Polymorphism in the CCR5 Gene Promoter and HIV-1 Infection in North Indians

Polymorphism in the CCR5 Gene Promoter and HIV-1 Infection in North Indians Gurvinder Kaur, P. Singh, C.C. Rapthap, N. Kumar, M. Vajpayee, S.K. Sharma, A. Wanchu, and N.K. Mehra ABSTRACT: The clinical course and outcome of human immunodeficiency virus–1 (HIV-1) infection are highly variable among individuals. CCR5 is the primary coreceptor that mediates entry of HIV-1 (R5) into permissive host cells. In this study, five SNPs (59029G/A, 59353T/C, 59356C/T, 59402A/G, and 59653C/T) in the promoter region and a deletion of 32 bp (⌬32) in the CCR5 gene were evaluated in 180 chronically HIV-1– infected North Indians. The study showed the following: (1) the protective CCR5 ⌬32 allele was absent; (2) the frequency of CCR5*59402A allele in the HIV-infected people (66.4%) was higher than in healthy subjects (57.1%, p ⫽ 0.027) and in the CDC stage C patients (76%) versus stages A and B patients together (60%; p ⫽ 0.002); (3) homozygous CCR5*59402 AA genotype was significantly increased in the seropositive subjects (46.1%) compared with healthy control subjects (30.2%; ABBREVIATIONS AIDS acquired immunodeficiency syndrome CDC Centers for Disease Control and Prevention

INTRODUCTION Individuals infected with human immunodeficiency virus–1 (HIV-1) show extreme heterogeneity in immune responsiveness, leading to variable degrees of susceptibility and rates of progression to acquired immunodeficiency syndrome (AIDS). This variability is governed to a large extent by multiple host genetic factors including

From the Departments of Transplant Immunology and Immunogenetics (G.K., P.S., C.C.R., N.K., J.K.M.), Microbiology (M.V.), and Medicine (S.K.), All India Institute of Medical Sciences, New Delhi, India; and Department of Internal Medicine (A.W.), Post Graduate Institute of Medical Education and Research, Chandigarh, India. Address reprint requests to: Prof. N.K. Mehra, Head, Department of Transplant Immunology and Immunogenetics, All India Institute of Medical Sciences, Ansari Nagar, New Delhi-110029, India; Tel: (91 11) 265 88 588; Fax: (91 11) 265 88 663; E-mail [email protected]. Received May 2, 2006; revised January 3, 2007; accepted January 9, 2007. Human Immunology 68, 454 – 461 (2007) © American Society for Histocompatibility and Immunogenetics, 2007 Published by Elsevier Inc.

p ⫽ 0.008) and in the CDC stage C patients (59.2%) compared with stage A and B subjects (37.6%, p ⫽ 0.007); and (4) an increased frequency of homozygous ACCAC haplotype was present in the seropositive stage C patients (32.4%) versus 15.6% in patients in stages A plus B (p ⫽ 0.013). These observations suggest an association of CCR5*59402A with increased likelihood of acquisition of HIV-1 and development of AIDS in the Asian Indian population. Further studies are required to confirm these findings and understand the effect of CCR5 polymorphisms on the outcome of HIV-1 infection. Human Immunology 68, 454 – 461 (2007). © American Society for Histocompatibility and Immunogenetics, 2007. Published by Elsevier Inc. KEYWORDS: Chemokine receptors; polymorphism; HIV-1; CCR5; AIDS

HIV-1 human immunodeficiency virus–1 SNP single nucleotide polymorphism

chemokine receptors, their ligands, MHC molecules, cytokines and their receptors [1–5]. Chemokine receptor CCR5 acts as a major coreceptor for entry of M-tropic, non syncytium inducing HIV-1 virions (R5 isolates) that generally initiate infection. The receptor is expressed on the surface of monocytes/ macrophages, dendritic cells, microglial cells and activated T cells. A number of polymorphisms exist in the CCR5 gene that have been associated with resistance to HIV-1 infection and with rapid or slow rate of progression to AIDS [5–10]. The CCR5 ⌬32 is a naturally occurring knockout deletion variant that introduces a premature stop codon and results in truncation of the protein synthesized. The truncated CCR5 protein is not expressed on the cell surface, leading to effectively restricted HIV-1 cell entry in homozygous people [11–14] and delayed AIDS progression in het0198-8859/07/$–see front matter doi:10.1016/j.humimm.2007.01.016

CCR5 Gene Promoter and HIV-1 Infection

FIGURE 1 The main CCR5 human haplotypes and their phylogenetic tree, including putative “ancestral” haplotype HHA, are represented. @Numbering system 1 is based on Genbank accession numbers AF031236, AF031237 [21], whereas 2 is relative to the translational site [9] and 3 is based on Genbank accession number U95626 [34]. #The promoter alleles (P1–P10) are numbered according to Martin et al. [8]. The SNPs (at positions 59029, 59353, 59356, 59402, 59653) in CCR5 cis-region shown with gray background have been genotyped in this study, and the corresponding haplotypes are indicated.

