Polymorphisms in SPINK5 are not associated with asthma in a Dutch population

Mechanisms of asthma and allergic inflammation Polymorphisms in SPINK5 are not associated with asthma in a Dutch population

Mechanisms of asthma and allergic inflammation

Hajo Jongepier, MD, PhD,a,b Gerard H. Koppelman, MD, PhD,c Ilja M. Nolte, PhD,d,e Marcel Bruinenberg,d Eugene R. Bleecker, MD,f Deborah A. Meyers, PhD,f Gerard J. te Meerman, PhD,e and Dirkje S. Postma, MD, PhDb Beatrixoord and Groningen, The Netherlands, and Winston-Salem, NC

Background: Asthma and allergic phenotypes are complex genetic diseases with known linkage to chromosome 5q. This region has many candidate genes, including serine protease inhibitor Kazal type 5 (SPINK5), which has been associated with asthma and atopic dermatitis in family-based studies of children with atopic dermatitis. Objective: We sought to investigate whether single nucleotide polymorphisms in SPINK5 are associated with asthma, atopic phenotypes, and atopic dermatitis. Methods: We investigated whether single nucleotide polymorphisms in SPINK5 (ie, 2785 A/G, Asn368Ser, and Lys420Glu) are associated with asthma, atopic phenotypes, and atopic dermatitis in 200 families ascertained by a proband with asthma (nonaffected spouses served as a matched control population) and an independent set of 252 trios with asthma. Results: We found no association with asthma, atopic phenotypes, and atopic dermatitis after correction for multiple testing. Conclusion: The negative results in this study suggest that SPINK5 is not associated with asthma or atopic phenotypes in individuals ascertained by a proband with asthma. This is consistent with the finding that SPINK5 is not expressed in the lung. Because our patients were ascertained for asthma, a role of SPINK5 in atopic dermatitis cannot be excluded. (J Allergy Clin Immunol 2005;115:486-92.) Key words: Asthma, polymorphism, SPINK5, allergy, atopic dermatitis

Asthma and allergic disorders are complex genetic diseases in which multiple genes and environmental factors play a role in their development and progression. Several genome-wide linkage scans have shown that From athe Department of Pulmonary Rehabilitation, Beatrixoord; bthe Department of Pulmonology, and cBeatrix Children’s Hospital, University Hospital Groningen; the Departments of dMedical Biology and eMedical Genetics, University of Groningen; and fthe Center for Human Genomics, Wake Forest University School of Medicine, Winston-Salem. Supported by grants of the Netherlands Asthma Foundation (AF 95.09 and AF 98.48). Received for publication April 29, 2004; revised December 7, 2004; accepted for publication December 9, 2004. Reprint requests: Dirkje S. Postma, MD, PhD, Department of Pulmonology, University Hospital Groningen, Hanzeplein 1, PO Box 30.001, 9700 RB Groningen, The Netherlands. E-mail: [email protected]. 0091-6749/$30.00 Ó 2005 American Academy of Allergy, Asthma and Immunology doi:10.1016/j.jaci.2004.12.013

486

Abbreviations used FBAT: Family-based association test LD: Linkage disequilibrium SNP: Single nucleotide polymorphism SPINK5: Serine protease inhibitor Kazal type 5 TDT: Transmission disequilibrium test

asthma and atopic phenotypes are linked to chromosome 5q31-33 in a region with a number of biologic candidate genes, including IL4,1 IL13,2 the gene encoding b2adrenoreceptor,3 and CD144 but also serine protease inhibitor Kazal type 5 (SPINK5). By means of linkage analysis and homozygosity mapping, Chavanas et al5 demonstrated that this gene causes Netherton syndrome, a severe recessive congenital dermatologic disease with associated atopy. The same group reported that several mutations within the SPINK5 gene, which encodes the serine protease inhibitor lymph-epithelial Kazal type– related inhibitor (LEKTI), cause Netherton syndrome.6 SPINK5 belongs to the family of serine proteinase inhibitors, which are important negative regulators of proteinase action. SPINK5 has been shown to inhibit the serine proteinases plasmin, subtilisin A, cathepsin G, human neutrophil elastase, and trypsin, but not chymotrypsin, and is thus a major physiologic inhibitor of multiple serine proteinases.7 A total of 34 mutations in SPINK5 resulting in premature termination codons have been identified in patients with Netherton syndrome.8 Walley et al9 found that 2 single nucleotide polymorphisms (SNPs) in SPINK5 (ie, Asn368Ser and Lys420Glu) were associated with atopic dermatitis and total IgE in children ascertained for atopic dermatitis without Netherton syndrome. Furthermore, the Lys420 allele was weakly associated with asthma in these populations, and a maternal parent-of-origin effect on atopy was reported for the Asn368 and Lys420 alleles. The association of the Lys420 allele and atopic dermatitis was confirmed in 2 Japanese populations,10,11 but no significant association with asthma was found, and no parent-oforigin effect could be detected, possibly because of sample size limitations.10 Recently, a study by Kabesch et al12 found association of the Lys420 allele with asthma and

