Polymethoxylated flavones from Orthosiphon stamineus leaves as antiadhesive compounds against uropathogenic E. coli

Journal Pre-proof Polymethoxylated flavones from Orthosiphon stamineus leaves as antiadhesive compounds against uropathogenic E. coli

Melanie Deipenbrock, Andreas Hensel PII:

S0367-326X(19)31835-0

DOI:

https://doi.org/10.1016/j.fitote.2019.104387

Reference:

FITOTE 104387

To appear in:

Fitoterapia

Received date:

12 September 2019

Revised date:

17 October 2019

Accepted date:

20 October 2019

Please cite this article as: M. Deipenbrock and A. Hensel, Polymethoxylated flavones from Orthosiphon stamineus leaves as antiadhesive compounds against uropathogenic E. coli, Fitoterapia (2019), https://doi.org/10.1016/j.fitote.2019.104387

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof

Research Article

of

Polymethoxylated flavones from Orthosiphon stamineus leaves as antiadhesive

1

na

lP

Melanie Deipenbrock1 , Andreas Hensel1

re

-p

ro

compounds against uropathogenic E. coli

University of Münster, Institute of Pharmaceutical Biology and Phytochemistry,

Jo

ur

Corrensstraße 48, D-48149 Münster, Germany

Correspondence Prof. Dr. Andreas Hensel, Institute of Pharmaceutical Biology and Phytochemistry, University of Münster, Corrensstrasse 48, D-48149 Münster, Germany Phone: +49 251 8333380, Fax: +49 838341 ahensel@uni- muenster.de

Journal Pre-proof

Abstract Aqueous and acetone extracts of O. stamineus leaves reduce the adhesion of uropathogenic E. coli (UPEC, strain UTI89) to T24 bladder cells significantly (IC25 ~ 524 mg/mL, resp.

40

μg/mL). The acteonic extract had no cytotoxic effects against UPEC in concentrations that inhibited the bacterial adhesion. The extract significantly reduced the gene expression of fimH,

of

fimC, fimD, csgA and focG, which are strongly involved in the formation of bacterial adhesins. The antiadhesive effect was due to the presence of polymethoxylated flavones, enriched in the

followed

by

preparative

HPLC.

Eupatorin,

ro

acetonic extract. Five flavones have been isolated by fast centrifugal partition chromatography, ladanein,

salvigenin,

sinensetin,

5,6,7,4’-

-p

tetramethoxyflavone and 5-hydroxy-6,7,3’,4’-tetramethoxyflavone were identified as the main

re

polymethoxylated flavones. With the exception of eupatorin, all of these flavones reduced the bacterial adhesion in a concentration depending manner, indicating that B-ring hydroxylation and

lP

methoxylation seems to have a major impact on the antiadhesive activity. In addition, this was confirmed by investigation of the flavones chrysoeriol and diosmetin, which had only very weak

na

antiadhesive activity. From these data, Orthosiphon extracts can be assessed to have a pronounced antiadhesive activity against UPEC, based on a variety of polymethoxylated

Keywords

Jo

ur

flavones.

Orthosiphon stamineus, adhesion, flavone, sinensetin, uropathogenic E. coli.

Journal Pre-proof

Abbreviations DMEM: Dulbecco’s Modified Eagle Medium with high glucose and L-glutamine, FCPC: fast centrifugal partition chromatography, FCS: fetal calf serum, FITC: fluorescein isothiocyanate, IBC: intracellular bacterial communities; OAE: Orthosiphon acetone extract, OWE: Orthosiphon aqueous extract, PMF: polymethoxylated flavones, TMF: tetramethoxyflavone, UHPLC: ultrahigh pressure liquid chromatography, UPEC: uropathogenic E. coli, UTI: urinary tract

-p

ro

of

infection.

re

1. Introduction

lP

Urinary tract infections (UTI) are one of the most common infections with an estimated incidence of more than 150 Million per year [1]. Women represent the most affected group with a lifetime

na

risk of symptomatic UTI of 60 % [2] due to anatomic reasons, but probably also due to lower innate immune defense (e.g. Tamm-Horsfall Protein) in the lower urinary tracts [3]. The infection

ur

is caused mainly by uropathogenic Escherichia coli (UPEC). Other Gram-neagtive bacteria as e.g. Enterococcus faecialis, group B Streptococci, Klebsiella pneumonia, Proteus mirabilis,

Jo

Pseudomonas aeruginosa, Staphylococcus saprophyticus or fungi, mainly Candida albicans, contribute to clinical manifestation of UTI. Bladder infection by UPEC is initiated by the bacterial adhesion to the superficial facet cells of the bladder epithelium, mainly by fimbriae-associated proteins, as either the mannose-sensitive type 1 fimbriae (FimH, interaction with the complementary, highly mannosylated uroplactin of the host cells) or the digalactosid-binding P fimbriae. Additionally, afimbrial Afa/Dr adhesins for review see [4] - contribute to the adhesion to the epithelial cells. Binding of UPEC with the decay accelerating factor (DAF) protein promotes subsequent bacterial internalization into the host cells [5]. Following invasion, UPEC can proliferate within the bladder or kidney cells, forming biofilmlike

intracellular

bacterial communities

(IBC).

IBCs,

which

undergo

a typical 3-step

Journal Pre-proof differentiation process [6] protect UPEC from excretion by the urine flow [7] and from the host defense [3,6]. In cases of UPEC elimination from the superficial umbrella cells, the bacteria can reenter the IBC developmental cycle and ultimately establish a quiescent reservoir of IBCs; for review see [8]. UPEC-induced exfoliation of the bladder cells will lead to strong inflammation and reduces the bacterial load in the bladder epithelium. Despite the strong host defense, UPEC can remain within the bladder for an indefinite period of time without causing any symptoms, serving as a seed for recurrent infections [9]. High recurrence rates and increasing resistance against antibiotics are major problems in the

of

treatment of UTI and necessitate new therapeutic strategies against UPEC. Especially targeting

ro

the specific recognition of the host cell, the receptor-mediated adhesion to the host cell surface and the subsequent invasion process are assessed as promising new targets for combating UPEC

-p

and UTI.

re

The use of leaves from Orthosiphon stamineus Benth. (Lamiaceae) for UTI within rationalized modern phytotherapy is based on governmental monographs for formalized drug registration

lP

within the “Traditional Use” frame by the European Medicine Agency (HMPC Monograph, 2016) and the European Scientific Cooperative on Phytotherapy [10]. Leaves from O. stamineus 0.5

to

0.7

eupatorinmethylether,

of

flavonoids,

rhamnazin,

salvigenin,

especially

methoxylated

scutellareintetramethylether,

flavones

(eupatorin,

sinensetin)

[11],

flavones [12], the flavonol eupatoretin, rosmarinic acid and di-caffeoyltartrat,

ur

prenylated

%

na

contain

Jo

diterpens, mainly the isopimaran derivatives orthosiphole A to Y [13], seco-orthosiphole A to C, siphonol A to E 7, neio-orthosiphonon A 8, epi-orthosiphol N9, besides several triterpens and about 0.04 % of volatile oil [10].

