- Email: [email protected]
Polynucleotide phosphorylase (PNPase) is required for Salmonella enterica serovar Typhimurium colonization in swine
Microbial Pathogenesis 65 (2013) 63e66
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Short communication
Polynucleotide phosphorylase (PNPase) is required for Salmonella enterica serovar Typhimurium colonization in swine S.M.D. Bearson a, *, B.L. Bearson b, I.S. Lee c, J.D. Kich d a
USDA/ARS/National Animal Disease Center, Ames, IA, USA USDA/ARS/National Laboratory for Agriculture and the Environment, Ames, IA, USA c Hannam University, Daejeon, South Korea d Embrapa Swine and Poultry, Concórdia, SC, Brazil b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 August 2012 Received in revised form 24 September 2013 Accepted 3 October 2013 Available online 11 October 2013
The pnp gene encodes polynucleotide phosphorylase, an exoribonuclease involved in RNA processing and degradation. A mutation in the pnp gene was previously identified by our group in a signature-tagged mutagenesis screen designed to search for Salmonella enterica serovar Typhimurium genes required for survival in an ex vivo swine stomach content assay. In the current study, attenuation and colonization potential of a S. Typhimurium pnp mutant in the porcine host was evaluated. Following intranasal inoculation with 109 cfu of either the wild-type S. Typhimurium c4232 strain or an isogenic derivative lacking the pnp gene (n ¼ 5/group), a significant increase (p < 0.05) in rectal temperature (fever) was observed in the pigs inoculated with wild-type S. Typhimurium compared to the pigs inoculated with the pnp mutant. Fecal shedding of the pnp mutant was significantly reduced during the 7-day study compared to the wild-type strain (p < 0.001). Tissue colonization was also significantly reduced in the pigs inoculated with the pnp mutant compared to the parental strain, including the tonsils, ileocecal lymph nodes, Peyer’s Patch region of the ileum, cecum and contents of the cecum (p < 0.05). The data indicate that the pnp gene is required for S. Typhimurium virulence and gastrointestinal colonization of the natural swine host. Published by Elsevier Ltd.
Keywords: Polynucleotide phosphorylase PNPase Salmonella Virulence Swine Colonization
1. Introduction In bacteria, polynucleotide phosphorylase (PNPase) is an exoribonuclease involved in mRNA degradation, tRNA processing and small RNA (sRNA) turnover, with homologues described in eukaryotes [1e4]. A multifunctional protein, PNPase is responsible for 30 / 50 processive phosphorolytic degradation and polyadenylation of RNA and is associated with the RNA degradosome, a multiprotein complex consisting of RNase E, enolase and RNA helicase RhlB [5e8]. PNPase has been shown to be involved in the environmental cold shock response of Escherichia coli [9,10], protection against H2O2 and UV induced damage in E. coli and Bacillus subtilis [11e13], and regulation of virulence gene expression of Salmonella enterica [14]. A point mutation in the pnp gene resulting in a truncated PNPase allowed S. enterica serovar Typhimurium (S. Typhimurium) to establish a persistent infection in BALB/c mice, presumably due to the observed increased expression of invasion-associated genes of
Salmonella Pathogenicity Island 1 and 2 [15]. Altered stability of a regulatory small RNA (sRNA) or the mRNA of a regulatory protein, such as SpvR, could account for the elevated expression of the Salmonella virulence genes in the presence of the mutated PNPase. The ability of S. Typhimurium with a truncated PNPase to establish a chronic carrier state in mice and our prior identification of a pnp mutant with reduced survival following exposure to the swine stomach environment [16] prompted our further investigation of the role of the pnp gene product in S. Typhimurium pathogenesis and colonization in pigs. In the current study, deletion of the pnp gene from S. Typhimurium resulted in decreased 1) fecal shedding of Salmonella in pigs, 2) clinical signs of disease and 3) swine gastrointestinal colonization.