current wheeze in German children aged 9 to 11 years. Thus the association of polymorphisms of SPINK5 with atopic dermatitis has been reported in 2 studies, whereas the association with asthma is less clear and requires further investigation. Because atopy, bronchial hyperresponsiveness, and allergic phenotypes (total serum IgE levels) are linked to chromosome 5q31-33 in our asthmatic families,13 we investigated SPINK5 for association with asthma and atopic phenotypes in 2 Dutch populations with asthma. The aim of our study was to assess whether polymorphisms of the SPINK5 gene are associated with asthma and asthma-related phenotypes.

METHODS Study populations Between 1963 and 1975, patients with symptomatic asthma were referred to Beatrixoord, a local asthma center in the northern part of the Netherlands, for clinical evaluation and optimization of asthma treatment. Two hundred of these asthmatic patients participated between 1991 and 1999 in a family study on the genetics of asthma, together with their spouses, children, children’s spouses, available grandchildren and their spouses, and available great-grandchildren. All individuals have been extensively characterized for asthma and allergy phenotypes, as described previously.14-16 For the purpose of this study, the probands and spouses of these families have been used in a case-control design.17 A second independent asthmatic population was ascertained between 1998 and 2000. This population consisted of probands with asthma from Friesland, a region in the Northern part of The Netherlands with its own language and probably a more homogeneous population. These asthmatic patients have been ascertained through local Frisian hospitals and media appeals. Available parents, sibs, spouses, and children donated DNA to form trios (eg, a proband and both parents) for genetic statistical analyses. All probands have been characterized with the standardized study protocol used in the families but not the other available relatives. All participants had been asked to stop their asthma and allergy medication if possible. They stopped inhaled corticosteroids for 14 days before testing, inhaled long-acting b-agonists and oral antihistamines 48 hours before testing, and inhaled short-acting b-agonists and anticholinergics 8 hours before testing. Therapy with oral corticosteroids was continued. The Medical Ethics Committee of the University Hospital Groningen approved both these studies, and all participants provided written informed consent.

hyperresponsive if the dosage of histamine producing a 20% decrease in FEV1 was 32 mg/mL or less, and the provocative concentration at which a 20% decrease in FEV1 occurred (PC20) was calculated. Intracutaneous skin tests with 16 common aeroallergens were performed, with both a negative and positive control. The allergens tested have been described previously in detail.14 In the trios the mixture of guinea pig and rabbit and the mixed weeds (ie, Artemisia vulgaris and Plantago lanceolata) were replaced by the separate allergens, and Botrytis cineria was not used. The maximum and perpendicular diameters of the wheal were recorded after 15 minutes. The skin test response was considered positive if the mean wheal diameter was larger than 5 mm. The skin tests were not used for further analysis if the negative control elicited a positive reaction (in case-controls, n = 4; in trios, n = 9). Total IgE levels were measured by means of solid-phase immunoassay in the first 92 families15 and by means of an enzymelinked fluorescent assay (Mini Vidas; Biomerieux Inc, Marcy l’Etoile, France) in the second set of 108 families and the trios. Specific IgE levels were measured with an in vitro test system (Pharmacia CAP system, Phadiatop FEIA; Pharmacia Diagnostics AB, Uppsala, Sweden).14 This assay is composed of a mixture of 11 inhalant allergens. The test response was considered positive if the fluorescence score of the individual’s serum was higher than the supplied reference. Specific IgE to Der p 1 (Dermatophagoides pteronyssinus) was measured by using the CAP method (Pharmacia and Upjohn, Uppsala, Sweden). Total blood eosinophils were counted in a counting chamber. The probands of the families were ascertained for asthma, and their spouses without bronchial hyperresponsiveness served as nonasthmatic control subjects. In the trios a diagnosis of asthma was based on an algorithm described previously.16 In this algorithm bronchial hyperresponsiveness, respiratory symptoms, smoking, airway obstruction, and brochodilator response are used to make a diagnosis of asthma. Atopy was defined as a dichotomous variable on the basis of the criteria of Walley et al9 (ie, either IgE >87.3 kU/L, positive skin test response for grasses or house dust mite, or a combination of these criteria). Specific IgE to Der p 1 was defined as a dichotomous variable. Individuals with class 2 IgE levels and higher (>0.7 kU/L) were considered to have positive responses. The control population consisted of individuals who had either negative responses to specific IgE or negative responses to specific Der p 1 IgE (,0.7 kU/L). Total serum IgE levels were considered both dichotomously, with a threshold of either 100 (our criterion) or 87.3 kU/L (criterion of Walley et al9), and continuously (log transformed and age and sex adjusted).