In vitro investigations indicated significant and concentration

dependent antiadhesive activity of an aqueous extract against UPEC [14]. This extract did not influence the proliferation of various UPEC strains and did not inhibit the viability of human bladder and kidney cells [14]. The extract inhibited the bacterial quorum sensing and reduced expression of fimH [14]. This seems to be due to a strong inhibition of the chaperone usher pathway, responsible for the formation and functionalization of the type 1 fimbriae [15]. The extract increased the expression of the motility/fitness-associated gene fliC, which changed also the phenotypes towards an increased bacterial motility of the bacteria. In vivo animal experiments within a mouse infection model proved significant anti-infective effects of aqueous Orthosiphon extract, which resulted in reduced bacterial load in bladder and kidney tissue after transurethral

Journal Pre-proof infection of the animals with UPEC [14]. From these data, Orthosiphon extract can be assessed as a strong antiadhesive plant extract for which the clinical use in phytotherapy for UTI might be justified [14]. On the other side, no data are available to clarify the question which secondary products from Orthosiphon extract are responsible for this antiadhesive and antivirulence effects of UPEC. Therefore, the following study aimed to perform bioassay-guided fractionation towards antiadhesive compounds from the leaves of O. stamineus.

of

2. Material and Methods

ro

2.1 Material

-p

If not stated otherwise, solvents and reagents were of analytical quality and obtained from VWR International (Darmstadt, Germany). Consumables were obtained from Sarstedt (Nümbrecht,

re

Germany). Water was produced by a Millipore simplicity 185 system (Merck, Darmstadt, Germany). Sinensetin was from PhytoLab (Vestenbergsgreuth, Germany), chrysoeriol and

lP

diosmetin from Carl-Roth (Karlsruhe, Germany).

na

Dried leaves from O. stamineus, batch No. 14017592, were obtained from Martin Bauer (Vestenbergsgreuth, Germany). A voucher specimen is documented in the archives of the

designation IPBP 493.

ur

University of Münster, Institute of Pharmaceutical Biology and Phytochemistry under the

Jo

2.2 Preparation of aqueous Orthosiphon extract (OWE) 300 g dried leaves from O. stamineus were extracted 2  with 3.5 L of water at 85 °C under stirring for 2 h each. The suspension was filtrated and centrifuged for 10 min at 2000 × g. Subsequently the extract was concentrated under vacuo, followed by lyophilisation, yielding 49.8 g (16.6 %) dried extract, named in the following as OWE. The herbal material : extract ratio accounts for 6 : 1. 2.3 Preparation of Orthosiphon acetone extract (OAE) 50 g dried leaves from O. stamineus were extracted 3  with 500 mL acetone under ice cooling by UltraTurrax® for 5 min at 16 000 rpm. The suspension was filtrated and centrifuged for 10 min

Journal Pre-proof at 2000 × g. Subsequently, the extract was dried under vacuo, yielding 1.65 g (3.3 %) of dried extract, named in the following as OAE. The herbal material : extract ratio accounts for 30 : 1. 2.4 UHPLC analysis of OWE and OAE 5.0 mg of OWE were dissolved in 1.0 mL water (Aqua Millipore), while 5.0 mg of OAE were dissolved in 1.0 mL acetonitrile. The solutions were filtered (PP-membrane, 0,45 µm) and subjected to the analytical UHPLC AcquityT M Ultra Performance LC System with autosampler and in-line degasser on a RP-18 stationary phase Acquity UPLC HSS T3, 1.8 µm, 2,1 × 100 mm

of

(Waters, Milford, Milwaukee, USA). Eluted compounds were detected by PDA λe detector (λ = 210 – 400 nm) and QDaT M mass-selective detector (positive and negative scan mass 150.00

ro

– 750.00 Da). Column temperature: 40 °C. Mobile phase was made of (A) water + formic acid

-p

0.1 %) and (B) acetonitrile + formic acid; gradient: t0min : 98 % A, t2min : 98 % A, t13min : 0 % A, t14.5min : 0 % A, t14.6min : 98 % A, t15min : 98 % A. Flow rate: 0.4 mL/min. Injection volume: 5 µL.

lP

re

Data were analysed using Waters Empower 3® (Waters, Milford, Milwaukee, USA).

2.5 LC-qTOF-MS analysis of the isolated compounds

performed.

LC-qTOF-MS analysis was

na

For determining the exact mass of the isolated compounds

ur

Compounds were dissolved in acetonitrile and subjected to a Dionex Ultimate 3000 RS LC System (Thermo Fisher, Oberhausen, Germany) on a Dionex Acclaim RSLC 120 C18 column

Jo

(2.1 × 100 mm, 2.2 µm). Eluted compounds were detected using a Dionex Ultimate DAD-3000 RS detector (λ = 200 – 400 nm) and Bruker Daltonics micrOTOF-QII time-of-flight mass spectrometer (Bruker, Bremen, Germany) equipped with an Apollo electorspray ionisation source in positive mode at 3 Hz (m/z: 50 – 1500) using the following instrument settings: nebulizer gas nitrogen, 4 bar; dry gas nitrogen, 9 L/min, 200 °C; capillary voltage -4500 V; end plate offset 500 V; transfer time 100 µs; prepulse storage 6 µs; collision gas nitrogen; collision energy 40 eV; collision RF 130 Vpp. Internal dataset calibration (HPC mode) was performed for each analysis using the mass spectrum of a 10 mM solution of sodium formiate in 50 % isopropanol that was infused during LC reequilibration using a divert valve equipped with a 20 µL sample loop. Mobile phase was made of (A) water + formic acid 0.1 %) and (B) acetonitrile + formic acid; gradient: t0min : 95 % A, t0.4min : 95 % A, t9,9min : 0 % A, t15min : 0 % A, t15.1min : 95 % A, t20min : 95 %

Journal Pre-proof A. Flow rate: 0.4 mL/min. Injection volume: 2 µL. Data were analysed using Bruker DataAnalysis 4.1 SP5.