erozygotes [15, 16]. Distribution of the protective ⌬32 allele is however restricted to Northern Europe, where it occurs at a frequency of 10%–16% [17, 18] and its frequency decreases in a Southeast cline toward the Mediterranean and gradually disappears toward the African and Asian populations [19]. Additional polymorphisms in the 5=cis-regulatory region of CCR5 have been defined [20] that affect susceptibility to HIV-1 infection and development of AIDS. Based on a unique constellation of single nucleotide polymorphisms, predominantly in the promoter region of CCR5, the gene has been organized into a number of haplotypes. A schematic organization of CCR5 haplotypes reported by other investigators and those identified in this study is shown in Figure 1. A set of seven evolutionarily distinct CCR5 human haplotypes, namely, HHA, HHB, HHC, HHD, HHE, HHF (F*1, F*2), and HHG (G*1, G*2), have been defined by Gonzalez et al. 1999 [21]. This organization differs from that reported earlier by Martin et al. 1998 [8], in which 10 CCR5 promoter alleles (i.e., P1– P10) have been described based on genotypic data from a region ⫹208 to ⫹811. These promoter alleles repre-

455

sent only a subset of the HHA–HHG haplotypes. The P1 allele is a composite of at least three haplotypes that share 303A and 627C (i.e., HHE, HHF*1, and HHG*1). P2, P3, and P4 correspond to HHA, HHD, and HHC, respectively. The additional alleles defined by P5–P10 are members of HHA, -B, -C, or -D. A number of studies have shown that CCR5 promoter haplotypes are associated with susceptibility to HIV infection and progression to AIDS [16, 21–30]. It has been reported that persons who are homozygous for allele CCR5*59029G may progress to AIDS more slowly than those who are homozygous for the CCR5*59029A allele [7]. Homozygosity for CCR5*59356 T allele, a polymorphism that occurs more frequently in African American persons than in Caucasian or Hispanic persons, has been associated with increased perinatal transmission [6]. In Caucasian individuals, the homozygous haplogroup HHE has been associated with both increased likelihood and an accelerated course of infection [21, 23, 24] but not among African Americans [9]. HHE has also been associated with perinatal infection in the Argentinean children [25]. Similarly, it has been reported to be associated with acquisition of HIV-1 infection, accelerated CD4 decline, and disease progression in Thai HEPS individuals [26] and Thai IDUs [27]. In the African population, homozygosity of HHD has been reported to be associated with increased perinatal infection [6] and with more rapid disease progression [28]. Furthermore, HHC has been associated with faster disease progression among African Americans [21], although in the Thai population, this haplotype is reported with slower disease progression [27]. A late onset of AIDS has also been reported among the Japanese hemophiliac individuals with HHC [29]. The CCR5 haplogroups HHG*2 and HHF*2 have been associated with slower HIV disease progression among Caucasian and African-American individuals, respectively, possibly because of the protective effects of ⌬32 and CCR2 64I respectively [21]. Because distributions of CCR5 polymorphisms vary greatly among different populations, it is hypothesised that these polymorphisms influence HIV-1 transmission and disease progression differentially according to their distribution in a race-specific manner. Although distribution of CCR5 promoter variations has been reported in a representative study on uninfected individuals from southern India [31], it has not been investigated in details in the HIV-infected Asian Indian population. This study was carried out to determine the influence of CCR5 polymorphisms on HIV-1 infection among the Asian northern Indian population.

456

MATERIALS AND METHODS Subjects A total of 119 unrelated healthy individuals and 180 HIV-1 seropositive subjects of thte same ethnicity from northern India (particularly Delhi and its immediate surrounding areas) were enrolled in the study. The healthy individuals were randomly selected from among the hospital staff and students. The HIV-1–infected cohort was collected from the AIDS clinic at the Department of Microbiology, All India Institute of Medical Sciences (AIIMS), New Delhi. The patient cohort consisted of chronically infected individuals with confirmed serodiagnosis of HIV-1 and had either no history or a ⬍6-week prior history of antiretroviral therapy. The HIV-1 seropositive study cohort had a median age of 31 years, median CD4 counts of 198/␮l (range 23–1284/ ␮l), and median CD8 counts of 937/␮l (range 192– 6948/␮l). The HIV-1 seropositive subjects were in different stages of disease progression. Although their plasma viremia (HIV RNA copies/ml) and number of years of seroprevalence without antiretroviral therapy were not known, their CD4 T cell counts were available. Therefore, depending on their CD4 counts and based on clinical symptoms they were divided into stages A (n ⫽ 50), B (n ⫽ 59), and C (n ⫽ 71) as per the Centers for Disease Control and Prevention (CDC) criteria [32, 33] (Table 1). Only individuals who had a minimum follow-up time of at least 6 months were included in the study. A 10-ml quantity of peripheral blood was collected from each subject by phlebotomy after informed consent and as per the human experimentation ethical guidelines laid down by the AIIMS. Genomic DNA was isolated by the salting out procedure and subjected to CCR5 genotyping using allele specific primers. Genotyping The SNPs in 5= regulatory region of CCR5 gene (at positions 59029 G/A, 59353 T/C, 59356 C/T, 59402 A/G and 59653 C/T) (numbered according to Genbank accession number U95626) were tested using sequence specific primers and protocol as described [34] and as shown in Table 2. The CCR5 ⌬32 deletion was genotyped by detecting size differences in the amplicons generated using primers mentioned in Table 2. All PCR amplifications were carried out in presence of 2.5 mmol/L MgCl2, 200 nmol/L each primer and subjected to thermal cycling as follows: 95°C for 2 minutes; 31 cycles of denaturation at 94°C for 25 seconds, annealing at 65°C (or 55°C for CCR5 ⌬32) for 45 seconds, extension at 72°C for 45 seconds; followed by 72°C for 6 min. The amplified products were electrophoresed and visualized in ethidium bromide–stained 2% agarose gels. The alleles and genotypes were scored and

