differentiation among bacteria. V2 and V3 were most suitable for distinguishing bacterial species to 220
Yang et al.
the genus level. The sequence lengths generated from the DGGE gels are short (240 bp in this study), however, and sequence information from manually excised DGGE bands thus does not always allow reliable phylogenetic analyses, as compared with 1500 bp of the whole 16S DNA sequence. In this study, efforts have targeted investigating the bacterial composition of acute periapical abscesses through DGGE, cloning, and sequencing. The DGGE method allowed visualization of the bacterial qualitative composition of the purulence samples from the acute periapical abscesses. The profiles of the predominant bacterial composition appeared to be unique for each individual. All abscesses evaluated were positive for the presence of bacteria. In the 11 samples, multiple DGGE bands, varying in number from 3–8, were observed. Siqueira et al (25) used PCR-DGGE to examine the structure of bacterial communities in samples taken from asymptomatic and symptomatic endodontic infections. The mean number of bands in asymptomatic cases was 6.7 2.7 (range, 2–11), and it was 12.1 9.4 (range, 2–29) in asymptomatic cases. Machado de Oliveira et al (26) reported that the mean diversity of bands detected in the 16S rRNA gene community profiles of endodontic abscesses was 7.4 4 (range, 1–20) for Brazilian samples and 10.4 3.4 (range, 5–19) for U.S. samples. The number of bands in abscesses from adults was higher than that identified in the present study. The reason for these differences might be the different sensitivities of PCR-DGGE methods. In the previous 2 studies, the sensitivity of the staining and photography procedures for DGGE might have been greater than in our study. Extensive cloning and sequencing of bands from each patient were performed to identify dominant members of the microbial population. The identification of each amplicon was to the genus level because it is based on a partial 16S rRNA gene sequence, which is insufficient for species level assignment. Reamplification, cloning, and sequencing of amplicons recovered from the individual DGGE bands revealed that each band represented 3 phylotypes on average (range, 1–5). The findings indicated that the number of species per purulent sample in this study ranged from 1–8. This figure is comparable with those of other studies, which have observed a mean number of species in acute periapical abscesses of endodontic origin ranging from 3–8.5 (8–12). The results of our study with the molecular fingerprinting technique allowed visual confirmation of the findings of culture studies in which the microbiota associated with acute periapical abscesses are usually polymicrobial. On the basis of cloning and sequencing of the DGGE products, in all patients the predominant microorganisms were identified as strict and facultative anaerobic bacteria, a finding similar to those of other studies. In this study, aerobes were not detected in the purulence samples from the acute periapical abscesses. In contrast, Lewis et al (8) and Brook et al (27) isolated aerobes from periapical abscesses, although with less frequency and mixed with anaerobes. The possible reason for the discrepancy between the results of this study and of previous culture studies is that the aerobes were absent or were present in quantities below the threshold of the PCR-DGGE detection used in this study. Another explanation for the discrepancy between our current results and previous findings might be differences in sampling or patients in different studies. Some investigators have reported diversity in the compositions of microbiota in different individuals. Nevertheless, acute periapical abscesses harbored a far greater proportion of strict and facultative anaerobic bacteria than aerobic bacteria. In this study, the dominant taxa were Prevotella spp. (24.0%), Fusobacterium spp. (17.7%), Porphyromonas spp. (13.9%), Lactobacillus spp. (11.3%), Peptostreptococcus spp. (8.3%), and Streptococcus spp. (6.4%). The general microbial composition of the periapical abscesses examined in this study is in agreement with
JOE — Volume 36, Number 2, February 2010
Clinical Research TABLE 1. Identification of genera in the DGGE bands cut for sequence analysis Band no. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47