2.6 Fast Centrifugal Partition Chromatgraphy (FCPC) FCPC was performed on a FCPC A 200 system (Kromaton, Annonay, France) using the solvent system hexane:ethylacetate:methanol:water 5:5:5:5, ascending mode (upper phase = mobile phase, lower phase = stationary phase), 1210 rpm, flow rate: 3 mL/min, fraction size: 9 mL,

of

390 min incl. extrusion. The fractionation was performed in three independent runs, with each

ro

time 1 g of the extract dissolved in 10 mL of the mobile phase. Nine subfractions were obtained.

-p

2.7 Isolation of polymethoxylated flavones by preparative HPLC

re

Isolation of flavonoids from the subfractions was performed by preparative HPLC using Eurospher® 100 C/8 7 µm, 250 × 20 mm stationary phase (VDS Optilab, Berlin, Germany),

lP

Waters 996 Photodiode Array Detector, Waters Pump Control Module, Waters 515 HPLC pumps (A and B), Degasys DG-2487. Flow rate: 5 mL/min, detection wavelength: λ = 210-390 nm,

characterized

for

their

na

mobile phase: various water-acetonitrile gradients. respective

The following compounds were isolated and

structural

features:

III-5:

5-hydroxy-6,7,3’,4’-

ur

tetramethoxyflavone (5-hydroxy-6,7,3’,4’-TMF) yield: 2.2 mg; m/z = 359.1179 [M + H]+ (calculated m/z = 359.1125 [M + H]+); III-6: 5-hydroxy-6,7,4’-trimethoxyflavone (salvigenin)

Jo

yield: 4.6 mg; m/z = 329.1037 [M + H]+ (calculated m/z = 329.1020 [M + H]+); V-4: 5,6,7,4’tetramethoxyflavone (5,6,7,4’-TMF) yield: 3.6 mg; m/z = 343.1193 [M + H]+ (calculated m/z = 343.1176 [M + H]+); VI-1: 3’5-dihydroxy-4’6,7-trimethoxyflavone (eupatorin) yield: 5.5 mg; m/z = 345.1009 [M + H]+ (calculated m/z = 345.0969 [M + H]+); VI-3: 5,6-dihydroxy-7,4’dimethoxyflavone (ladanein) yield: 3.4 mg; m/z = 315.0893 [M + H]+ (calculated m/z = 315.0863 [M + H]+). 2.8 NMR spectroscopy For identification of the isolated compounds one- and two-dimensional NMR spectra were recorded by an Agilent DD2 400 MHz or 600 MHz spectrometer (Agilent, Santa Clara, USA). Compounds were dissolved in either chloroform-d 99.8 % or methanol-d4 99.8 % (both from

Journal Pre-proof Sigma-Aldrich, Steinheim, Germany). Solvent peaks were set as references at 7.260 ppm for 1 HNMR and 77.160 ppm for ppm for

13

13

C-NMR of chloroform and at 4.870 ppm for 1 H-NMR and 49.000

C-NMR of methanol. Detailed NMR data sets and the original spectra of compounds

III-5, III-6, V-4, VI-1, and VI-3 are displayed in the Supplementary Data File.

2.9 Methods of microbiology and cell biology Cell lines: T24 bladder cells (ATCC HTB-4) are a human epithelial cell line from a bladder carcinoma of an 82 years old Swedish female [16], which has been established for in vitro

of

adhesion and invasion assays with UPEC [17]. The cultivation of the cells was performed in

ro

Dulbecco’s Modified Eagle Medium with high glucose and L-glutamine (DMEM) (Biochrom GmbH, Berlin, Germany), supplemented with 10 % FCS (Biochrom GmbH, Berlin, Germany)

-p

and 0.5 % penicillin/streptomycin (Biochrom GmbH, Berlin, Germany) at 37 °C and 5 % CO 2 .

re

Bacterial strains: UPEC strain UTI89 (NCBI: txid364106) [18], a clinical cystitis isolate, was kindly provided by Prof. Dobrindt (University of Münster, Germany). Cultivation was performed

lP

by incubation of bacteria from frozen stocks at 37  °C for 24 or for 48 h on UPEC agar (AgarAgar 15 g, Bacto Tryptone 10 g, NaCl 8 g, glucose 1 g, yeast extract 1 g, CaCl2 2 g, purified

na

water 1 L).

Proliferation assay: For monitoring the bacterial growth in presence of the test compounds, agar

ur

grown bacteria (24 h) were harvested and suspended in 1 mL UPEC liquid medium

The OD640

nm

Jo

(BactoT MTryptone 10 g, NaCl 8 g, glucose 1 g, yeast extract 1 g, CaCl2 2 g, Aqua Millipore 1 L). was adjusted to 0.5 and 100 µL of the suspension was transferred to a 96-well plate.