G. Kaur et al.

TABLE 1 CDCa classification of HIV-1–seropositive individuals

Feature Age (y) Median Range Mean CD4 counts/␮l Median Range Mean CD8 counts/␮l Median Range Mean

Total HIV⫹ (n ⫽ 180)

Stage A (n ⫽ 50)

Stage B (n ⫽ 59)

Stage C (n ⫽ 71)

31 2–66 32.23 198 23–1284 231.9

29 2–60 29.64 298 58–1284 338.7

33 3–66 33.76 194 55–532 222.8

32 4–64 32.77 142 23–669 170.1

937 192–6948 1056

1049 334–3598 1146

901 258–2048 984.2

917 192–6948 1058

HIV ⫽ human immunodeficiency virus. Clincal symptoms in Category A: Asymptomatic HIV infection, persistent generalized lymphadenopathy; Category B: Oropharyngeal and vulvovaginal candidiasis, constitutional symptoms such as fever (38.5°C) or diarrhea lasting ⬎1 month, herpes zoster; Category C: Mycobacterium tuberculosis (pulmonary and disseminated), Pneumocystis carinii pneumonia, candidiasis of bronchi; trachea, or lungs, extrapulmonary cryptococcosis, cytomegalovirus, HIVrelated encephalopathy, Kaposi’s sarcoma, wasting syndrome caused by HIV [33]. a Centers for Disease Control and Prevention, Atlanta, GA [32].

subjected to statistical analyses. Differences between the genotypic features of the CCR5 haplotypes and the classification system used in this study and relatively those reported by other investigators are defined in Figure 1. Statistical Analysis The relative frequencies of CCR5 alleles, genotypes, haplotypes, and Hardy-Weinberg proportions (HWP) were determined among the healthy North Indian population using the population genetics analysis software package Pypop, available online at http://allele5.biol. berkeley.edu/pypop/ and as described [35]. The EwensWatterson homozygosity tests of neutrality with Slatkin’s exact p values were used to indicate any deviations from the hypothesis of neutral selection. Frequencies of CCR5 alleles and genotypes in the HIV-infected group of people were calculated by direct counting and the significance of their association was evaluated by the ␹2 or Fisher’s exact tests where applicable. Comparisons were made between healthy subjects versus total seropositive individuals followed by comparisons within the HIV seropositive patients classified under different CDC categories. Differences were considered to be significant only if p values were ⬍0.05 and their odds ratios (OR) and 95% confidence intervals (CI) were calculated.

CCR5 Gene Promoter and HIV-1 Infection

457

TABLE 2 Primers used for genotyping CCR5 polymorphisms Specificity 59029G–59353T 59029G–59353C 59029A–59353T 59029A–59353C 59029G–59402G 59029G–59402A 59029A–59402G 59029A–59402A 59029G–59356C 59029G–59356T 59653C 59653T ⌬32

Forward primer (5= to 3=) Annealing positiona

Reverse primer (5= to 3=) Annealing positiona

Amplicon Size (bp)

Annealing temp.

GAGTGGAGAAAAAGGGGG [59012-59029] GAGTGGAGAAAAAGGGGG [59012-59029] GAGTGGAGAAAAAGGGGA [59012-59029] GAGTGGAGAAAAAGGGGA [59012-59029] GAGTGGAGAAAAAGGGGG [59012-59029] GAGTGGAGAAAAAGGGGG [59012-59029] GAGTGGAGAAAAAGGGGA [59012-59029] GAGTGGAGAAAAAGGGGA [59012-59029] GAGTGGAGAAAAAGGGGG [59012-59029] GAGTGGAGAAAAAGGGGG [59012-59029] CAGGAAACCCATAGAAGAC [59635-59653] CAGGAAACCCATAGAAGAT [59635-59653] TCATTACACCTGCAGCTCTC [62004-62023]

AGAATAGATCTCTGGTCTGAAA [59374-59353] AGAATAGATCTCTGGTCTGAAG [59374-59353] AGAATAGATCTCTGGTCTGAAA [59374-59353] AGAATAGATCTCTGGTCTGAAG [59374-59353] AGAATCAGAGAACAGTTCTTCC [59423-59402] AGAATCAGAGAACAGTTCTTCT [59423-59402] AGAATCAGAGAACAGTTCTTCC [59423-59402] AGAATCAGAGAACAGTTCTTCT [59423-59402] TAGAGAATAGATCTCTGGTCTG [59377-59356] TAGAGAATAGATCTCTGGTCTA [59377-59356] GTGGGCACATATTCAGAAG [59943-59925] GTGGGCACATATTCAGAAG [59943-59925] TGGTGAAGATAAGCCTCAC [62182-62200]

363

65°C

363

65°C

363

65°C

363

65°C

412

65°C

412

65°C

412

65°C

412

65°C

367

65°C

367

65°C

309

65°C

309

65°C

⌬32 ⫽ 165; wt ⫽ 197

55°C

Temp. ⫽ temperature. Adapted from Tang et al. [34]. a Accession number U95626.