Genus (no. of clones) Lactobacillus (8) Lactobacillus (8) Lactobacillus (6), Prevotella (2) Bacteroidales genomosp. P4 oral clone MB2_G17 (8) Porphyromonas (8) Porphyromonas (6), Fusobacterium (2) Treponema (4), Fusobacterium (4) Prevotella (5), Treponema (1), Fusobacterium (1), Peptostreptococcus (1) Porphyromonas (3), Prevotella (3), Catonella (2) Porphyromonas (4), Prevotella (4) Porphyromonas (6), Prevotella (2) Peptostreptococcus (3), Porphyromonas (2), Treponema (2), Prevotella (1) Peptostreptococcus (3), Prevotella (2), Campylobacter (2), Treponema (1) Campylobacter (4), Peptostreptococcus (1), Prevotella (1), Treponema (1), Streptococcus (1) Eubacterium (5), Peptostreptococcus (1), Prevotella (1) ,Campylobacter (1) Eubacterium (5), Prevotella (1), Fusobacterium (1), Treponema (1) Lactobacillus (8) Lactobacillus (8) Lactobacillus (8) Prevotella (4), Porphyromonas (2), Fusobacterium (1), Peptostreptococcus (1) Fusobacterium (4), Porphyromonas (3), Peptostreptococcus (1) Bulleidia (6), Fusobacterium (1), Prevotella (1) Peptostreptococcus (8) Porphyromonas (8) Peptostreptococcus (5), Prevotella (3) Fusobacterium (8) Peptostreptococcus (4), Prevotella (1), Streptococcus (1), Fusobacterium (1), Dialister (1) Prevotella (4), Bulleidia (3), Dialister (1) Prevotella (6), Fusobacterium (1), Eubacterium (1) Prevotella (3), Fusobacterium (3), Peptostreptococcus (2) Fusobacterium (7), Prevotella (1) Porphyromonas (4), Fusobacterium (4) Peptostreptococcus (3), Prevotella (3), Fusobacterium (2) Prevotella (4), Bulleidia (2), Fusobacterium (1), Porphyromonas (1) Fusobacterium (4), Prevotella (2), Porphyromonas (2) Fusobacterium (6), Prevotella (1), Catonella (1) Prevotella (8) Prevotella (4), Streptococcus (2), Fusobacterium (1), Neisseria (1) Porphyromonas (6), Actinobacillus (1), Fusobacterium (1) Actinobacillus (6), Fusobacterium (2) Prevotella (3), Fusobacterium (2), Peptostreptococcus (1), Actinobacillus (1), Treponema (1) Campylobacter (3), Prevotella (2), Porphyromonas (2), Eubacterium (1) Prevotella (4), Porphyromonas (2), Eubacterium (2) Fusobacterium (8) Streptococcus (3), Prevotella (2), Fusobacterium (2), Actinobacillus (1) Prevotella (5), Streptococcus (3) Streptococcus (3), Campylobacter (3), Prevotella (2) (Continued )
JOE — Volume 36, Number 2, February 2010
TABLE 1. (Continued ) Band no. 48 49 50 51 52 53
Genus (no. of clones) Prevotella (4), Fusobacterium (2), Eubacterium (1), Campylobacter (1) Fusobacterium (6), Eubacterium (1), Prevotella (1) Streptococcus (7), Prevotella (1) Prevotella (4), Streptococcus (2), Peptostreptococcus (1), Lactobacillus (1) Streptococcus (4), Prevotella (2), Veillonella (1), Lactobacillus (1) Prevotella (5), Anoxybacillus (2), Streptococcus (1)
those of culture-dependent or culture-independent studies. Brook et al (27) cultured purulence samples from acute periapical abscesses in 39 patients, including 6 children. The predominant isolates were Prevotella spp., Porphyromonas spp., Peptostreptococcus spp., and Fusobacterium spp. Siqueira et al (7) examined the occurrence of 49 bacterial species in purulence samples from acute periapical abscesses by using checkerboard DNA–DNA hybridization analysis and reported, in decreasing order of prevalence, that the species were Tannerella forsythensis (29.6%), Porphyromonas gingivalis (29.6%), Streptococcus constellatus (25.9%), Prevotella intermedia (22.2%), Prevotella nigrescens (22.2%), Fusobacterium periodonticum (18.5%), Fusobacterium nucleatum subspecies nucleatum (18.5%), and Eikenella corrodens (18.5%). Furthermore, acute orofacial odontogenic infections are primarily composed of gram-positive anaerobic cocci and anaerobic gram-negative rods. The most commonly isolated gram-positive cocci include Peptostreptococcus spp. and the Streptococcus anginosus group. The most frequently detected gram-negative rods within acute odontogenic infections include Prevotella spp., Porphyromonas spp., Tannerella forsythensis, and F. nucleatum (8, 28). Of particular significance in the current study was the abundance of the Prevotella genus from the purulence samples. In a recent study with PCR, cloning, and sequence analysis, Riggio et al (29) reported that the Prevotella genus constituted approximately half of all clones analyzed from 4 patients with spreading odontogenic infections. The precise role that