100 µL of the test compound solutions (UPEC liquid medium, supplemented with 5 % DMSO), including a positive control (gentamicin 0.2 µM (Sigma-Aldrich, St. Louis, USA)) and a negative control (UPEC liquid medium + 5 % DMSO) were added to each well. The plate was incubated at 37 °C and the bacterial proliferation monitored by measuring the OD640

nm

every 60 min for 6 h

and after 24 h. MTT assay [19]: T24 cells were seeded in 96-well plates with 1 × 104 cells per well (200 µL) and incubated for 48 h at 37 °C / 5 % CO 2 . The cell layer was washed with 200 µL/well PBS. Incubation with test compounds (was performed with 100 µL of the test solution for 24 h at 37 °C / 5 % CO 2 . Subsequently, the supernatant was removed and cells were washed twice with 200 µL/well PBS. 50 µL MTT reagent were added, followed by incubation for 4 h at 37 °C / 5 %

Journal Pre-proof CO 2 . MTT reagent was tapped off and 50 µL DMSO were added to dissolve the formazan crystals. After shaking for 10 min, the resulting absorption was determined at λ = 595 nm against reference wavelength of λ = 690 nm. Flow cytometric adhesion assay: FITC-labelling of UPEC and flow cytometric adhesion assay was performed as described earlier by [3,20,21]. Agar grown UPEC were labelled under light protection with fluorescein isothiocyanate (FITC) as follows: UPEC were resuspended in 1 mL sterile saline solution (NaCl 150 mM, Na2 CO3

of

100 mM, pH 8.0). The OD640 nm of the suspension was determined and 14 × 108 bacteria were resuspended in 900 µL of saline solution corresponding to an OD640

nm

of 8 (OD of 8 adjusted

ro

after determining the OD from a 1:50 dilution). 100 μL of a FITC solution (10 % in DMSO) were

-p

added and incubated for 60 min at 37 °C in a thermomixer (Eppendorf, Hamburg, Germany) at 300 rpm. The labelling process was terminated by pelleting the bacteria (10 000 × g, 5 min).

re

Labelled bacteria were washed 3  with 1 mL PBS to remove excess FITC, resuspended in 1 mL

lP

DMEM and adjusted to OD640 nm of 4 (determined from 1 : 20 dilution). T24 cells (1.25 × 105 cells/well) were seeded into 6-well plates and incubated at 37  °C/5 % CO 2

na

until 90 % confluence was reached (corresponding to 800   000 cells, after approximately 48 h of incubation). The medium was removed and cells were washed twice with PBS (1 mL) and once

ur

with DMEM (1 mL). All further steps with FITC-labelled E. coli were carried out under direct light protection.

Jo

For sample preparation 900 µL of DMEM, containing the sample dissolved in DMSO (DMSO concentration in all samples: 5 %) were mixed with 100 µL of DMEM, containing FITC-labelled bacteria (OD640

nm

 0.4, corresponding to 8 × 107 CFU/mL). For adhesion experiments, a bacteria

to cell ratio (BCR) of 100 : 1 was used. UPEC and T24 cells were incubated for 1 h at 37  °C. Subsequently, unattached UPEC were removed by gently washing the cells 3  with 1 mL PBS/well. Cells were detached by addition of 1 mL trypsin/EDTA for 4 min at 37  °C. Trypsinisation was stopped by addition of 2.5 mL DMEM. The content of each well was transferred to tubes and centrifuged for 5 min at 450 × g. The supernatant was discarded, and the cells resuspended in 700 µL of PBS. Fluorescence of the cell suspension was measured by flow cytometry (FACS Calibur, Software: BD CellQuest Pro V 5.2, BD Biosciences, Heidelberg, Germany). For data evaluation, 10 000 counts per sample were used.

Journal Pre-proof Yeast agglutination assay: [22]: 24 h agar grown UPEC (UTI89) were harvested and suspended in UPEC liquid medium, the OD was adjusted to 1 and test compounds (dissolved in DMSO, final DMSO concentration 1 %) were added. Either directly or after a 1, 2 or 24 h incubation time at 37 °C / 5 % CO 2 a dilution series was made (final ODs: 0.5, 0.25, 0.125, 0.0625, 0.03125). Yeast cells (Sigma Aldrich, St. Louis, USA) were suspended in PBS (2 % suspension). 35 µL of the bacterial suspension was transferred to a 96-well plate and 10 µL yeast suspension was added. After 10 min a visual evaluation was performed and the agglutination titre was determined (reciprocal maximal dilution, which still shows agglutination). Mannose (10mM) served as

of

positive control. Test compounds did not show any agglutination of yeast cells without UPEC

ro

present. 2.10 Quantitative real-time PCR (qPCR)

-p

Primer sequences used for the differential gene expression analysis are listed in Table 1. E. coli

re

strain UTI89 was prepared as following: A liquid culture of UPEC was prepared transferring one colony of 24 h agar grown UPEC (UTI89) in 10 mL of human pooled urine. The steady culture

lP

was incubated overnight (~15 h). Subsequently 150 µL of the urine grown bacteria (OD640 = 0.1/mL) was transferred to 1.35 mL of fresh pooled urine, including 75 µg/mL OAE (dissolved in

na

1 % DMSO) or 1 % DMSO as untreated control and incubated at 37 °C/5 % CO 2 for 2 h until the mid-logarithmic phase was reached. The suspension was centrifuged (10 000  g, 5 min) and the

ur

pellet after removement of the supernatant resuspended in 500 µL PBS. Immediately, 1 mL of RNAprotect™ Bacteria reagent was added. Bacterial RNA isolation and quantitative real-time

Jo

PCR (qPCR) was performed according [14].

2.11 Statistical Analysis

If not stated otherwise, data represent the means ± SD. One-way analysis of variance (One-way ANOVA) and Tukeys Post Test (Compare all pairs of columns) were used for statistical analysis by GraphPad Prism 3 (GraphPad Software, INC., LA Jolla, CA, USA). p < 0.05 was determined as statistical significant (*), p significant.

<

0.01 as high significant (**) and p < 0.001 as very high

Journal Pre-proof

3. Results and Discussion From previous data, it is known that an aqueous extract from the leaves from O. stamineus (Orthosiphon Water Extract, OWE) exerts concentration-dependent and significant antiadhesive effects against the adhesion of different UPEC strains to human bladder and kidney cells [14]. OWE has been quantified by UHPLC for its content on rosmarinic acid, cichoric acid and caffeic acid [14]. The extract OWE was obtained in a yield of 16.6 % (w/w) for the following investigations.

of

OWE inhibited the bacterial adhesion of UPEC strain UTI89 to human T24 bladder cells in a

ro

concentration-dependent manner with IC 25 of ~ 524 μg/mL (Fig. 1A).

