Polymorphic microsatellite markers in pineapple (Ananas comosus (L.) Merrill)

Scientia Horticulturae 156 (2013) 127–130

Contents lists available at SciVerse ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Polymorphic microsatellite markers in pineapple (Ananas comosus (L.) Merrill) D. Rodríguez a , M.J. Grajal-Martín b , M. Isidrón a , S. Petit b , J.I. Hormaza c,∗ a b c

Plant Biotechnology Laboratory, Agrarian University of Havana, National Highway Km 23 ½, San José de las Lajas, Mayabeque, CP 32700, Cuba Canarian Institute of Agrarian Research, Apartado 60, 38200 La Laguna, S/T Tenerife, Spain Instituto de Hortofruticultura Subtropical y Mediterránea La Mayora (IHSM la Mayora-CSIC-UMA), 29750 Algarrobo-Costa, Málaga, Spain

a r t i c l e

i n f o

Article history: Received 28 February 2013 Received in revised form 21 March 2013 Accepted 22 March 2013 Keywords: Ananas bracteatus Ananas comosus SSRs Molecular markers Germplasm

a b s t r a c t Simple Sequence Repeats (SSRs), also known as microsatellites, have not been used extensively to study the genetic diversity of pineapple (Ananas comosus (L.) Merrill). In this work the performance of existing pineapple-specific microsatellite primers and of primers based on microsatellite sequence information from Ananas bracteatus (L.) Merrill are evaluated for the molecular characterization of pineapple genotypes. Of the 20 microsatellite primer pairs specifically developed for pineapple previously reported in the literature, only six were useful in this study: two could be used directly and four could be used after redesign of the primers. In addition, 10 additional new primer pairs were designed based on A. bracteatus (L.) Merrill sequences deposited in Genbank, in order to study their transferability to pineapple. A total of 10 SSRs were finally selected that allowed the detection of 26 polymorphic alleles in 6 different pineapple genotypes, representing the main groups of varieties of this crop, averaging 2.6 alleles/locus. Average expected heterozygosity (He) was 0.56, and average observed heterozygosity (Ho) was 0.47. Ho was lower than He for over half of the studied loci. According to Wright’s fixation index (F) there is a heterozygote deficit in six loci (60%). Average genetic similarity between the studied genotypes was 0.75. The use of the SSR markers described in this work will allow the optimization of pineapple cultivar fingerprinting and diversity studies in germplasm collections. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Pineapple (Ananas comosus L. Merrill, 2n = 2x = 50) is the most widely known species of the cultivated members of the Bromeliaceae. Although native from South America, it is currently grown in tropical, subtropical and mild climate regions worldwide due to its adaptability, resistance to drought and easiness of propagation protocols (Smith and Downs, 1979; Coppens d’Eeckenbrugge and Leal, 2003). Exhibiting a delicate taste, this tropical fruit enjoys widespread consumer acceptance whether fresh or processed and has, in addition, found some medicinal applications (Sanewski, 2007). Total world production in 2010 has reached close to 20 million tons with Brazil, Thailand, Philippines Costa Rica and China producing about 50% of the world production making pineapple the third tropical fruit crop in production after bananas and citrus (FAOSTAT, 2012). Recently, Coppens d’Eeckenbrugge and Leal (2003) have revised pineapple taxonomy, proposing one genus, Ananas, with two species A. comosus (L.) Merr. (diploid, 2n = 2x = 50) and A.

∗ Corresponding author. Tel.: +34 952548990; fax: +34 952552677. E-mail address: [email protected] (J.I. Hormaza). 0304-4238/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.scienta.2013.03.026