Prevotella spp. play in acute periapical abscesses is unknown. Further work is necessary to elucidate the significance of their involvement in disease progression. Although some similarity was found between the bacteria studied by PCR-DGGE and by culture methods, anomalies did exist. For example, Treponema was present in 2 of 10 abscesses evaluated in this study. It is apparent that the prevalence of T. denticola in acute periapical abscesses had been underestimated because of its fastidiousness about growing on culture media. In contrast to the conventional culture procedures, molecular techniques do not depend on sampling under carefully controlled anaerobic conditions, do not require special transport media, and do not require cultivation of the isolates. In a recent study, Siqueira et al (7), by using checkerboard DNA–DNA hybridization, found that T. denticola was present in 1 of 27 acute periapical abscesses. Gomes et al (30) verified the occurrence of T. denticola in primary endodontic infections in 38% of the symptomatic cases with necrotic pulp tissues by nested PCR assay. Sassone et al (31) found that T. socranskii was present in 7 105 counts in symptomatic teeth with primary endodontic infections by using the checkerboard DNA–DNA hybridization method. By using PCR, Foschi et al (32) reported that T. denticola was detected in 24% of infected root canals and 56% of teeth with symptoms and radiolucency. The high prevalence of T. denticola in endodontic PCR-DGGE Analysis of Bacteria in Children With Acute Periapical Abscesses
221
Clinical Research TABLE 2. Distribution of bacteria identified according to genera by PCRDGGE, cloning, and sequence analysis of the 16S rRNA gene from purulence samples obtained from 11 children with acute periapical abscesses Genus Prevotella Fusobacterium Porphyromonas Lactobacillus Peptostreptococcus Streptococcus Eubacterium Campylobacter Treponema Bulleidia Actinobacillus Bacteroidales genomosp. P4 oral clone MB2_G17 Catonella Dialister Anoxybacillus Neisseria Veillonella
No. of clones analyzed (%) (N = 424) 102 (24.0) 75 (17.7) 59 (13.9) 48 (11.3) 35 (8.3) 27 (6.4) 16 (3.8) 14 (3.3) 11 (2.6) 11 (2.6) 9 (2.1) 8 (1.9) 3 (0.7) 2 (0.5) 2 (0.5 1 (0.2) 1 (0.2)
infections suggests that these bacteria are related to the etiology of acute periapical abscesses. Bulleidia have not been encountered in acute periapical abscesses by using culture methods. Another study reporting the molecular characterization of the microflora in acute periapical abscesses used the checkerboard DNA–DNA hybridization technique (7) by using whole genomic DNA probes for 49 cultured bacterial species to analyze the microflora of 27 acute periapical abscesses. In that study, Bulleidia were not investigated. In the present study, we found it in 11 of 424 clones (2.6%). In another study, purulence samples from 4 cases of spreading odontogenic infections were analyzed by PCR amplification, cloning, and sequencing of bacterial 16S rRNA genes, and Bulleidia represented 4% of clones analyzed (29). The PCR-DGGE procedure has an advantage in detecting the unexpected bacteria. The present study demonstrated the potential of DGGE for qualitative analysis of microbial constituents, including fastidious bacteria, in acute periapical abscesses, especially for revealing dominant bacteria. TABLE 3. Occurrence of bacteria identified according to genera by PCR-DGGE, cloning, and sequence analysis of 16S rRNA gene from purulence samples obtained from 11 children with acute periapical abscesses Genus
No. of patients (%) (N = 11)
Prevotella Fusobacterium Peptostreptococcus Porphyromonas Streptococcus Eubacterium Lactobacillus Campylobacter Treponema Bulleidia Catonella Actinobacillus Dialister Veillonella Neisseria Bacteroidales genomosp. P4 oral clone MB2_G17 Anoxybacillus
10 (90.9) 9 (81.8) 7 (63.6) 5 (45.5) 5 (45.5) 5 (45.5) 3 (27.3) 3 (27.3) 3 (27.3) 3 (27.3) 2 (18.2) 2 (18.2) 1 (9.1) 1 (9.1) 1 (9.1) 1 (9.1)
222
Yang et al.
1 (9.1)
These findings confirm that the etiology of acute periapical abscesses is polymicrobial and show that strict and facultative anaerobic bacterial infection is important in the pathogenesis of acute periapical abscesses.
Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (Grant 30572037 to Qiu-Bo Yang) and the Beijing Natural Science Foundation (Grant 7062028 to Qiu-Bo Yang).