UHPLC and LC-MS analysis of OWE indicated the dominant presence of the depsides

-p

rosmarinic acid, cichoric acid and caffeic acid, besides very low amounts of polymethoxylated

re

flavon aglyca (Figure 2). To enrich lipohilic compounds, acetone was used as an alternative extraction solvent, which resulted in higher yields of flavonoid aglyca and diterpenes and reduced

lP

amounts of the tannin-like depsides. The so obtained Orthosiphon acetone extract (OAE) was strongly enriched in polymethoxylated flavones (Figure 2A). Qualitatively, the flavone peaks in

na

UHPLC were comparable for OWE and OAE, but quantitative differences were obvious (Figure 2B). Interestingly, the antiadhesive activity of OAE (IC 50 ~ 40 μg/mL) was much more

ur

pronounced, as compared to OWE (Figure 1B). Therefore, OAE was manufactured in a higher amount (yield about 3.3 %, related to the leave material) and used for bioassay-guided

Jo

fractionation towards the antiadhesive compounds. OAE was subjected to fractionation by FCPC, yielding nine fractions I to IX. According LC-MS investigations, fractions III to VIII contained high amounts of polymethoxylated flavones. Further fractionation of III, V and VI by preparative HPLC on RP18 stationary phase led to the isolation of five flavones (III-5, III-6, V-4, VI-1 and VI-3). Identification of the isolated compounds was performed by recording the exact mass by LC-qTOF-MS and the respective 1and 2D-NMR-spectra. III-5 was identified as 5-hydroxy-6,7,3’,4’-tetramethoxyflavone (syn. 5-hydroxy-6,7,3’,4’-TMF) [23,24], III-6 was identified as 5-hydroxy-6,7,4’-trimethoxyflavone (syn. salvigenin) [23,24], V-4 was 5,6,7,4’-tetramethoxyflavone (syn. 5,6,7,4’-TMF) [23,24], VI-1 turned out to be 3’5dihydroxy-4’6,7-trimethoxyflavone (syn. eupatorin) [23,24], and VI-3 was identified as 5,6-

Journal Pre-proof dihydroxy-6,4’-dimethoxyflavone (syn. ladanein) [23,25]. Additionally the pentamethoxylated flavone sinensetin was identified in fraction VII (m/z = 373.1332 [M + H]+) [23,24]. Structural features of the flavones are displayed in Figure 3. The six flavones had no influence on the bacterial growth over 24 h (data not shown). T24 cells were negatively influenced only weakly at 200 μM test concentration during 24 h of incubation time (data not shown). As the contact time between the cells and the test compounds within the adhesion assay protocol is less than 1 h, it is assumed that the flavones have no negative influence during this protocol on the pro- and eucaryotic cells.

of

Within the adhesion assay five of the six PMFs showed a concentration depending antiadhesive

ro

activity against UPEC UTI89 (Figure 4). Significant inhibition of the bacterial adhesion at 5 μM level was observed for sinensetin, 5-hydroxy-6,7,3’,4’-TMF, and ladanein. Salvigenin and

-p

5,6,7,4’-TMF were active only at higher concentrations (25 μM), while Eupatorin did not show

re

any effect.

The follwing inhibition values (IC 25 ) were calculated: Ladanein: IC25 < 5 µM, sinensetin: IC25 ~

lP

7 µM, 5-hydroxy-6,7,3’,4’-TMF: IC25 ~ 41 µM, 5,6,7,4’-TMF: IC25 ~ 43 µM, salvigenin: IC25 ~

na

51 µM.

Comparison of the structures and the respective antiadhesive activities indicates that the inactive

ur

eupatorin is the only flavone of this series bearing a free hydroxyl group in the B-ring; position 3’ is unsubstituted or is methoxylated in cases of all other (active) flavones. This leads to the

Jo

assumption, that B-ring substitution is relevant for the potential antiadhesive activity. To have a closer look on the impact of B-ring hydroxylation, the two regioisomers chrysoeriol and diosmetin were analysed for potential antiadhesive activity by the flow cytometric adhesion assay (Figure 5). Both flavones are not constituents in the genus Orthosiphon, but have been described for Artemisia sp. [26] and Citrus bergamia [27] in case of chrysoeriol and for Glycyrrhiza uralensis [28] in case of diosmetin. Both flavones did not cause any significant reduction of bacterial adhesion in concentrations between 5 and 100 µM. Slight, but still significant effects are observed only at 200 µM. Although these effects are significant, they are substantially weaker than the antiadhesive activity found for the polymethoxylated flavones from Orthosiphon, causing a reduction of bacterial adhesion of 41 to 61 % at 200 µM level. From this point of view the lipophilicity of the B-ring seems to be an important prerequisite for antiadhesive activity against UPEC; 4’-methoxylation of the B-ring and either a proton or a methoxy group at position

Journal Pre-proof 3’ promotes this bioactivity, while 3’-hydroxylation, as found in eupatorin and diosmetin, leads to a drastical decrease of the activity. From these data, PMFs can be assessed as the active compounds in OAE, but it has to be kept in mind, that the antiadhesive activity of the extract is higher than those of the isolated PMFs. For pinpointing functional aspects towards the underlying molecular mechanism for the observed antiadhesive effect, the influence of OAE and sinensetin on the FimH-mediated interaction between UPEC UTI89 and T24 bladder cells was investigated. FimH-associated adhesion can be

fimbriae

are

mannose-sensitive

structures,

which

of

monitored easily by an agglutination assay against Saccharomyces cerevisiae, as the type 1 strongly

interact

with

mannosylated

ro

polysaccharides from the yeast cell wall [29]. This agglutination can be blocked by mannose as

-p

potent inhibitor. As shown in Table 2 untreated UPEC UTI89 agglutinated the yeast cells up to a dilution titre of 8 (dilution factor always 1:1), while mannose (10 mM) completely inhibited the

re

agglutination immediatly after addition to the suspension. Inhibition of agglutination was observed by OAE (75 µg/mL), but this effect got obvious only with a strong time delay of 2 to 24

lP

h. This might be indicative for a non-direct effect of OAE against the type 1 fimbriae. Remarkably, a previous report indicated that Orthosiphon extracts interact with the Chaperon-

na

Usher pathway, an assembly and secretion mechanism for fimbriae biosynthesis and formation [15]. The observed delayed onset of the inhibition of yeast agglutination would be in good

ur

correlation with such a block of the pilus assembly machinery. Interestingly, sinensetin did not

Jo

have any influence on the yeast agglutination. This hypothesis was additionally investigated and validated by monitoring the expression of genes, related to UPEC adhesion. Therefore a 2 h incubation protocol of strain UTI89 together with OAE (75 μg/mL) was used. As displayed in Figure 6 significant downregulation of fimH, the gene encoding for the mannose-binding protein FimH, was observed. In addition, the genes for the periplasmic chaperone FimC, and the gene for the outer membrane channel usher protein FimD, both involved in the assembly and export of type 1 fimbriae [30], were strongly downregulated. This fits nicely to the hypothesis that OAE influences the chaperon-usher machinery. In addition, csgA was significantly downregulated, a gene, responsible for the formation of the major subunit of curli, another pilus of UPEC, which is related to bacterial adhesion [31].