Molecular methods Clinical evaluation Medical data on the diagnosis of asthma and atopic disease, respiratory and atopic symptoms, eczema, types and doses of medications, and history of tobacco smoking were obtained by using a modified version of the British Medical Counsel questionnaire.18 Individuals were considered to have atopic dermatitis if they reported having eczema in answer to the following question: ‘‘Did you ever have eczema, urticaria, or any other form of skin allergy.’’ FEV1 and vital capacity were measured with a water-sealed spirometer (Lode Spirograph, Groningen, The Netherlands). Bronchial hyperresponsiveness to histamine was tested according to a protocol using the 30-second method described by de Vries et al.19 Histamine challenge was not performed if baseline FEV1 was less than 1.2 L. The challenge was discontinued when FEV1 decreased 20% or more compared with baseline FEV1. A subject was considered

We used standard methods to identify the SNPs in SPINK5. In brief, the Celera database (http://www.celeradiscoverysystem.com) was screened for polymorphisms in the gene and the promoter region. Five promoter SNPs and 2 missense mutations were identified. Three assays failed during the design process (21365, 21145, and 2696 SNPs), and the 22403 SNP was not further analyzed because there was no variation detected in 384 individuals. In conclusion, 3 polymorphisms of SPINK5 were genotyped in all individuals (ie, 2785 promoter SNP, Asn368Ser, and Lys420Glu). The used primers and probes are presented in Table I. Reactions were performed in 5-mL volumes and contained 25 ng of DNA, 13 TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, Calif), 100 nM of each primer, and 900 nM of each probe. Cycling conditions on the ABI prism 7900 HT (Applied Biosystems) were 2 minutes at 50°C and 10 minutes at 95°C, followed by 40 cycles

Mechanisms of asthma and allergic inflammation

Jongepier et al 487

J ALLERGY CLIN IMMUNOL VOLUME 115, NUMBER 3

488 Jongepier et al

J ALLERGY CLIN IMMUNOL MARCH 2005

TABLE I. SNPs with used primers and probes SNP

Celera ID

Primers

Probes*

2785

CV2000362

Asn368Ser

CV2000256

Lys420Glu

CV2000249

Forward: GGAAAGTTAAACTGAGTCTCCAATGTT Reverse: TTTTAAAACTTCTCAATCTGCAGGATATT Forward: TGGCCAACTTACTTCTTCTATCTCG Reverse: TTTCCGTTCCTCACAAGCTTTC Forward: CCAAGCAGAAGAAGAAGAAAAGAAA Reverse: TCACCTCAAAGGAAGCTGTACTCTT

al1: al2: al1: al2: al1: al2:

VIC-TGGCTAGGATATAAAA-MGB-NFQ FAM-TGTTTGGCTAGAATAT-MGB-NFQ VIC-TTTGCAATGAATATC-MGB-NFQ FAM-TTGCAGTGAATATC-MGB-NFQ VIC-AAGGAAGGTAAATCAA-MGB-NFQ FAM-AGGAAGGTGAATCAA-MGB-NFQ

*Bases recognizing the specific sequences are underlined in the probe sequences.