References 1. Heimdahl A, Nord CE. Treatment of orofacial infections of odontogenic origin. Scand J Infect Dis Suppl 1985;46:101–5. 2. Kuriyama T, Absi EG, Williams DW. An outcome audit of the treatment of acute dentoalveolar infection: impact of penicillin resistance. Br Dent J 2005;198:759–63. 3. Peterson LJ. Principles of management and prevention of odontogenic infections. In: Peterson LJ, Ellis E, Hupp JR, Tucker MR, eds. Contemporary oral and maxillofacial surgery. St Louis: MO :Mosby; 1998:392–417. 4. Sandor GK, Low DE, Judd PL. Antimicrobial treatment options in the management of odontogenic infections. J Can Dent Assoc 1998;64:508–14. 5. Munson MA, Pitt-Ford T, Chong B. Molecular and cultural analysis of the microflora associated with endodontic infections. J Dent Res 2002;81:761–6. 6. Sakamoto M, Roˆc¸as IN, Siqueira JF Jr. Molecular analysis of bacteria in asymptomatic and symptomatic endodontic infections. Oral Microbiol Immunol 2006;21: 112–22. 7. Siqueira JF Jr, Roˆc¸as IN, Souto R. Microbiological evaluation of acute periradicular abscesses by DNA-DNA Hybridization. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2001;92:451–7. 8. Lewis MA, MacFarlane TW, McGowan DA. Quantitative bacteriology of acute dentoalveolar abscesses. J Med Microbiol 1986;21:101–4. 9. Wasfy MO, McMahon KT, Minah GE. Microbiological evaluation of periapical infections in Egypt. Oral Microbiol Immunol 1992;7:100–5. 10. Williams BL, McCann GF, Schoenknecht FD. Bacteriology of dental abscesses of endodontic origin. J Clin Microbiol 1983;18:770–4. 11. Sundqvist G, Johansson E, Sjo¨gren U. Prevalence of blackpigmented Bacteroides species in root canal infections. J Endod 1989;15:13–9. 12. Kuriyama T, Karasawa T, Nakagawa K. Bacteriologic features and antimicrobial susceptibility in isolates from orofacial odontogenic infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2000;90:600–8. 13. Brook I, Frazier EH, Gher ME Jr. Microbiology of periapical abscesses and associated maxillary sinusitis. J Periodontol 1996;67:608–10. 14. Muyzer G, de Waal EC, Uitterlinden AG. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 1993; 59:695–700. 15. Siqueira JF Jr, Roˆc¸as IN, Rosado AS. Application of denaturing gradient gel electrophoresis (DGGE) to the analysis of endodontic infections. J Endod 2005;31:775–82. 16. Alves FR, Siqueira JF Jr, Carmo FL. Bacterial community profiling of cryogenically ground samples from the apical and coronal root segments of teeth with apical periodontitis. J Endod 2009;35:486–92. 17. Siqueira JF Jr, Roˆc¸as IN, Debelian G. Profiling of root canal bacterial communities associated with chronic apical periodontitis from Brazilian and Norwegian subjects. J Endod 2008;34:1457–61. 18. Li Y, Ge Y, Saxena D. Genetic profiling of the oral microbiota associated with severe early-childhood caries. J Clin Microbiol 2007;45:81–7. 19. Torabinejad M, Walton RE. Periradicular lesions. In: Ingle JI, Bakland LK, eds. Endodontics. Baltimore, MD: Williams and Wilkins; 1994:439–64. 20. Burton JP, Cadieux PA, Reid G. Improved understanding of the bacterial vaginal microbiota of women before and after probiotic instillation. Appl Environ Microbiol 2003;69:97–101. 21. Stackebrandt E, Goebel BM. A place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol 1994;44:846–9. 22. Aas JA, Paster BJ, Stokes LN. Defining the normal bacterial flora of the oral cavity. J Clin Microbiol 2005;42:5721–32. 23. Rolph HJ, Lennon A, Riggio MP. Molecular identification of microorganisms from endodontic infections. J Clin Microbiol 2001;39:3282–9. 24. Siqueira JF Jr, Roˆc¸as IN. Exploiting molecular methods to explore endodontic infections: part 2–redefining the endodontic microbiota. J Endod 2005;31:488–98. 25. Siqueira JF Jr, Roˆc¸as IN, Rosado AS. Investigation of bacterial communities associated with asymptomatic and symptomatic endodontic infections by denaturing
JOE — Volume 36, Number 2, February 2010
Clinical Research gradient gel electrophoresis fingerprinting approach. Oral Microbiol Immunol 2004;19:363–70. 26. Machado de Oliveira JC, Siqueira JF Jr, Roˆc¸as IN. Bacterial community profiles of endodontic abscesses from Brazilian and USA subjects as compared by denaturing gradient gel electrophoresis analysis. Oral Microbiol Immunol 2007;22: 14–8. 27. Brook I, Frazier EH, Gher ME. Aerobic and anaerobic microbiology of acute periapical abscess. Oral Microbiol Immunol 1991;6:123–5. 28. Stefanopoulos PK, Kolokotronis AE. The clinical significance of anaerobia bacteria in acute orofacial odontogenic infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;98:398–408.
29. Riggio MP, Aga H, Murray CA. Identification of bacteria associated with spreading odontogenic infections by 16S rRNA gene sequencing. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2007;103:610–7. 30. Gomes BPFA, Montagner F, Jacinto RC. Polymerase chain reaction of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia in primary endodontic infections. J Endod 2007;33:1049–52. 31. Sassone LM, Fidel RA, Faveri M. A microbiological profile of symptomatic teeth with primary endodontic infections. J Endod 2008;34:541–5. 32. Foschi F, Cavrini F, Montebugnoli L. Detection of bacteria in endodontic samples by polymerase chain reaction assays and association with defined clinical signs in Italian patients. Oral Microbiol Immunol 2005;20:289–95.
JOE — Volume 36, Number 2, February 2010
PCR-DGGE Analysis of Bacteria in Children With Acute Periapical Abscesses
223