Journal Pre-proof The lipophilic, polymethoxylated flavone aglyca have been shown to be bioavailable and partially

demethoxylated

tetramethoxyflavone,

metabolites

(e.g.

from

sinensetin:

5-hydroxy-6,7,3',4'-tetramethoxyflavone,

4'-hydroxy-5,6,7,3'6-hydroxy-5,7,3',4'-

tetramethoxyflavone, and 7-hydroxy-5,6,3',4'-tetramethoxyflavone sulfate) [32,33] have been detected in rat urine after oral administration. Therefore, antiadhesive activity against UPEC in the urinary tract can be assumed, under the consideration, that the necessary concentrations will be reached in this compartment. Further in vivo studies of Orthosiphon extracts after oral applications have to be performed, to rationalize the observed in vitro effect of this study also

of

within in vivo studies. Typically, read-out for such investigations could be the antiadhesive activity of urine samples, obtained from Orthosiphon-treated volunteers, similar to a recent study

ro

performed by Vaccinium macrocarpum extract [3]. On the other side, in vivo animal experiments

-p

with aqueous Orthosiphon extract (OWE) have clearly proven, that oral administration of the extract in mice will have a significant positive effect on the bacterial load with UPEC after

re

transurethral infection in bladder and kidney [14].

lP

Summarising, Orthosiphon extracts can be assessed to have a strong and pronounced antiadhesive activity against UPEC, based on a variety of polymethoxylated flavones. Further clinical studies

Jo

ur

na

in UTI patients have to be performed to validate these findings also on a clinical base.

Journal Pre-proof

Acknowledgements Fruitful discussions with Dr. Shabnam Beydokthi and Dr. Birte Scharf, University of Münster are acknowledged. Assistance of Dr. Simone Brandt is acknowledged.

Ethical Approval

ro

of

This article does not contain studies with human participants performed by any of the authors.

-p

Funding

Financial support from Medice Arzneimittel Pütter GmbH&Co.KG, Isarlohn, Germany, is

lP

re

acknowledged.

Conflict of Interest

na

Financial support from Medice Arzneimittel Pütter GmbH&Co. KG, Isarlohn, Germany, is acknowledged. The funder had no influence on the design of the study, on the experiments

Jo

ur

performed, on the interpretation of the results and on the writing of this manuscript.

Journal Pre-proof Captions to Tables

Table 1: Primer sequences for qPCR.

Table 2: Influence of the acetonic Orthosiphon leave extract OAE (75 µg/mL) and sinensetin (200 μM) on the UPEC UTI89 induced agglutination of S. cerevisiae. UC: untreated control, PC: positive control mannose (10 mM): no agglutination. Results are expressed as dilution titres (1:1

Jo

ur

na

lP

re

-p

ro

of

dilution). Results are related to three independent experiments with n = 2 technical replicates.

Jo

ur

na

lP

re

-p

ro

of

Journal Pre-proof

Journal Pre-proof

References

Jo

ur

na

lP

re

-p

ro

of

[1] A.L. Flores-Mireles, J.N. Walker, M. Caparon, S.J. Hultgren, Urinary tract infections: epidemiology, mechanisms of infection and treatment options, Nat. Rev. Microbiol. 13 (2015) 269–284. https://doi.org/10.1038/nrmicro3432. [2] B. Foxman, Epidemiology of urinary tract infections: incidence, morbidity, and economic costs, Am. J. Med. 113 Suppl 1A (2002) 5S-13S. https://doi.org/10.1016/s00029343(02)01054-9. [3] B. Scharf, J. Sendker, U. Dobrindt, A. Hensel, Influence of Cranberry Extract on TammHorsfall Protein in human urine and its antiadhesive activity against uropathogenic Escherichia coli, Planta Med. 85 (2019) 126–138. https://doi.org/10.1055/a-0755-7801. [4] A.L. Servin, Pathogenesis of human diffusely adhering Escherichia coli expressing Afa/Dr adhesins (Afa/Dr DAEC): current insights and future challenges, Clin. Microbiol. Rev. 27 (2014) 823–869. https://doi.org/10.1128/CMR.00036-14. [5] R. Selvarangan, P. Goluszko, V. Popov, J. Singhal, T. Pham, D.M. Lublin, S. Nowicki, B. Nowicki, Role of decay-accelerating factor domains and anchorage in internalization of Drfimbriated Escherichia coli, Infect. Immun. 68 (2000) 1391–1399. [6] S.S. Justice, C. Hung, J.A. Theriot, D.A. Fletcher, G.G. Anderson, M.J. Footer, S.J. Hultgren, Differentiation and developmental pathways of uropathogenic Escherichia coli in urinary tract pathogenesis, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 1333–1338. https://doi.org/10.1073/pnas.0308125100. [7] C.N. Spaulding, S.J. Hultgren, Adhesive pili in UTI pathogenesis and drug development, Pathogens 5 (2016). https://doi.org/10.3390/pathogens5010030. [8] L. Cegelski, G.R. Marshall, G.R. Eldridge, S.J. Hultgren, The biology and future prospects of antivirulence therapies, Nat. Rev. Microbiol. 6 (2008) 17–27. https://doi.org/10.1038/nrmicro1818. [9] S.N. Abraham, Y. Miao, The nature of immune responses to urinary tract infections, Nat. Rev. Immunol. 15 (2015) 655–663. https://doi.org/10.1038/nri3887. [10] European Scientific Cooperative on Phytotherapynal (Ed.), ESCOP Monographs: Orthosiphonis folium, 2nd ed., Thieme, Stuttgart, New York, 2003. [11] K.E. Malterud, I.M. Hanche-Olsen, I. Smith-Kielland, Flavonoids from Orthosiphon spicatus, Planta Med. 55 (1989) 569–570. https://doi.org/10.1055/s-2006-962099. [12] N.D. Yuliana, A. Khatib, A.M. Link-Struensee, A.P. Ijzerman, F. Rungkat-Zakaria, Y.H. Choi, R. Verpoorte, Adenosine A1 receptor binding activity of methoxy flavonoids from Orthosiphon stamineus, Planta Med. 75 (2009) 132–136. https://doi.org/10.1055/s-00281088379. [13] M.T.T. Nguyen, S. Awale, Y. Tezuka, C. Chien-Hsiung, S. Kadota, Staminane- and isopimarane-type diterpenes from Orthosiphon stamineus of Taiwan and their nitric oxide inhibitory activity, J. Nat. Prod. 67 (2004) 654–658. https://doi.org/10.1021/np030471. [14] S. Sarshar, S. Brandt, M.R. Asadi Karam, M. Habibi, S. Bouzari, M. Lechtenberg, U. Dobrindt, X. Qin, F.M. Goycoolea, A. Hensel, Aqueous extract from Orthosiphon stamineus leaves prevents bladder and kidney infection in mice, Phytomedicine 28 (2017) 1–9. https://doi.org/10.1016/j.phymed.2017.02.009.