macrodontes Morren (tetraploid, 2n = 4x = 100). A. comosus would include five botanical varieties: comosus, ananassoides, parguazensis, erectifolius, and bracteatus. The cultivated pineapple varieties are included in var. comosus and they are usually classified in five phenotypic groups (Py et al., 1987; Paull and Duarte, 2011): Spanish, Queen, Abacaxi or Pernambuco, Cayenne and Maipure or Perolera. A number of different morphological, biochemical and nucleic acid-based markers have been employed to characterize pineapple germplasm. Morphological markers have, for instance, been extensively applied to analyze the diversity of important pineapple collections, including those of EMBRAPA in Cruz das Almas, Brazil, with over 700 accessions, USDA in Hawaii and CIRADFLHOR in Martinique with 600 accessions (Leal et al., 1986; Ferreira and Cabral, 1993; Duval et al., 1997; Coppens d’Eeckenbrugge et al., 2000). Although biochemical markers such as isozymes have also been used to identify pineapple varieties and resolve taxonomic ambiguities, only a handful of isoenzymatic systems are capable of delivering acceptable performance in this species, and even those are not sufficiently polymorphic (DeWald et al., 1992; Aradhya et al., 1994). Nucleic acid-based markers have, on the other hand, enjoyed much greater success in the field of pineapple genetics (Carlier et al., 2007). For instance, AFLP markers have been used in the

128

D. Rodríguez et al. / Scientia Horticulturae 156 (2013) 127–130

characterization of germplasm collections (Yanes et al., 2005, 2012; Tapia et al., 2005a), the detection of somaclonal variations from in vitro culture (Pérez et al., 2009) and the analysis of genetic diversity (Kato et al., 2004). RAPD markers have also been used for the analysis of genetic diversity (Ruas et al., 2001 and Sripaoraya et al., 2001), as well as the study of somaclonal variants arising during in vitro culture (Feuser et al., 2003). RFLPs enabled the study of rDNA (Noyer et al., 1997) and the characterization of genetic diversity (Duval et al., 2001). Finally combinations of different markers have been used for genetic mapping in this species (Carlier et al., 2012). A powerful technique for quantifying and comparing levels of inter-species genetic variation is the use of Simple Sequence Repeat (SSR) markers or microsatellites. However, the potential of microsatellites for fingerprinting and diversity studies in the Ananas genus is far from realized. Thus, the objective of this work is the evaluation of microsatellites for studying the genetic diversity of pineapple, identifying genotypes of this species and examining whether microsatellite data from other species of the Ananas genus can readily be applied in pineapple genetics.

fixed alleles respectively). POPGENE 1.32 (Yeh et al., 1997) was used to calculate the effective number of alleles (Ne = 1/1 − He) and Wright’s fixation index (F = 1 − Ho/He) (Wright, 1951). The probability of identity (PI = pi4 + (2pipj)2 , where pi and pj are the frequency of the ith and jth alleles at each locus), measuring the probability that two randomly drawn diploid genotypes will be identical under the observed allele frequencies and assuming random assortment (Paetkau et al., 1995) was calculated with IDENTITY 1.0 (Centre for Applied Genetics, University of Agricultural Sciences, Vienna, Austria). Genetic relationships between the studied accessions were calculated by UPGMA cluster analysis, using a similarity matrix obtained from the proportion of shared amplification fragments (Nei and Li, 1979) with NTSYSpc 2.11 (Exeter Software, Stauket, NY, USA). The cophenetic correlation coefficient was computed for the dendrogram after the construction of a cophenetic matrix to measure the goodness of fit between the original similarity matrix and the dendrogram. Bootstrap support values were obtained from 2000 replicates using the program TREECON 1.3b (Van de Peer and De Watchter, 1994).