RESULTS Absence of CCR5 32 bp deletion No mutant CCR5 ⌬32 allele was observed in any of the subjects tested, irrespective of HIV-1 infection status. All subjects included in the study carried the wild-type CCR5 alleles. CCR5 promoter alleles and genotypes The percent allele frequencies corresponding to five SNPs in the promoter region of CCR5 at positions 59029, 59353, 59356, 59402, and 59653 in the HIV1–infected individuals and healthy controls are shown in Table 3. The frequency of allele CCR5*59402A was increased in the HIV-positive cohort (66.4%) compared with healthy controls (57.1%; p ⫽ 0.02; OR ⫽ 0.68; 95% CI ⫽ 0.48 – 0.94). A further comparison of *59402A allele frequencies in between different stages of HIV-infected patients revealed a significant increase in its frequency in the HIV-infected patients in stage C (76%) compared with those together in stages A plus B (60%, p ⫽ 0.002; OR ⫽ 2.109; 95% CI ⫽ 1.31–3.37). The allele frequencies corresponding to SNPs at positions 59029, 59353, 59356, and 59653 in promoter region of

CCR5 did not show any significant difference between HIV-infected patients and healthy controls. The frequencies of CCR5 promoter genotypes are shown in Table 3. The 59402AA homozygous genotype was observed at an increased frequency in the HIVpositive cohort (46.1% vs 30.2% in healthy controls, p ⫽ 0.008; OR ⫽ 0.5; 95% CI ⫽ 0.3– 0.82) and in the HIV-positive stage C patients (59.2% versus 37.6% in non–stage C patients, i.e., in stages A and B taken together, p ⫽ 0.007; OR ⫽ 2.4; 95% CI ⫽ 1.3– 4.42). CCR5 Promoter Haplotypes The CCR5 haplotypes spanning five SNPs in the promoter region were evaluated in HIV-positive patients as shown in Table 4. Of the six CCR5 promoter haplotypes observed, GTCGC was the most common haplotype in healthy people, whereas the haplotype ACCAC was the most common in HIV-1–infected individuals tested. The GTCGC haplotype was observed at a frequency of 40.8% among healthy controls but 32.5% in HIV-positive individuals (p ⫽ 0.048; OR ⫽ 1.42; 95% CI ⫽ 1.01–2.0). The CCR5 haplotype ACCAC was found at a frequency of 38.7% in healthy controls but 42.5% among the

458

G. Kaur et al.

TABLE 3 Frequencies of alleles and genotypes of single-nucleotide polymorphisms (SNPs) in CCR5 promoter region

Allele or genotype *59029

59353

ⴱ59356

ⴱ59402

ⴱ59653

G A GG GA AA T C TT TC CC C T CC CT TT A G AA AG GG C T CC CT TT

Healthy controls No. (%) (n ⫽ 119)

HIV-1 seropositive No. (%) (n ⫽ 180)

Stage A No. (%) (n ⫽ 50)

Stage B No. (%) (n ⫽ 59)

Stage C No. (%) (n ⫽ 71)

146 (61.3) 92 (38.7) 42 (35.3) 62 (52.1) 15 (12.6) 146 (61.3) 92 (38.7) 42 (35.3) 62 (52.1) 15 (12.6) 233 (97.9) 5 (2.1) 115 (96.7) 3 (2.5) 1 (0.8) 136 (57.1) 102 (42.9) 36 (30.2) 64 (53.8) 19 (16) 238 (100) 0 (0) 119 (100) 0 0

203 (56.4) 157 (43.6) 64 (35.6) 75 (41.7) 41 (22.8) 203 (56.4) 157 (43.6) 64 (35.6) 75 (41.7) 41 (22.8) 353 (98.1) 7 (1.9) 175 (97.2) 3 (1.7) 2 (1.1) 239a (66.4) 121 (33.6) 83c (46.1) 73 (40.6) 24 (13.3) 356 (98.9) 4 (1.1) 176 (97.8) 4 (2.2) 0

61 (61) 39 (39) 22 (44) 17 (34) 11 (22) 61 (61) 39 (39) 22 (44) 17 (34) 11 (22) 98 (98) 2 (2) 49 (98) 0 1 (2) 61 (61) 39 (39) 20 (40) 21 (42) 9 (18) 100 (100) 0 50 (100) 0 0

72 (61) 46 (39) 20 (33.9) 32 (54.2) 7 (11.9) 72 (61) 46 (39) 20 (33.9) 32 (54.2) 7 (11.9) 117 (99.2) 1 (0.9) 58 (98.3) 1 (1.7) 0 70 (59.3) 48 (40.7) 21 (35.6) 28 (47.5) 10 (16.9) 117 (99.2) 1 (0.8) 58 (98.3) 1 (1.7) 0