Journal Pre-proof

Jo

ur

na

lP

re

-p

ro

of

[15] S.S. Beydokhti, C. Stork, U. Dobrindt, A. Hensel, Orthosipon stamineus extract exerts inhibition of bacterial adhesion and chaperon-usher system of uropathogenic Escherichia coli - a transcriptomic study, Appl. Microbiol. Biotechnol. (2019). https://doi.org/10.1007/s00253-019-10120-w. [16] Bubeník J Baresová M Viklický V Jakoubková J Sainerová H Donner J, Established cell line of urinary bladder carcinoma (T24) containing tumour-specific antigen, Int J Cancer (1973) 765–773. [17] Type 1, P and S fimbriae, and afimbrial adhesin I are not essential for uropathogenic Escherichia coli to adhere to and invade bladder epithelial cells, FEMS Immunol Med Microbiol (2002) 23–26. [18] S.L. Chen, C.-S. Hung, J. Xu, C.S. Reigstad, V. Magrini, A. Sabo, D. Blasiar, T. Bieri, R.R. Meyer, P. Ozersky, J.R. Armstrong, R.S. Fulton, J.P. Latreille, J. Spieth, T.M. Hooton, E.R. Mardis, S.J. Hultgren, J.I. Gordon, Identification of genes subject to positive selection in uropathogenic strains of Escherichia coli: a comparative genomics approach, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 5977–5982. https://doi.org/10.1073/pnas.0600938103. [19] T. Mosmann, Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays, J Immunol Meth 65 (1983) 55–63. https://doi.org/10.1016/0022-1759(83)90303-4. [20] N. Rafsanjany, M. Lechtenberg, F. Petereit, A. Hensel, Antiadhesion as a functional concept for protection against uropathogenic Escherichia coli: in vitro studies with traditionally used plants with antiadhesive activity against uropathognic Escherichia coli, J. Ethnopharmacol. 145 (2013) 591–597. https://doi.org/10.1016/j.jep.2012.11.035. [21] N. Rafsanjany, J. Sendker, M. Lechtenberg, F. Petereit, B. Scharf, A. Hensel, Traditionally used medicinal plants against uncomplicated urinary tract infections: Are unusual, flavan-4ol- and derhamnosylmaysin derivatives responsible for the antiadhesive activity of extracts obtained from stigmata of Zea mays L. against uropathogenic E. coli and Benzethonium chloride as frequent contaminant faking potential antibacterial activities?, Fitoterapia 105 (2015) 246–253. https://doi.org/10.1016/j.fitote.2015.07.014. [22] A.W.H. Lo, K. van de Water, P.J. Gane, A.W.E. Chan, D. Steadman, K. Stevens, D.L. Selwood, G. Waksman, H. Remaut, Suppression of type 1 pilus assembly in uropathogenic Escherichia coli by chemical inhibition of subunit polymerization, J. Antimicrob. Chemother. 69 (2014) 1017–1026. https://doi.org/10.1093/jac/dkt467. [23] Y. Tezuka, P. Stampoulis, A.H. Banskota, S. Awale, K.Q. Tran, I. Saiki, S. Kadota, Constituents of the Vietnamese medicinal plant Orthosiphon stamineus, Chem Pharm Bull 48 (2000) 1711–1719. https://doi.org/10.1248/cpb.48.1711. [24] W. Sumaryono, P. Proksch, V. Wray, L. Witte, T. Hartmann, Qualitative and quantitative analysis of the phenolic constituents from Orthosiphon aristatus, Planta Med. 57 (1991) 176–180. https://doi.org/10.1055/s-2006-960060. [25] X. Martin-Benlloch, M. Elhabiri, D.A. Lanfranchi, E. Davioud-Charvet, A practical and economical high-yielding, six-step sequence synthesis of a flavone: Application to the multigram-scale synthesis of ladanein, Org. Process Res. Dev. 18 (2014) 613–617. https://doi.org/10.1021/op4003642. [26] D.N. Olennikov, N.K. Chirikova, N.I. Kashchenko, V.M. Nikolaev, S.-W. Kim, C. Vennos, Bioactive phenolics of the genus Artemisia (Asteraceae): HPLC-DAD-ESI-TQ-MS/MS