Mechanisms of asthma and allergic inflammation

TABLE II. Characteristics of probands and spouses of the families and probands of the trios Families Probands (n = 200)

Male sex, % Mean age, y (SD) PC20 ,32 mg/mL, %  Mean FEV1, % predicted FEV1,80% predicted, % Reversibility (baseline), %, >9% Reversibility (predicted), %, >9% Positive skin test response, % Eczema, % Mean eosinophils,à 107/L (range) Mean total IgE,à kU/L (range) Positive specific IgE (Phadiatop), % Positive specific IgE to Der p 1, %

Trios Spouses (n = 201)*

Probands (n = 252)

37.8 51.0 (9.2) 25.6 98.4 9.0 21.5 18.9 31.0 15.5 5.6 (0-63.8) 26.2 (0.5-1940) 15.1 3.5

37.3 34.1 (9.2) 83.7 88.6 25.4 57.9 54.8 79.4 39.5 12.4 (1-85.0) 104.5 (0-8650) 70.2 51.2

62.0 52.1 (8.5) 88.2 69.6 61.4 77.7 62.9 81.8 39.0 9.5 (0- 126.5) 92.0 (1-2880) 72.4 47.7

*One proband married twice.  Percentage of bronchial hyperresponsiveness to histamine. àGeometric mean.

TABLE III. Allele frequencies in different populations SNP*

2785 A/G Asn368Ser Lys420Glu

Dutch families Dutch trios (probands and spouses) (parents and spouses)

0.36 0.57 0.54

United Kingdom9

Japan10 (parents)

Japan11 (patients & control subjects)

Germany12

– 0.50 0.48

– 0.59 0.58

– 0.58 0.58

– – 0.48

0.38 0.56 0.54

*Frequencies of the underlined allele are presented.

of 15 seconds at 92°C and 1 minute at 60°C. End-point fluorescence was measured immediately after cycling. Alleles were assigned by using SDS 2.1 software (Applied Biosystems).

Analysis and statistics Statistical analyses were performed for the following phenotypes: asthma, bronchial hyperresponsiveness, total serum IgE, atopy, skin test positivity, specific IgE to common aeroallergens, specific IgE to Der p 1, and atopic dermatitis. In the families the SNPs were tested for allelic associations with dichotomous traits by using x2 statistics in the probands and spouses according to a case-control design. Classical trios were analyzed for transmission of SNPs by using the transmission disequilibrium test (TDT) and the family-based association test (FBAT) for the dichotomous variables under study.20 The TDT tests whether parents transmit an allele more often than 50%, which is expected under the null hypothesis of no linkage disequilibrium (LD) between the marker locus and the disease locus. The FBAT analysis compares the observed number of allele transmissions from the parents to the probands with the expected number. Total

serum IgE levels were also tested as a continuous variable by means of ANOVA, separately for the cases and control subjects from the families and for the probands of the trios. In addition, total IgE and bronchial hyperresponsiveness (PC20 to histamine) were analyzed as quantitative traits by using the quantitative TDT (Q-TDT) approach.21 We used the software package Arlequin (http://lgb. unige.ch/arlequin/software/) to test for LD among the 3 SNPs and to perform 3-SNP haplotype analyses. In addition, we used FBAT for family-based association analyses (http://www.biostat.harvard. edu).

RESULTS A total of 200 asthmatic probands and their spouses from the families and 252 probands from the trios were evaluated. Classical trios consisting of proband and both parents were analyzed (69.4% [n = 175]). The clinical characteristics of both the cases and control subjects of the

Jongepier et al 489

J ALLERGY CLIN IMMUNOL VOLUME 115, NUMBER 3

TABLE IV. Numbers and frequencies of alleles in the probands and spouses of the families Asthma

A Asn (A) Lys (A)

Control subjects

cases

Control subjects

226 (64.6%) 198 (57.6%) 161 (45.5%)

160 (62.5%) 140 (53.4%) 128 (48.5%)

284 (64.3%) 256 (58.4%) 198 (44.2%)

160 (62.5%) 140 (53.4%) 128 (48.5%)

Cases

Control subjects

Cases

Control subjects

148 (63.8%) 136 (58.6%) 100 (42.7%)

299 (63.6%) 263 (55.7%) 227 (47.1%)

129 (67.9%) 108 (60.0%) 79 (42.0%)