70 (49.3) 72 (50.7) 22 (31) 26 (36.6) 23 (32.4) 70 (49.3) 72 (50.7) 22 (31) 26 (36.6) 23 (32.4) 138 (97.2) 4 (2.8) 68 (95.8) 2 (2.8) 1 (1.4) 108b (76) 34 (23.9) 42d (59.2) 24 (33.8) 5 (7) 139 (97.9) 3 (2.1) 68 (95.8) 3 (4.2) 0

␹2 ⫽ 4.85; p ⫽ 0.0276; OR ⫽ 0.675; 95% CI ⫽ 0.481– 0.945. ␹2 ⫽ 9.119; p ⫽ 0.00253; OR ⫽ 2.109; 95% CI ⫽ 1.316 –3.379. c 2 ␹ ⫽ 6.873; p ⫽ 0.00875; OR ⫽ 0.507; 95% CI ⫽ 0.31– 0.826. d 2 ␹ ⫽ 7.185; p ⫽ 0.007353; OR ⫽ 2.402; 95% CI ⫽ 1.303– 4.428. a

b

HIV-infected patients. In this study, individuals bearing CCR5 promoter haplotypes GTCGC or ACCAC also possessed CCR2 64V allele (data not shown). The most common haplotype pair observed in the study was GTCGC/ACCAC. It was found at a frequency of 35.3% in the healthy controls but 27.8% in the HIVinfected cohort. In the HIV-seropositive patients in CDC stage C, the homozygous ACCAC/ACCAC was the most predominant haplotype pair. The HIV-1–positive stage C patients possessed homozygous ACCAC at a higher fre-

quency (32.4%) versus 15.6% in stage A and B HIVpositive patients taken together (p ⫽ 0.013; OR ⫽ 2.59; 95% CI ⫽ 1.26 –5.31). The homozygous GTCAC was observed at an increased frequency in the HIV-positive cohort (10.6%) compared with healthy controls (2.5%; p ⫽ 0.017, OR ⫽ 0.21; 95% CI ⫽ 0.06 – 0.75). The other minor haplotypes observed in the study were ACCAT, GTTAC, and GTTGC, but there were no other significant differences in their frequencies in healthy controls versus HIV-infected study subjects.

TABLE 4 Frequencies of CCR 5 promoter haplotypes in HIV-1–infected subjects

GTCAC GTCGC ACCAC ACCAT GTTAC GTTGC a

Healthy controls No. (%) (n ⫽ 119)

Total HIV⫹ No. (%) (n ⫽ 180)

Stage A No. (%) (n ⫽ 50)

Stage B No. (%) (n ⫽ 59)

Stage C No. (%) (n ⫽ 71)

44 (18.5) 97 (40.8) 92 (38.7) 0 0 5 (2.1)

79 (21.9) 117a (32.5) 153 (42.5) 4 (1.1) 3 (0.8) 4 (1.1)

21 (21) 38 (38) 39 (39) 0 1 (1) 1 (1)

23 (19.5) 48 (40.7) 45 (38.1) 1 (0.8) 1 (0.8) 0

35 (24.6) 31 (21.8) 69 (48.6) 3 (2.1) 1 (0.7) 3 (2.1)

␹2 ⫽ 3.898; p ⫽ 0.048; OR ⫽ 1.428; 95% CI ⫽ 1.017–2.0.

CCR5 Gene Promoter and HIV-1 Infection

DISCUSSION In this study, the protective CCR5⌬32 allele was not found in any of the subjects tested. A rare occurrence of this allele in the Asian Indian population has also been reported in earlier studies [36, 37]. The homozygous CCR5 promoter genotype 59402AA was found at a higher frequency in the HIV-positive individuals and in the patients classified as CDC stage C. This suggests that the CCR5*59402A allele might favor the likelihood of acquisition of HIV-1 infection and development of AIDS. To date, no study has been carried out on the role of CCR5 promoter polymorphisms in the HIV-infected Asian Indian population. This is a cross-sectional study in which CCR5 polymorphisms have been evaluated in HIV-positive subjects from this population. However, one limitation of this study is that the HIV-positive patients could not be classified on the basis of number of years of known seroprevalence without antiretroviral therapy and viral load as this data was not available. Nonetheless, in the absence of such a longitudinal follow-up data, the patients were categorized on the basis of their CD4 counts and clinical CDC classification. Approximately 25%– 30% of the subjects enrolled in the HIV-infected and healthy cohorts were smokers and had no correlation with the status of HIV infection. A relative comparison between HIV-positive subjects and healthy controls was carried out to assess the effect of CCR5 variability on risk of HIV acquisition, whereas analyses in between different disease stages (stages A, B, and C) was performed to evaluate their effect on development of AIDS. The CCR5 genotypes were rescored in a blinded manner and all possible technical errors including assay nonspecificities, sample mishandling or DNA contamination were carefully avoided. The EwensWatterson homozygosity tests of neutrality using Pypop software showed negative values for the Fnd statistic for all the CCR5 SNPs studied except 59356C/T (data not shown) but all the Slatkin’s exact p values of F were insignificant, thereby indicating that CCR5 locus is under balancing selection in the Indian population as has also been suggested in other populations [1, 31]. An evaluation of CCR5 haplotypes for deviation from HWP in healthy Indian population showed insignificant HWP values (⬎0.05; data not shown), thereby indicating that the sample fits HWP equilibrium. As shown in Figure 1, an analogous comparison can be made to some extent between the CCR5 promoter haplotypes identified in this study with those reported by others [8, 9, 21, 34]. The GTCGC haplotype in this study can be compared with the haplogroup HHC in other studies that has been shown to be associated with