Journal Pre-proof

Jo

ur

na

lP

re

-p

ro

of

profile of the siberian species and their inhibitory potential against α-amylase and αglucosidase, Front. Pharmacol. 9 (2018) 756. https://doi.org/10.3389/fphar.2018.00756. [27] G. Gattuso, C. Caristi, C. Gargiulli, E. Bellocco, G. Toscano, U. Leuzzi, Flavonoid glycosides in bergamot juice (Citrus bergamia Risso), J. Agric. Food Chem. 54 (2006) 3929–3935. https://doi.org/10.1021/jf060348z. [28] L. Wang, K. Zhang, S. Han, L. Zhang, H. Bai, F. Bao, Y. Zeng, J. Wang, H. Du, Y. Liu, Z. Yang, Constituents isolated from the leaves of Glycyrrhiza uralansis and their antiinflammatory activities on LPS-induced RAW264.7 ells, Molecules 24 (2019). https://doi.org/10.3390/molecules24101923. [29] P. Klemm, R.M. Vejborg, V. Hancock, Prevention of bacterial adhesion, Appl. Microbiol. Biotechnol. 88 (2010) 451–459. https://doi.org/10.1007/s00253-010-2805-y. [30] G. Waksman, S.J. Hultgren, Structural biology of the chaperone-usher pathway of pilus biogenesis, Nat. Rev. Microbiol. 7 (2009) 765–774. https://doi.org/10.1038/nrmicro2220. [31] R. Fronzes, H. Remaut, G. Waksman, Architectures and biogenesis of non-flagellar protein appendages in Gram-negative bacteria, EMBO J. 27 (2008) 2271–2280. https://doi.org/10.1038/emboj.2008.155. [32] G.-J. Wei, J.-F. Sheen, W.-C. Lu, L.S. Hwang, C.-T. Ho, C.-I. Lin, Identification of sinensetin metabolites in rat urine by an isotope-labeling method and ultrahigh-performance liquid chromatography-electrospray ionization mass spectrometry, J. Agric. Food Chem. 61 (2013) 5016–5021. https://doi.org/10.1021/jf3046768. [33] L. Li, Y. Chen, X. Feng, J. Yin, S. Li, Y. Sun, L. Zhang, Identification of metabolites of eupatorin in vivo and in vitro based on UHPLC-Q-TOF-MS/MS, Molecules 24 (2019). https://doi.org/10.3390/molecules24142658.

ro

-p

re

lP

na

ur

16S RNA f: 16S RNA r: fimH f: fimH r: fimC f: fimC r: fimD f: fimD r: csgA f: csgA r: papGIII f: papGIII r: papC f: papC r: papD f: papD r: prsGIII f: prsGIII r: sfaG f: sfaG r: focG f: focG r: fyuA f: fyuA r: chuT f: chuT r: fliC f: fliC r:

Primer sequence 5’ → 3’ GGCGCATACAAAGAGAAG ATGGAGTCGAGTTGCAGA CAATGGTACCGCAATCCCTA GCAGGCGCAAGGTTTACA CTAAATTAGCGTTGCCACCCG AGGGTGTCGGGTTAATCAGC TCCGGTATGAATCTGCTGGC CTGCTGACCCACATCCAGTT GTAGCAGCAATTGCAGCAATCG TTAGATGCAGTCTGGTCAACAG AGCAATTTTCGGTTGGTCTG TCCACGCCATTAATCGAAAT GATGGTGTGGGAGGTGTACC CGCTTCAGGTCAACAGAGGT CCCGGCAGCAATTAAAACCA ATACGATACCCACCGCTGAC CAATTTTCGGTTGGTCTGG CGATGGTCAGGTTTTGTG AGCGGGTTCTGTGGTGAATA CCCGACATGAAATACCGACG TGTTACAGGGAGGGTATTG GGTGCTGTTGGCTGCTAT GGTCTTGATGCCAAACCGTT GGTATAAAACGTCGCGGCTT GATTGCGGCTAACCCTGAAG TCAACGGTGATAATGCGCTG ACAGCCTCTCGCTGATCACTCAAA GCGCTGTTAATACGCAAGCCAGAA

Jo

Primer

of

Journal Pre-proof

Journal Pre-proof

UC

PC

OAE

Sinensetin

0

8

-

8

8

1

8

-

8

8

2

4

-

4

4

24

8

-

2

8

Jo

ur

na

lP

re

-p

ro

of

Time of incubation [h]

Journal Pre-proof Conflict of Interest Financial support from Medice Arzneimittel Pütter GmbH&Co. KG, Isarlohn, Germany, is acknowledged. The funder had no influence on the design of the study, on the experiments performed, on the interpretation of the results and on the writing of this manuscript.

Bladder Cell

Jo

Legends to Figures

ur

na

lP

re

-p

ro

of

Graphical abstract

Figure 1: Relative adhesion of UPEC UTI89 to T24 bladder cells after 1 h coincubation with different concentrations of aqueous extract OWE (A) and acetonic extract OAE (B) from the leaves of O. stamineus. Data indicate the adhesion related to the untreated control (UC = 100 %). Values represent the mean ± SD from three independent experiments with n = 2 technical replicates. *** p < 0.01. Figure 2: Comparative UHPLC analysis of aqueous extract OWE from O. stamineus leaves (red chromatogram) and acetonic extract OAE (green chromatogram). Polymethoxylated flavones are enriched in OAE, while depsides are dominant in OWE. A: full chromatogram t0 to t16 min; B: enlarged chromatogram from t6.8 to t10 min. Detection wavelength  = 330 nm; test concentration 5 mg/mL.

Figure 3: Structural features of polymethoxylated flavones from the leaves of O. stamineus.

Journal Pre-proof

Figure 4: Influence of different concentrations of polymethoxylated flavones from the leaves of O. stamineus on the relative adhesion of FITC-labelled UPEC UTI89 to T24 bladder cells after 1 h of coincubation. Data indicate the relative adhesion related to the untreated control (UC = 100 %). Values originate from three independent experiments with n = 2 technical replicates; *** p < 0.001, ** p < 0.01.

of

Figure 5: Influence of chrysoeriol and diosmetin on the relative bacterial adhesion of UPEC UTI89 to T24 bladder cells after 1 h coincubation. Data indicate the relative adhesion related to the untreated control (UC = 100 %). Values represent the mean ± SD from three independent experiments with n = 2 technical replicates. *: p < 0.05 **: p < 0.01.

Jo

ur

na

lP

re

-p

ro

Figure 6: Relative gene expression of selected virulence factors related to the bacterial adhesion, motility and iron acquisition of UPEC UTI89 after 2 h incubation with acetonic Orthosiphon extract (OAE 75 μg/mL) as determined by qPCR. Gene expression is normalized to the endogenous reference gene 16S rRNA and related to the untreated control (= 1). Values represent the mean ± SD of three independent experiments with n = 2 technical replicates. *: p < 0.05, ***: p < 0.001.