319 (62.1%) 292 (55.5%) 249 (47.0%)

IgE (100)

2785 Asn368Ser Lys420Glu

A Asn (A) Lys (A)

Phadiatop

Der p 1(y/n)

2785 Asn368Ser Lys420Glu

A Asn (A) Lys (A)

Eczema (y/n)

Cases

Control subjects

Cases

Control subjects

129 (67.9%) 108 (60.0%) 79 (42.0%)

63 (56.3%)* 56 (50.0%) 61 (53.5%)

119 (61.3%) 112 (58.9%) 86 (44.3%)

245 (62.8%) 214 (54.3%) 190 (47.5%)

Skin test positivity (y/n)

2785 Asn368Ser Lys420Glu

A Asn (A) Lys (A)

Cases

Control subjects

259 (64.8%) 220 (56.4%) 183 (45.5%)

186 (62.4%) 177 (57.1%) 142 (45.8%)

For all other phenotypes, the results of the 3 SNPs were nonsignificant. BHR, Bronchial hyperresponsiveness. *P = .04.

families and the trios are outlined in Table II. The Frisian asthmatic patients were younger than the probands from the families. In addition, FEV1 was higher in the Frisian patients. Allele frequencies of the SNPs (ie, 2785 A/G, Asn368Ser, and Lys420Glu) in our 2 populations are presented in Table III, together with the allele frequencies for Asn368Ser and Lys420Glu from the studies of Walley et al,9 Nishio et al,10 and Kato et al11 for comparison. All SNPs were in Hardy-Weinberg equilibrium in families and trios, and the 3 SNPs were in strong LD with each other (P , .00001). Tables IV, V, and VI show that none of the tested phenotypes were significantly associated with Asn368Ser or Lys420Glu SNPs, neither in families nor in trios. In addition, no significant associations between either SNP and total serum IgE levels and PC20 were identified by using the Q-TDT, and no parent-of-origin effects were observed in the trios (data not shown). Only one significant association was found between the A allele of the 2785 SNP and specific IgE to Der p 1 (P = .04). When applying the criteria of atopy used by Walley et al9 (ie, IgE affected >87.3 kU/L and skin test for grasses or house dust mite resulting in >3-mm wheal), again no significant association was found. Additional haplotype and FBAT analyses (252 trios) did not show any significant result for any of the phenotypes in either group (results not shown).

DISCUSSION This study suggests that the polymorphisms of the SPINK5 gene we genotyped do not contribute to susceptibility to asthma and atopic phenotypes in the Dutch population. In 2 independent populations, both ascertained by a proband with asthma, we found one significant association between the A allele of the 2785 SNP and specific IgE to Der p 1 (P = .04). However, because 3 SNPs and 7 phenotypes had been analyzed, we performed a multiple testing correction. Correcting for 21 tests would, however, be too strict because of LD between the loci and correlation between the traits. Nevertheless, a correction for only 2 tests would already imply a nonsignificant result for skin test positivity, implying that it is most likely a false-positive result. We could not reproduce the findings on atopic dermatitis or asthma reported by Walley et al,9 Nishio et al,10 Kato et al,11 and Kabesch et al12 that were performed in populations from the United Kingdom, Japan, and Germany. Association studies have been used widely because they are easier to perform, but often replication of positive results has been shown to be difficult for a number of reasons. For the most part, discrepancies in results can be caused by 5 reasons: (1) a difference in study design exists (ie, variations in the phenotype in relation to the environment, ascertainment, and choice of control subjects used); (2) the observed differences are real and result from

Mechanisms of asthma and allergic inflammation

2785 Asn368Ser Lys420Glu

BHR

Cases

490 Jongepier et al

J ALLERGY CLIN IMMUNOL MARCH 2005

TABLE V. Number of transmissions and nontransmissions in the classical trios Asthma

2785 Asn368Ser Lys420Glu

A Asn (A) Lys (A)

BHR

IgE (100)

N-T

T

N-T

T

N-T

T

N-T

51 60 69

60 64 68

53 64 75

65 68 71

34 37 40

42 45 48

17 24 31

24 25 26

Der p 1(y/n)

Mechanisms of asthma and allergic inflammation

2785 Asn368Ser Lys420Glu

Phadiatop

T

A Asn (A) Lys (A)

Skin test positivity (y/n)

Eczema(y/n)

T

N-T

T

N-T

T

N-T

25 31 37

36 37 38

26 27 28

29 31 33

42 53 64

57 61 65

For all phenotypes, the results of all 3 SNPs were nonsignificant.