2. Materials and methods 2.1. Construction and characterization of a S. Typhimurium pnp mutant by recombineering
* Corresponding author. 1920 Dayton Ave, Room 1403, Ames, IA 50010, USA. Tel.: þ1 515 337 7455; fax: þ1 515 337 6190. E-mail address: [email protected] (S.M.D. Bearson). 0882-4010/$ e see front matter Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.micpath.2013.10.001
PCR primers oSBI 220 (50 gtattatgccgtcaaaaattggaaaggat attattttgcttaatccgatagctgaatgagtgacgtgc 30 ) and oSBI 221 (50 ct
64
S.M.D. Bearson et al. / Microbial Pathogenesis 65 (2013) 63e66
tctttaatgctcagacgtacacggccctggcggtcaacttccagcatagagcagtgacgta gtcgc 30 ) were constructed for the PCR amplification of a linear DNA fragment to knockout the S. Typhimurium pnp gene by recombineering [17]. The 50 end of the primers contain 47 and 46 bp of nucleotide sequence (bold) that is identical to either the upstream or downstream region of the pnp gene, respectively. On the 30 end of the primers (underlined) is a universal sequence containing stop codons in all three reading frames for amplification of the neo gene and was previously described [18,19]. Following arabinoseinduction and electroporation of oSBI 220/221-neo into SX49 [20], kanamycin resistant transformants were selected on LuriaeBertani (LB) agar medium containing 50 mg kanamycin ml1. The knockout mutation was subsequently moved to virulent S. Typhimurium c4232 [21] by P22 transduction. A pnp::Km colony was screened by PCR to confirm the pnp knockout mutation, and the strain was designated SB 304. To confirm that insertion of the neo gene into the pnp gene by recombineering did not affect the downstream nlpI gene, two experiments were performed: transcriptional analysis of the nlpI gene to demonstrate nlpI expression in the pnp mutant, and a phenotypic analysis for biofilm formation, illustrating the loss of the red, dry and rough (rdar) colony morphology that is complemented by a plasmid expressing the pnp gene from an arabinose-inducible promoter. First, real-time RT-PCR was performed as described previously [20] using S. Typhimurium c4232 and SB 304 grown in LB medium at 37 C to O.D.600 ¼ 0.5 and processed in RNAprotect bacteria reagent (Qiagen). Using expression of the gyrB gene as the internal control [20], transcripts were amplified in duplicate from four experiments: 95 C for 10 min, 39 cycles at 94 C for 60 s, 58 C for 60 s, 72 C for 30 s. In wild-type S. Typhimurium c4232, amplification was identical for the pnp (sequence of primers oSBI 506 and oSBI 507: 50 CGGATAAACGTGTAGAGAAAG 30 and 50 GCAGCCGCAGGTTGAGACT 30 , respectively) and nlpI (sequence of primers oSBI 508 and oSBI 509: 50 TGGCGCGTATGGAACAGAT 30 and 50 CGCGCTAATGCCCTCAAACC 30 , respectively) genes. As expected, no pnp amplification product was observed in the pnp::Km mutant SB 304. Similar to Rouf et al. [22] whereby expression of nlpI was initiated from the tetracycline resistance gene promoter inserted in the pnp* mutant, we observed transcriptional amplification of the nlpI gene in SB 304, presumably due to expression from the neo gene promoter of the pnp::Km mutant (data no shown); a slight but insignificant increase was observed in nlpI transcription (<2-fold) compared to the wild-type strain. Thus, nlpI is expressed in SB 304. In a phenotypic assay for biofilm formation on solid medium [23], the pnp mutant SB 304 on Congo red LB agar plates (40 mg/ml Congo Red, 20 mg/ml Coomassie brilliant blue) without salt at room temperature for 48 h revealed a delay in the production of the rdar colony phenotype compared to the wild-type strain, as similarly observed by Rouf et al. [23]. Complementation with a cloned pnp gene (PCR primers oSBI 505 and oSBI 513: 50 GCAAAAGGCTACCTT ACTCG 30 and 50 TAGGAAAGGATATTATTTTGCTTAATC 30 , respectively) in the pBAD TOPOÒ TA expression vector (Invitrogen) restored the rdar colony morphology in the pnp mutant when Larabinose (0.1%) was included in the medium (data not shown). Thus, mutation of the pnp gene in SB 304 is responsible for the phenotype loss. 2.2. Swine study Ten male and female crossbred piglets from a conventional Midwestern farm were weaned and shipped to the National Animal Disease Center, Ames, IA at 12 days of age. Pigs were divided into two groups of five, separately housed in isolation facilities, and confirmed three times over a six week period to be fecal-negative for Salmonella spp. using bacteriological culture techniques [24].