459

delayed onset of AIDS in the Thais [27] and the Japanese [29] but with faster disease progression among AfricanAmericans [21]. In this study, the haplotype GTCGC was found to be more predominant in the healthy controls than in HIV-positive subjects, suggesting that it might play a protective role against HIV-1 infection in Asian Indians. Similarly, another CCR5 promoter haplotype ACCAC in this study corresponds to CCR5 haplogroups HHE or HHG*1 in other studies. The haplogroup HHG*1 is a minor haplogroup that is rare in the Indian population [31]. A higher frequency of homozygous CCR5 promoter haplotype ACCAC in the stage C HIV-positive patients compared with those in stages A and B together suggests its possible role in development of AIDS. Such an association of ACCAC in this study is consistent with other studies where the comparable haplogroup HHE has been associated with enhanced acquisition and rate of progression to AIDS in the Caucasian [8, 9] and Thais [26, 27] but not in the Ugandan population [9]. The CCR5 HHE haplogroup has also been associated with an enhanced risk of transmission among Argentinean children exposed perinatally to HIV-1 [25]. The most common haplotype pair observed in this study was GTCGC/ACCAC in HIV –ve and HIVpositive subjects, however, ACCAC/ACCAC was most predominantly found in the HIV-positive patients in stage C. The implications of these findings still remain to be explored further in this population. Overall, the study has indicated a modest role of genetic variations in CCR5 promoter region in acquisition of HIV infection by a “permissive host” and development of AIDS. Further genetic studies covering more number of SNPs in the CCR5 and neighboring region and tested in a larger number of well-categorized seropositive subjects are required to confirm associations between CCR5polymorphisms and HIV status in Asian Indians. Longitudinal cohorts representing various ethnic groups in India need to be studied to help establish association with rates of disease progression and nonprogression. Population studies based on genetic associations are important not only for elucidating the mechanisms of disease pathogenesis but also for developing screening tests for identifying people at risk and determining their responses to drugs and vaccine trials. ACKNOWLEDGMENTS This study was supported by a research grant from the Department of Biotechnology (DBT), Ministry of Science and Technology and the Indian Council of Medical Research (ICMR) Government of India. The authors thank Shekhar Neolia for providing technical assistance.

460

G. Kaur et al.

REFERENCES 1. Arenzana-Seisdedos F, Parmentier M: Genetics of resistance to HIV infection: role of co-receptors and co-receptor ligands. Semin Immunol 18:387, 2006. 2. Shrestha S, Strathdee SA, Galai N, Oleksyk T, Fallin MD, Mehta S, Schaid D, Vlahov D, O’Brien SJ, Smith MW: Behavioral risk exposure and host genetics of susceptibility to HIV-1 infection. J Infect Dis 193:16, 2006. 3. Kaslow RA, Dorak T, Tang JJ: Influence of host genetic variation on susceptibility to HIV type 1 infection. J Infect Dis. 191(Suppl 1):S68, 2005. 4. O’Brien SJ, Nelson GW: Human genes that limit AIDS. Nat Genet 36:565, 2004. 5. Smith MW, Dean M, Carrington M, Winkler C, Huttley GA, Lomb DA, Goedert JJ, O’Brien TR, Jacobson LP, Kaslow R, Buchbinder S, Vittinghoff E, Vlahov D, Hoots K, Hilgartner MW, O’Brien SJ: Contrasting genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression. Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC), ALIVE Study. Science 277:959, 1997. 6. Kostrikis LG, Neumann AU, Thomson B, Korber BT, McHardy P, Karanicolas R, Deutsch L, Huang Y, Lew JF, McIntosh K, Pollack H, Borkowsky W, Spiegel HM, Palumbo P, Oleske J, Bardeguez A, Luzuriaga K, Sullivan J, Wolinsky SM, Koup RA, Ho DD, Moore JP: A polymorphism in the regulatory region of the CC-chemokine receptor 5 gene influences perinatal transmission of human immunodeficiency virus type 1 to African-American infants. J Virol 73:10264, 1999. 7. McDermott DH, Zimmerman PA, Guignard F, Kleeberger CA, Leitman SF, Murphy PM: CCR5 promoter polymorphism and HIV-1 disease progression. Multicenter AIDS Cohort Study (MACS). Lancet 352:866, 1998. 8. Martin MP, Dean M, Smith MW, Winkler C, Gerrard B, Michael NL, Lee B, Doms RW, Margolick J, Buchbinder S, Goldert JJ, O’Brien TR, Hilgartner MW, Vlahov D, O’Brien SJ, Carrington M: Genetic acceleration of AIDS progression by a promoter variant of CCR5. Science 282: 1907, 1998. 9. Mummidi S, Bamshad M, Ahuja SS, Gonzalez E, Feuillet PM, Begum K, Galvis MC, Kostecki V, Valente AJ, Murthy KK, Haro L, Dolan MJ, Allan JS, Ahuja SK: Evolution of human and non-human primate CC chemokine receptor 5 gene and mRNA. Potential roles for haplotype and mRNA diversity, differential haplotypespecific transcriptional activity, and altered transcription factor binding to polymorphic nucleotides in the

10.