TABLE VI. Log IgE (age corrected) in families and trios (ANOVA) Families

Trios

No.

Mean IgE

SD

No.

Mean IgE

SD

2785

AA AG GG

143 162 47

1.81 1.78 1.80

0.67 0.75 0.77

83 103 41

1.97 2.03 1.94

0.72 0.76 0.65

Asn368Ser

AA AG GG

108 184 61

1.78 1.80 1.76

0.72 0.72 0.76

65 105 50

1.97 2.00 2.04

0.77 0.70 0.76

Lys420Glu

AA AG GG

73 182 104

1.77 1.80 1.80

0.75 0.71 0.73

53 105 66

2.00 1.97 1.97

0.70 0.69 0.77

Results were nonsignificant for all 3 SNPs in both populations.

genetic heterogeneity or population differences; (3) results can be false-positive because of, for example, publication bias; (4) results can be spurious or replication can be absent because of lack of power in one of the studies; or (5) lack of Hardy-Weinberg equilibrium in cases and control subjects exists,22 in which the absence of Hardy-Weinberg equilibrium in control subjects is a strong indication for genotyping errors.

Study design In our family study adult patients with asthma were enrolled and extensively characterized. Furthermore, the asthmatic subjects from the case-control population were older, with lifelong asthma initially diagnosed in the 1960s and early 1970s. This is an important difference with respect to the characteristics of the patients in the study of Walley et al9 and Kabesch et al.12 The patients in the study of Walley et al9 were children and attended a dermatology clinic, and a diagnosis of atopic dermatitis in the families was based on questionnaires. The study by Kabesch et al12 investigated an unselected general population sample of German children. In both studies an asthma diagnosis

was not based on objective measurements but rather on positive answers to the question ‘‘Has your child ever had an attack of asthma?’’ or parental questionnaire data on a doctor’s diagnosis of asthma, recurrent spastic bronchitis, or recurrent asthmatic bronchitis. It is well established that this might overestimate the presence of asthma because the majority of infants with wheezing do not have an increased risk of asthma later in life.23 Thus the association might be spurious. The same drawback applies to the questionnaire-based definition of atopic dermatitis in our study, hence our cautious note that atopic dermatitis can be associated with SPINK5. A further difference between this study and the previously mentioned studies is that Walley et al9 and Kabesch et al12 investigated children, in contrast to our adult population, who were retrospectively asked about the presence of eczema. This might further explain why our study did not show any association with atopic dermatitis because this could resolve with age; that is, about 39% of our cases reported eczema, whereas 70% of the children in the report of Walley et al9 had eczema. With regard to the control population in our study, these individuals were age matched and characterized in the same manner as the

Jongepier et al 491

J ALLERGY CLIN IMMUNOL VOLUME 115, NUMBER 3

Genetic heterogeneity or lack of power Because asthma is a complex genetic disease, genetic heterogeneity can always account for differences in results between populations, especially for effects of rare alleles. Theoretically, a different set of genes might result in identical phenotypes in the different populations (ie, Japanese and Dutch, German or white subjects from the United Kingdom), and this cannot be excluded. Our casecontrol study had 80% power to detect relative risks of 2.0 to 2.4 (depending on the assumed disease model) at a significance level of .05. Considering the high allele frequencies, this would imply an increase of approximately 10% in the allele frequency among cases compared with control subjects. Therefore this study excludes major effects of SPINK5 on adults with asthma. SPINK5 function Recent studies suggest that it is indeed plausible that we did not find an association between asthma and SPINK5. The SPINK5 gene is involved in the Netherton syndrome, a rare autosomal recessive disorder syndrome with ichthyosis, hair shaft defects, and atopy with increased IgE levels. A pathognomic feature of Netherton disease is the lack of expression of SPINK5 in keratinocytes. Functional studies have partly unraveled functions and substrates of a number of the 15 domains of SPINK5. SPINK5 was shown to inhibit the serine proteinases plasmin, subtilisin A, cathepsin G, human neutrophil elastase, and trypsin, but not chymotrypsin, and is thus a major physiologic inhibitor of multiple serine proteinases.7 The main function of layered epithelia, especially the skin, is the barrier to environmental influences. Serine protease inhibitors limit the unwanted proteolytic properties of proteases. In the epidermis the expression of SPINK5 is mainly restricted to the stratum granulosum, suggesting a role for SPINK5 in the process of epithelial differentiation leading to cornification. SPINK5 might play a role in the process of protein expression that forms the cornified cell envelope in the stratum corneum that, together with the lipid lamellae, prevents influx of pathogens.24 Interestingly, SPINK5 expression was present in keratinocytes of normal skin and the skin of patients with atopic dermatitis, yet no expression was seen in the lung tissue of healthy individuals.8 These findings suggest that SPINK5 might be involved in atopic dermatitis but that involvement in asthma is more doubtful. Moreover, if polymorphisms in SPINK5 result in asthma, individuals with the Netherton syndrome should experience more frequent asthma. This is not the case because only 4 (17.4%) of 23 individuals have been reported to have Netherton syndrome and asthma,25 which is only slightly