2. Materials and methods

3. Results and discussion

A total of six pineapple genotypes (Queen, MD2, Perolera, White Pine, Smooth Cayenne and Red Spanish) were analyzed in this work. DNA was isolated from young leaves using the DNeasy® extraction kit from QIAGEN. A total of 20 SSR primers reported in the literature (Kinsuat and Kumar, 2007) were initially tested. PCR amplifications were performed in a final reaction volume of 15 ␮L containing 20 ng of genomic DNA, 16 mM (NH4 )2 SO4 , 67 mM Tris–ClH pH 8.8, 0.01% Tween20, 2 mM MgCl2 , 0.1 mM each dNTP, 0.4 ␮M each primer, and 0.5 units of BioTaqTM DNA polymerase (Bioline, London, UK). PCR was performed in an I-Cycler (Bio-Rad Laboratories, Hercules, CA, USA) thermocycler using the following temperature profile: an initial step of 1 min at 94 ◦ C followed by 35 cycles of 30 s denaturation at 94 ◦ C, 30 s annealing at 55 ◦ C and 1 min extension at 72 ◦ C, and a final step of 5 min final extension at 72 ◦ C. For initial screening, the resulting amplicons were resolved by horizontal gel electrophoresis in 2.5% agarose (1.25% NuSieve® GTG® and 1.25% Seakem® GTG® ), using 1X TBE buffer at 80 V and a BstN I digest of pBR322 DNA as molecular weight marker. Gels containing the resolved DNA fragments were examined by staining in 0.75 ␮g/ml EtBr followed by observation under ultraviolet (312 nm) transillumination. In addition, 10 new primers were designed from A. bracteatus sequences deposited in GenBank, using the Primer3 (v. 0.4.0) programm (Steve and Helen, 2000). For final analyses with the 10 selected loci, SSR amplification mixtures were prepared as previously described except that the forward primers of each primer pair were labeled with a fluorescent dye (D2 , D3 and D4 from Beckman Coulter) in the 5 end (Proligo, Paris, France). The reactions were run using the temperature profile described above. PCR products were analyzed by capillary electrophoresis in a CEQTM 8000 capillary DNA analysis system (Beckman Coulter, Fullerton, CA, USA). Samples were denaturalized at 90 ◦ C during 120 s, injected at 2.0 kV 30 s and separated at 6.0 kV during 35 min. Each reaction was repeated twice in each run to ensure size accuracy and to minimize run-to-run variation. Allelic composition and the number of total alleles were determined for each SSR locus of each accession, indicating putative alleles by their estimated size in bp. ARLEQUIN version 3.01 (Excoffier et al., 2005) was used to calculate the number of alleles per locus (A), observed heterozygosity (Ho), expected heterozygosity [(He = 1 − pi2 where pi is the frequency of the ith (Nei, 1973)] and allele frequencies (considering p ≤ 0.05 and p ≥ 0.9 as rare and

DNA amplifications using the 20 SSR primers previously reported for A. comosus (Kinsuat and Kumar, 2007) did not produce the expected result in most reactions except for two loci: ACLR749 and ACPCT136B. The amplifications with the remaining primer pairs exhibited non-specific amplification patterns, producing a larger number of amplicons than expected for this type of molecular marker. Due to these unexpected results, a detailed analysis of each amplified sequence, its corresponding primers and repeated motif was performed. The results indicated that for 15 SSR loci (ACLR179C, ACUMS217, ACUMS228A, ACLR746A, ACLR76A, ACLR776B, ACPCT127B, ACPCT124B, ACUMS141B, ACPCT610A, ACPCT643A, ACPCT662A, ACPCT651B, ACUMS228C, ACPCT662A), the microsatellite itself was contained within the sequence of the forward or reverse primer; for 3 loci either the primer sequences were not present in the reported sequences (ACLR179B) or the sequences of the primers did not exactly correspond to those of the original sequence (ACLR179 C and ACUMS217); finally, for 3 cases (ACPCT138B, ACPCT138A, ACLR74A) the SSR loci did not correspond to the sequences reported. As a result, only two of the reported primer pairs (loci ACLR749 and ACPCT136B) could be used without modification, and new primers could be re-designed for 4 loci (DQ019851, DQ356280, DQ356284 and DQ381768) based on the original sequences (Table 1). Additional 10 primers were designed from A. bracteatus sequences deposited in GenBank making a total of 17 SSR loci (Table 1). Specific amplification of DNA from the studied pineapple genotypes was obtained for those 17 new SSR primers and the 10 most polymorphic SSR loci (ACPCT124BM, ACLR179BMa, ACLR179BMb, ACPCT651BM, ANBR58, ANBR72, ANBR73, ANBR75, ANBR80 and ANBR81) were then selected for studying the genetic diversity of six pineapple accessions, representing the main groups of varieties of this crop, and deduce their allelic composition. The genetic diversity parameters calculated with the data obtained after running the 10 selected primer pairs on six pineapple accessions are shown in Table 2. There were a total of 26 polymorphic alleles, with an average of 2.6 alleles/locus ranging from 2 to 4. Effective allele number ranged from 1.18 to 3.0, illustrating the efficacy of this technique. ANBR58 was the most polymorphic SSR locus, with 4 alleles in the genotypes studied. Average expected heterozygosity (He) was 0.56, ranging from 0.32 in loci ACLR179BMb and ANBR75 to 0.73 in locus ANBR81.