11.

12.

13.

14.

15.

16.

17.

18.

pathogenesis of HIV-1 and simian immunodeficiency virus. J Biol Chem 275: 18946, 2000. Blanpain C, Lee B, Tackoen M, Puffer B, Boom A, Libert F, Sharron M, Wittamer V, Vassart G, Doms RW, Parmentier M: Multiple nonfunctional alleles of CCR5 are frequent in various human populations. Blood 96:1638, 2000. Dean M, Carrington M, O’Brien SJ: Balanced polymorphism selected by genetic versus infectious human disease. Annu Rev Genomics Hum Genet 3:263, 2002. Huang Y, Paxton WA, Wolinsky SM, Neumann AU, Zhang L, He T, Kang S, Ceradini D, Jin Z, Yazdanbaksh K, Kunstman K, Erickson D, Dragon E, Landau NR, Phair J, Ho DD, Koup RA: The role of a mutant CCR5 allele in HIV-1 transmission and disease progression. Nat Med 2:1240, 1996. Liu R, Paxton WA, Choe S, Ceradini D, Martin SR, Horuk R, MacDonald ME, Stuhlmann H, Koup RA, Landau NR: Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 86:367, 1996. O’Brien TR, Winkler C, Dean M, Nelson JA, Carrington M, Michael NL, White GC 2nd: HIV-1 infection in a man homozygous for CCR5 delta 32. Lancet 349:1219, 1997. Buseyne F, Janvier G, Teglas JP, Ivanoff S, Burgard M, Bui E, Mayaux MJ, Blanche S, Rouzioux C, Riviere Y: Impact of heterozygosity for the chemokine receptor CCR5 32 bp deleted allele on plasma virus load and CD4 T lymphocytes in perinatally human immunodeficiency virus infected children at 8 years of age. J Infect Dis 178:1019, 1998. Zimmerman PA, Buckler-White A, Alkjatib G, Spalding T, Kubofcik J, Combadiere C, Weissman D, Cohen O, Rubbert A, Lam G, Vaccarzza M, Kennedy PE, Kumaraswami V, Giorgi JV, Detels R, Hunter J, Chopek M, Berger EA, Fauci AS, Nutman TB, Murphy PM: Inherited resistance to HIV-1 conferred by an inactivating mutation in CC chemokine receptor 5: studies in populations with contrasting clinical phenotypes, defined racial background, and quantified risk. Mol Med 3:23, 1997. Libert F, Cochaux P, Beckman G, Samson M, Aksenova M, Cao A, Czeizel A, Claustres M, de la Rua C, Ferrari M, Ferrec C, Glover G, Grinde B, Guran S, Kucinskas V, Lvinha J, Mercier B, Ogur G, Peltonen L, Rosatelli C, Schwartz M, Spitsyn V, Timar L, Beckman L, Parmentier M, Vassart G: The deltaCCR5 mutation conferring protection against HIV-1 in Caucasian populations has a single and recent origin in North Eastern Europe. Hum Mol Genet 7:399, 1998. Lucotte G, Mercier G: Distribution of the CCR5 gene 32 bp deletion in Europe. J Acquir Defic Syndr Hum Retrovir 19:174, 1998.