higher than the population prevalence, which ranges from 2.0% to 11.9% (median, 4.5%).26

Conclusion On the basis our own observation that there is no association between 2785, Asn368Ser, and Lys420Glu polymorphisms of the SPINK5 gene and asthma phenotypes in 2 independent populations and on the basis of the observation that SPINK5 is not expressed in lung tissue, we propose that it is unlikely that polymorphisms in the SPINK5 gene contribute to asthma. However, SPINK5 might be associated with atopic dermatitis because Netherton disease is associated with atopic dermatitis, and it is expressed in keratinocytes. We thank all participants of the studies. We also thank D. Faber, H. Koops, M. Leever, E. Gankema, and T. van Hoogdalem who assisted in the clinical testing. In addition, we would like to thank the Frisian pulmonologists: J. Nabers, H. Pasma, T. H. E. P. Franssen, P. Eppinga, J. H. Strijbos, W. Evers, and S. Sanwikarja for their help in patient recruitment.

REFERENCES 1. Kabesch M, Tzotcheva I, Carr D, Hofler C, Weiland SK, Fritzsch C, et al. A complete screening of the IL4 gene: novel polymorphisms and their association with asthma and IgE in childhood. J Allergy Clin Immunol 2003;112:893-8. 2. Howard TD, Whittaker PA, Zaiman AL, Koppelman GH, Xu J, Hanley MT, et al. Identification and association of polymorphisms in the interleukin-13 gene with asthma and atopy in a Dutch population. Am J Respir Cell Mol Biol 2001;25:377-84. 3. Reihsaus E, Innis M, MacIntyre N, Liggett SB. Mutations in the gene encoding for the beta-2-adrenergic receptor in normal and asthmatic subjects. Am J Respir Cell Mol Biol 1993;8:334-9. 4. Koppelman GH, Reijmerink NE, Colin SO, Howard TD, Whittaker PA, Meyers DA, et al. Association of a promoter polymorphism of the CD14 gene and atopy. Am J Respir Crit Care Med 2001;163:965-9. 5. Chavanas S, Garner C, Bodemer C, Ali M, Teillac DH, Wilkinson J, et al. Localization of the Netherton syndrome gene to chromosome 5q32, by linkage analysis and homozygosity mapping. Am J Hum Genet 2000; 66:914-21. 6. Chavanas S, Bodemer C, Rochat A, Hamel-Teillac D, Ali M, Irvine AD, et al. Mutations in SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nat Genet 2000;25:141-2. 7. Mitsudo K, Jayakumar A, Henderson Y, Frederick MJ, Kang Y, Wang M, et al. Inhibition of serine proteinases plasmin, trypsin, subtilisin A, cathepsin G, and elastase by LEKTI: a kinetic analysis. Biochemistry 2003;42:3874-81. 8. Bitoun E, Micheloni A, Lamant L, Bonnart C, Tartaglia-Polcini A, Cobbold C, et al. LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome. Hum Mol Genet 2003;12:2417-30. 9. Walley AJ, Chavanas S, Moffatt MF, Esnouf RM, Ubhi B, Lawrence R, et al. Gene polymorphism in Netherton and common atopic disease. Nat Genet 2001;29:175-8. 10. Nishio Y, Noguchi E, Shibasaki M, Kamioka M, Ichikawa E, Ichikawa K, et al. Association between polymorphisms in the SPINK5 gene and atopic dermatitis in the Japanese. Genes Immun 2003;4:515-7. 11. Kato A, Fukai K, Oiso N, Hosomi N, Murakami T, Ishii M. Association of SPINK5 gene polymorphisms with atopic dermatitis in the Japanese population. Br J Dermatol 2003;148:665-9. 12. Kabesch M, Carr D, Weiland SK, von Mutius E. Association between polymorphisms in serine protease inhibitor, kazal type 5 and asthma phenotypes in a large German population sample. Clin Exp Allergy 2004;34:340-5.