D. Rodríguez et al. / Scientia Horticulturae 156 (2013) 127–130

129

Table 1 Primers used in this work, including the unmodified* or modified** primers from Kinsuat and Kumar (2007) and those designed from available A. bracteatus sequences in GenBank (***). Locus

Repeat motif

Sequence (5 –3 )

Genbank accession No.

ACLR749*

(AG)2 (GA)2 (G)2

AY551306

ACPCT136B*

(GAC)7

ACLR179BMa**

(GTA)4

ACLR179BMb**

(TAA)4

ACPCT124BM**

(CCT)8

ACPCT138AM**

(CTT)4 (CG)3 (AAG)3

ACPCT651BM**

(GAA)13

ANBR34***

(CT)30

ANBR36***

(CT)14

ANBR48***

(GA)19

ANBR58***

(CT)21 (CA)21

ANBR60***

(GA)17

ANBR72***

(GA)27

ANBR73***

(CT)17

ANBR75***

(GA)30

ANBR80***

(GA)8

ANBR81***

(CT)21

F: TTGAGAGCCAGAGGGTTTTG R: ACGGTCCGATGTAAAATTCG F. GGGTCCGAGTGGAGAGATTC R: TCGTGCAGTGTTTCGCTTAG F: CCTTTGTTTTGTTACTTTTTAT R: CCAGTTATTTTTAGTAAAGTCC F: GGACTTTACTAAAAATAACTGG R: ATACTAACAACACCTCTTTCAC F: GTAGCAACAGCTATGAAAAC R: GATACAACGACAAGTACTACG F: GACGAGGACCGTACTCACGA R: ATGGCATGATCTCGTCCACT F: GATACATAACAGTGTATTGGAG R: TAACTACTCTATGTTGTGACCA F: TTAATCAAGTTCTTTAAAGGTT R: GAGAGAACTAGACTGAAAGAAA F: TACTTTCTTTGTGCATGTTAT R: AGTGGACATTTTACATAGTTTT F: ACAATAATTGATACAGTCCAGT R: AAGTTGTGTAGAGAACAAATTAC F:ATATGATAGGACTTACTTTTGG R: AAGGCTACAGATAGTTAAAGAG F: TGTAGACGCCTTATATATTGTA R: CACTATTATCCTAACCAGACAT F: TGCACCTTCTTACTTCTATAAT R: ACAACTAGCAAAACTTTGTATC F: CATTAGATTAGTTCACAAACAA R: AGAATATTATGGAAAAATTGAG F: ATGATCTCCTAAAAATCATAAG R: CTTAATTAGGGTTTTATTTGTC F: GTTTAAGCAATAATTCCTAGAG R: TATAATCATGATGGAACATCTA F: TTAATCAAGTTCTTTAAAGGTT R: CTAGTAAAGTCTCTTTCCATTG

Average observed heterozygosity (Ho) was 0.47, ranging from 0.17 in ANBR75 and ACLR179BMb to 0.83 in ACLR179BMa. Ho was lower than He in more than half of the assayed loci. The relation of both heterozygosities, determined by Wright’s fixation index (F, comparing He to Ho and estimating the degree of allelic fixation), produced negative values also in more than half of the cases, evidencing heterozygosis deficits in 6 loci (60%). The probability of identity (PI) was 0.34, and ranged from 0.16 (ANBR80) to 0.60 (ACPCT651BM). The behavior of heterozygosity values was inversely proportional to that of Ne and PI, evidencing that microsatellites uncover a high heterozygosity and constitute, therefore, appropriate markers for varietal identification in pineapple. The loci providing most information were ANBR80 (PI = 0.16) and ANBR81 (He = 0.73), although over 60% of the selected loci were highly informative, with He ≥ 0.5 and PI ≤ 0.35. As a matter of fact, it is possible to resolve the genotypes analyzed in this work with only the 6 loci with the highest He and lowest PI confirming the potential of SSR for optimizing collection management.