CCR5 Gene Promoter and HIV-1 Infection

19. Martinson JJ, Chapman NH, Rees DC, Liu YT, Clegg JB: Global distribution of the CCR5 gene 32-basepair deletion. Nat Genet 16:100, 1997. 20. Mummidi S, Ahuja SS, McDaniel BL, Ahuja SK: The human CC chemokine receptor 5 (CCR5) gene. Multiple transcripts with 5= end heterogeneity, dual promoter usage, and evidence for polymorphisms within the regulatory regions and noncoding exons. J Biol Chem 272: 30662, 1997. 21. Gonzalez E, Bamshad M, Sato N, Mummidi S, Dhanda R, Catano G, Cabrera S, McBride M, Cao XH, Merrill G, O’Connell P, Bowden DW, Freedman BI, Anderson SA, Walter EA, Evans JS, Stephan KT, Clark RA, Tyagi S, Ahuja SS, Dolan MJ, Ahuja SK: Race-specific HIV-1 disease-modifying effects associated with CCR5 haplotypes.Proc Natl Acad Sci USA 96:12004, 1999. 22. Singh KK, Barroga CF, Hughes MD, Chen J, Raskino C, McKinney RE, Spector SA: Genetic influence of CCR5, CCR2 and SDF-1 variants on HIV-1 related disease progression and neurological impairment in children with symptomatic HIV-1 infection. J Infect Dis 188:1461, 2003. 23. Tang J, Shelton B, Makhatadze NJ, Zhang Y, Schaen M, Louie LG, Goedert JJ, Seaberg EC, Margolick JB, Mellors J, Kaslow RA: Distribution of chemokine receptor CCR2 and CCR5 genotypes and their relative contribution to human immunodeficiency virus type 1 (HIV-1) seroconversion, early HIV-1 RNA concentration in plasma, and later disease progression. J Virol 76:662, 2002. 24. Ming Li, Song R, Masiciotra S, Soriano V, Spira TJ, Lal RB, Yang C: Association of CCR5 human haplogroup E with rapid HIV type 1 disease progression. AIDS Res Hum Retrovir 21:111, 2005. 25. Mangano A, Gonzalez E, Dhanda R, Catano G, Bamshad M, Bock A, Duggirala R, Williams K, Mummidi S, Clark RA, Ahuja SS, Dolan MJ, Bologna R, Sen L, Ahuja SK: Concordance between the CC chemokine receptor 5 genetic determinants that alter risks of transmission and disease progression in children exposed perinatally to human immunodeficiency virus. J Infect Dis 183:1574, 2001. 26. Sriwanthana B, Hodge T, Mastro TD, Dezzutti CS, Bond K, Stephens HA, Kostrikis LG, Limpakarnjanarat K, Young NL, Qari SH, Lal RB, Chandanayingyong D, McNicholl JM: HIV-specific cytotoxic T lymphocytes, HLA-A11, and chemokine related factors may act synergistically to determine HIV resistance in CCR5 D32 negative female sex workers in Chiang Rai, northern Thailand. AIDS Res Hum Retrovir 17:719, 2001. 27. Nguyen L, Li M, Chaowanachan T, Hu DJ, Vanichseni S, Mock PA, van Griensven F, Martin M, Sangkum U, Choopanya K, Tappero JW, Lal RB, Yang C: CCR5 promoter human haplogroups associated with HIV-1 dis-

461

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

ease progression in Thai injection drug users. AIDS 18:1327, 2004. John GC, Bird T, Overbaugh J, Nduati R, Mbori-Ngacha D, Rostron T, Dong T, Kostrikis L, Richardson B, Rowland-Jones SL: CCR5 promoter polymorphisms in a Kenyan perinatal human immunodeficiency virus type 1 cohort: association with increased 2 year maternal mortality. J Infect Dis 184:89, 2001. Kageyama S, Mimaya J, Yamada K, Kurimura T, Shiraki K: Polymorphism of CCR5 affecting HIV disease progression in the Japanese population. AIDS Res Hum Retrovir 17:991, 2001. Ioannidis JP, Rosenberg PS, Goedert JJ, Ashton LJ, Benfield TL, Buchbinder SP, Coutinho RA, Eugen-Olsen J, Gallart T, Katzenstein TL, Kostrikis LG, Kuipers H, Louie LG, Mallal SA, Margolick JB, Martinez OP, Meyer L, Michael NL, Operskalski E, Pantaleo G, Rizzardi GP, Schuitemaker H, Sheppard HW, Stewart GJ, Theodorou ID, Ullum H, Vicenzi E, Vlahov D, Wilkinson D, Workman C, Zagury JF, O’Brien TR: International MetaAnalysis of HIV Host Genetics. Effects of CCR5-Delta 32, CCR2-64I, and SDF-1 3=A alleles on HIV-1 disease progression: an international meta analysis of individual patient data. Ann Intern Med 135:782, 2001 Bamshad MJ, Mummidi S, Gonzalez E, Ahuja SS, Dunn DM, Watkins WS, Wooding S, Stone AC, Jorde LB, Weiss RB, Ahuja SK: A strong signature of balancing selection in the 5= cis-regulatory region of CCR5. PNAS 99:10539, 2002. McNicholl JM, Lal RB, Kaslow R: Human immunodeficiency virus (HIV) infection: genetics. In Cooper DN (ed.): Encyclopedia of the Human Genome, Nature Publishing Group, 2003. www.ehgonline.net Vajpayee M, Kaushik S, Sreenivas V, Wig N, Seth P: CDC staging based on absolute CD4 count and CD4 percentage in an HIV-1 infected Indian population: treatment implications. Clin Exp Immunol 141:485, 2005. Tang J, Rivers C, Karita E, Costello C, Allen S, Fultz PN, Schoenbaum EE, Kaslow RA: Allelic variants of human beta-chemokine receptor 5 (CCR5) promoter: evolutionary relationships and predictable associations with HIV-1 disease progression. Genes Immunity 1:20, 1999 Kaur G, Rapthap CC, Kumar N, Kumar S, Neolia S, Mehra NK: Frequency distribution of cytokine gene polymorphisms in the healthy North Indian population. Tissue Antigens (in press). Suresh P, Wanchu A, Sachdeva RK, Bhatnagar A: Gene polymorphisms in CCR5, CCR2, CX3CR1, SDF-1 and RANTES in exposed but uninfected partners of HIV-1 infected individuals in North India. J Clin Immunol 26:476, 2006. Majumdar PP, Dey B: Absence of the HIV-1 protective ⌬CCR5 allele in most ethnic populations of India. Eur J Hum Genet 9:794, 2001.