Mechanisms of asthma and allergic inflammation

asthmatic probands. All individuals were from the northern rural part of the Netherlands, and the Frisian asthmatic patients and their relatives were from a restricted area in the northern part of the Netherlands as well. This suggests similar demographics and environment, hence making them ideal control subjects.

492 Jongepier et al

Mechanisms of asthma and allergic inflammation

13. Amelung PJ, Postma D, Panhuysen CI, Meyers DA, Bleecker ER. Susceptibility loci regulating total serum IgE levels, bronchial hyperresponsiveness, and clinical asthma map to chromosome 5q. Chest 1997; 111(suppl 6):77S-8S. 14. Koppelman GH, Stine OC, Xu J, Howard TD, Zheng SL, Kauffman HF, et al. Genome-wide search for atopy susceptibility genes in Dutch families with asthma. J Allergy Clin Immunol 2002;109:498-506. 15. Xu J, Postma DS, Howard TD, Koppelman GH, Zheng SL, Stine OC, et al. Major genes regulating total serum immunoglobulin E levels in families with asthma. Am J Hum Genet 2000;67:1163-73. 16. Panhuysen CIM, Bleecker ER, Koe¨ter GH, Meyers DA, Postma DS. Characterization of obstructive airways disease in family members of probands with asthma; an algorithm for the diagnosis of asthma. Am J Respir Crit Care Med 1998;157:1734-42. 17. Howard TD, Koppelman GH, Xu J, Zheng SL, Postma DS, Meyers DA, et al. Gene-gene interaction in asthma: IL4RA and IL13 in a Dutch population with asthma. Am J Hum Genet 2002;70:230-6. 18. Panhuysen CI, Bleecker ER, Koe¨ter GH, Meyers DA, Postma DS. Dutch approach to the study of the genetics of asthma. Clin Exp Allergy 1995; 25(suppl 2):35-8. 19. de Vries K, Goei JT, Booy-Noord H, Orie NGM. Changes during 24 hours in the lung function and histamine hyperreactivity of the bronchial

J ALLERGY CLIN IMMUNOL MARCH 2005

20.

21.

22.

23.

24. 25.

26.

tree in asthmatic and bronchitic patients. Int Arch Allergy 1962;20: 93-101. Spielman RS, Ewens WJ. The TDT and other family-based tests for linkage disequilibrium and association. Am J Hum Genet 1996;59: 983-9. Abecasis GR, Cardon LR, Cookson WO. A general test of association for quantitative traits in nuclear families. Am J Hum Genet 2000;66: 279-92. Xu J, Turner A, Little J, Bleecker ER, Meyers DA. Positive results in association studies are associated with departure from Hardy-Weinberg equilibrium: hint for genotyping error? Hum Genet 2002;111:573-4. Martinez FD, Wright AL, Taussig LM, Holberg CJ, Halonen M, Morgan WJ. Asthma and wheezing in the first six years of life. The Group Health Medical Associates. N Engl J Med 1995;332:133-8. Morita K, Miyachi Y. Tight junctions in the skin. J Dermatol Sci 2003; 31:81-9. Bitoun E, Chavanas S, Irvine AD, Lonie L, Bodemer C, Paradisi M, et al. Netherton syndrome: disease expression and spectrum of SPINK5 mutations in 21 families. J Invest Dermatol 2002;118:352-61. Janson C, Chinn S, Jarvis D, Burney P. Physician-diagnosed asthma and drug utilization in the European Community Respiratory Health Survey. Eur Respir J 1997;10:1795-802.