DQ356283 DQ019851 DQ019851 DQ356280 DQ356284 DQ381768 AJ845034 AJ845036 AJ845048 AJ845058 AJ845060 AJ845072 AJ845073 AJ845075 AJ845080 AJ845081

A UPGMA analysis was used to determine genetic relatedness among the six studied pineapple genotypes. The cophenetic correlation obtained (r = 0.82) suggests that the genotype classification shown in the dendrogram (Fig. 1) is robust. The cultivars analyzed belong to the five established horticultural groups of this species (Paull and Duarte, 2011): Spanish, Queen, Abacaxi, Cayenne and Maipure, and they are clearly separated in the dendrogram (Fig. 1): MD2 and Smooth Cayenne belong to the Cayenne group, Queen to the Queen group, White Pine to the Abacaxi or Pernambuco group, Red Spanish to the Spanish group and Perolera to the Maipure or Perolera group. Tapia et al. (2005b) evaluated pineapple accessions including some from the Cayenne group, and also found Smooth Cayenne and the MD2 hybrid to be some of the most closely related genotypes. The SSR primers designed from A. bracteatus sequences were able to amplify polymorphic DNA fragments from the A. comosus genome. Such a result illustrates the advantages of using SSR markers for this purpose, as their sequence is often conserved across different species and genera of the same family, enabling

Table 2 Diversity parameters of 10 microsatellite loci, including locus name, expected size (bp), number of alleles, effective number of alleles (Ne), probability of identity (PI), observed heterozygosity (Ho), expected heterozygosity (He), Wright’s fixation index (F) and GenBank Accession no. Locus

Size (bp)

No. of alleles

Ne

PI

Ho

He

F

Genbank accesion no.

ANBR58 ANBR72 ANBR73 ANBR75 ANBR80 ANBR81 ACLR179BMa ACLR179BMb ACPCT124BM ACPCT651BM

227–243 239–241 211–227 210–220 147–149 240–268 280–288 109–110 273–287 219–245

4 2 2 2 2 3 3 2 3 3

2.06 1.39 1.80 1.19 1.80 3.00 1.94 1.18 2.32 2.57

0.46 0.38 0.28 0.46 0.16 0.28 0.28 0.28 0.20 0.60

0.50 0.33 0.67 0.17 0.33 0.50 0.83 0.17 0.50 0.67

0.67 0.44 0.48 0.32 0.64 0.73 0.62 0.32 0.70 0.67

0.03 −0.20 −0.50 −0.09 0.25 0.25 −0.71 −0.09 0.12 −0.09

AJ845058 AJ845072 AJ845073 AJ845075 AJ845080 AJ845081 DQ019851 DQ019851 DQ356280 DQ381768

130

D. Rodríguez et al. / Scientia Horticulturae 156 (2013) 127–130

Queen White Pine

86

Red Spanish MD-2

67

Smooth Cayenne Perolera 0.60

0.70

0.80

0.90

1.00

Similarity Fig. 1. UPGMA-based dendrogram, constructed from polymorphisms of 10 SSR loci for six pineapple genotypes, using the similarity matrix generated with the Nei and Li (1979) coefficient from molecular data. Only bootstrap values larger than 50% are represented.

the application of previously used primers to the study of species for which scarce or no sequence information is available (Escribano et al., 2004, 2008). Successful transportability of EST-SSR markers has also been recently shown in the Bromeliaceae (Whöhrmann and Weising, 2011). The set of loci described in this work will be useful to analyze different pineapple germplasm collections in order to optimize germplasm management and elucidate synonimies and homonymies present in the different collections. Acknowledgements This investigation has been funded by grants from the Carolina Foundation, the Mediterranean Agronomic Institute of Zaragoza (IAMZ) and the Spanish Ministry of Science–European Regional Development Fund, European Union (AGL2010-15140). We would also like to acknowledge the contribution of the Canarian Institute of Agricultural Research (ICIA), Spain, and the Bioplant Center of Ciego de Ávila, Cuba, for generously sharing specimens from their collections. References Aradhya, K.M., Zee, F., Manshardt, R.M., 1994. Isozyme variation in cultivated and wild pineapple. Euphytica 79, 87–99. Carlier, J., Sousa, N.H., Santo, T.E., Coppens d’Eeckenbrugge, G., Leitao, J.M., 2012. A genetic map of pineapple (Ananas comosus (L.) Merr.) including SCAR, CAPS, SSR and EST-SSR markers. Mol. Breed. 29, 245–260. Carlier, J.D., Coppens d’Eeckenbrugge, G., Leitao, J.M., 2007. Pineapple genome mapping and molecular breeding in plants. In: Kole, C. (Ed.), Fruits Nuts 4, 331–342. Coppens d’Eeckenbrugge, G., Leal, F., 2003. Morphology, anatomy and taxonomy. In: Bartholomew, D.P., Paull, R.E., Rohrbach, K.G. (Eds.), The Pineapple: Botany, Production and Uses. CABI Publishing, Oxon, UK, pp. 13–32. Coppens d’Eeckenbrugge, G., Cabral, J.R.S., Carlier, J.D., Duval, M.F., Ferreira, F.R., Leal, F., Leitao, J., de Matos, A.P., Noyer, J.L., Suárez, Z., Subhadrabandhu, S., Chairidchai, P., 2000. The EU-funded project evaluation and utilization of pineapple genetic resources from the Amazon to breed resistant varieties. Acta Hortic. 529, 169–174. DeWald, M.G., Moore, G.A., Sherman, W.B., 1992. Isozymes in Ananas (pineapple): genetics and usefulness in taxonomy. J. Am. Soc. Hortic. Sci. 117, 491–496. Duval, M.F., Coppens d’Eeckenbrugge, G., Ferreira, F., Bianchetti, B., Cabral, J., 1997. First results from joint EMBRAPA–CIRAD Ananas germplasm collecting in Brazil and French Guyana. Acta Hortic. 425, 137–144.

Duval, M.F., Noyer, J.L., Perrier, X., Coppens d’Eeckenbrugge, G., Hamon, P., 2001. Molecular diversity in pineapple assessed by RFLP markers. Theor. Appl. Genet. 102, 83–90. Escribano, P., Viruel, M.A., Hormaza, J.I., 2004. Characterization and cross-species amplification of microsatellite markers in cherimoya (Annona cherimola Mill Annonaceace). Mol. Ecol. Notes 4, 746–748. Escribano, P., Viruel, M.A., Hormaza, J.I., 2008. Development of 52 new polymorphic SSR markers from cherimoya (Annona cherimola Mill.) transferability to related taxa and selection of a reduced set for DNA fingerprinting and diversity studies. Mol. Ecol. Resour. 8, 317–321. Excoffier, L.G., Laval, G., Schneider, S., 2005. Arlequin ver 3.0: an integrated software package for population genetics data analysis. Evol. Bioinform. Online 1, 47–50. FAOSTAT, 2012. Food and Agriculture Organization of the United Nations Online Database. http://faostat.fao.org/site/567/default.aspx#ancor (accessed January 2013). Ferreira, F., Cabral, J., 1993. Pineapple germplasm in Brazil. Acta Hortic. 334, 23–26. Feuser, S., Meler, K., Daquinta, M., Guerra, M.P., Nodari, R.O., 2003. Genotypic fidelity of micropropagated pineapple (Ananas comosus) plantlets assessed by isozyme and RAPD markers. Plant Cell Tissue Organ Culture 72, 221–227. Kato, C.Y., Nagai, C., Moore, P.H., Zee, F., Kim, M.S., Steiger, D.L., Ming, R., 2004. Intraspecific DNA polymorphism in pineapple (Ananas comosus (L) Merr.) assessed by AFLP markers. Genet. Resour. Crop Evol. 51, 815–825. Kinsuat, M., Kumar, V., 2007. Polymorphic microsatellite and cryptic simple repeat sequence markers in pineapples (Ananas comosus var. comosus). Mol. Ecol. Notes 7, 1032–1035. Leal, F., García, M., Cabot, M., 1986. Prospección y recolección de Ananas y sus congéneres en Venezuela. Plant Genet. Resour. Newslett. 66, 16–19. Nei, M., 1973. Analysis of gene diversity in subdivided populations. Proc. Nat. Acad. Sci. U.S.A. 70, 3321–3323. Nei, M., Li, W., 1979. Mathematical-model fir studying genetic-variation in terms of restriction endonucleases. Proc. Nat. Acad. Sci. U.S.A. 76, 5269–5273. Noyer, J., Launad, C., Coppens d’Eeckenbrugge, G., Duval, M.F., 1997. RFLP study on rDNA variability in Ananas genus. Acta Hortic. 425, 153–160. Paetkau, D., Calvert, V., Stirling, I., Strobeck, C., 1995. Microsatellite analysis of population-structure in Canadian polar bears. Mol. Ecol. 4, 347–354. Paull, R.E., Duarte, O., 2011. Pineapple. In: Paull, R.E., Duarte, O. (Eds.), Tropical Fruits, vol. 1, 2nd ed. CAB International, Wallingford, UK. Pérez, G., Yanes, E., Isidrón, M., Lorenzo, J.C., 2009. Phenotypic and AFLP characterization of two new pineapple somaclones derived from in vitro culture. Plant Cell Tissue Organ Cult. 96, 113–116. Py, C., Lacoeuilhe, J., Teisson, C., 1987. The pineapple: cultivation and uses, vol. 568. G.P. Maisonneuve et Larose, Paris. Ruas, C.F., Ruas, P.M., Cabral, J.R., 2001. Assessment of genetic relatedness of the genera Ananas and Pseudananas confirmed by RAPD markers. Euphytica 119, 245–252. Sanewski, G., 2007. Breeding Ananas for the cut-flower and garden markets. Acta Hortic. 822, 71–78. Smith, L., Downs, R., 1979. Bromelioides (Bromeliaceae). Flora Neotrop. Monogr. 14, 1493–2142. Sripaoraya, S., Blackhall, N.W., Marchant, R., Power, J.B., Lowe, K.C., Davey, M.R., 2001. Relationships in pineapple by random amplified polymorphic DNA (RAPD) analysis. Plant Breed. 120, 265–267. Steve, R., Helen, J., 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132, 365–386. Tapia, E., Gutiérrez, A., Guillén, H., Warbourton, M., Uriza, D., Rebolledo, A., 2005a. Characterization of pineapple germplasm (Ananas spp) by mean AFLPs. Acta Hortic. 666, 109–111. Tapia, E., Guillén, H., Gutiérrez, M.A., 2005b. Caracterización genética de materiales ˜ (Ananas spp.) mediante RAPD e ISSR. Rev. Fitotec. Mex. 28, 187–194. de pina Van de Peer, Y., De Watchter, R., 1994. TREECON for windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput. Appl. Biosci. 10, 569–570. Whöhrmann, T., Weising, K., 2011. In silico mining for simple sequence repeat loci in a pineapple expressed sequence tag database and cross-species amplification of EST-SSR markers across Bromeliaceae. Theor. Appl. Genet. 123, 635–647. Wright, S., 1951. The genetical structure of populations. Annu. Eugen. 15, 323–354. Yanes, E., Gil, K., Rebolledo, L., Rebolledo, A., Uriza, D., Martinez, O., Isidron, M., Simpson, J., 2005. AFLP characterization of the Mexican pineapple germplasm collection. J. Am. Soc. Hortic. Sci. 130, 575–579. Yanes, E., Gil, K., Rebolledo, L., Rebolledo, A., Uriza, D., Martínez, O., Isidrón, M., Díaz, L., Lorenzo, J.C., Simpson, J., 2012. Genetic diversity of Cuban pineapple germplasm assessed by AFLP markers. Crop Breed. Appl. Biotech. 12, 104–110. Yeh, F., Young, R., Timothy, B., Boyle, T., Ye, Z., Mao, J., 1997. Popgene, the UserFriendly Shareware for Population Genetic Analysis. Molecular Biology and Biotechnology Center, University of Alberta, Canada.