At 8 weeks of age (day zero), the ten pigs were intranasally inoculated with 1 ml PBS containing either 1.0 109 colony forming units (cfu) of c4232 (wild-type; n ¼ 5) or SB 304 (pnp::Km; n ¼ 5). Body temperatures (assessed using a rectal thermometer) were taken at 0, 1, 2, 3, 5, 7 days post-inoculation (d.p.i.). Statistical analysis of daily body temperatures for each treatment group was performed in GraphPad Prism 5 using repeated measures two-way ANOVA (analysis of variance) with Bonferroni post-tests to compare data for individual days. Pig fecal samples were obtained on 0, 1, 2, 3, 5 and 7 d.p.i. and pig tissue samples were obtained at 7 d.p.i. for quantitative and qualitative Salmonella culture analyses (described in detail in Ref. [24]). Statistical analysis of the number of Salmonella present (cfu/g) in the daily fecal samples was performed in GraphPad Prism 5 using repeated measures two-way ANOVA (analysis of variance) with Bonferroni post-tests to compare data for individual days following Log10 transformation of the data. Statistical analysis of the number of Salmonella present (cfu/g) in the tissues at 7 dpi (necropsy) was analyzed in GraphPad Prism 5 using the paired t-test following Log10 transformation of the data. Procedures involving animals followed humane protocols as approved by the USDA, ARS, NADC Animal Care and Use Committee. 3. Results and discussion A signature-tagged mutagenesis screen previously performed by our group identified genes of S. enterica serovar Typhimurium that are important for survival in an ex vivo swine stomach content assay [16]. A transposon insertion in the pnp gene of S. Typhimurium resulted in a 1000-fold reduction in survival following exposure to the swine stomach content compared to the parental wildtype strain. Since the pnp gene encodes polynucleotide phosphorylase (PNPase), an exoribonuclease implicated in S. enterica virulence gene expression [14,15], the current study compared wildtype S. Typhimurium c4232 to an isogenic pnp mutant for survival and colonization potential in the natural porcine host. Over a 7-day study, rectal temperatures (fever) assessed clinical signs of infection, while quantitative and qualitative bacteriological evaluation of fecal and tissue samples measured the level of Salmonella shedding and tissue colonization in the inoculated pigs. A significantly higher rectal temperature was observed at 2 (p < 0.01) and 3 (p < 0.05) d.p.i. for the pigs inoculated with wild-type S. Typhimurium compared to the pigs inoculated with the pnp mutant (Fig. 1A). Fecal shedding of the pnp mutant was significantly reduced throughout the 7-day study compared to the wild-type strain at each day tested (Fig. 1B; p < 0.001). Tissue colonization assessed at 7 d.p.i. was also dramatically reduced in the pigs inoculated with the pnp mutant compared to the parental strain, including the tonsils (p < 0.05), ileocecal lymph nodes (p < 0.01), Peyer’s Patch region of the ileum (p < 0.05), cecum (p < 0.001) and contents of the cecum (p < 0.001) (Fig. 1C). The results indicate that the loss of PNPase in S. Typhimurium resulted in decreased colonization fitness in the natural swine host. As a major regulator in the decay of small noncoding RNAs (sRNAs) involved in posttranscriptional regulation of gene expression, PNPase influences sRNA gene regulatory functions such as the production of outer membrane proteins (OMP) and adaptation to rapid environmental changes [25e27]. Alterations in the OMP composition may influence cellular permeability, a likely explanation for the increased susceptibility to antibiotics of an E. coli pnp mutant [28] and the increased sensitivity of a S. Typhimurium pnp mutant to the contents of the swine stomach and lactic acid observed by our group [16]. Ygberg et al. [15] showed that PNPase suppresses spv gene expression (Salmonella plasmid virulence) under inducing conditions, suggesting that PNPase provides a fine-tuning mechanism for optimal virulence gene expression during infection. Other
S.M.D. Bearson et al. / Microbial Pathogenesis 65 (2013) 63e66
Rectal Temperature ( °C)
40.5
†
65
not imply recommendations or endorsement by the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer.
‡
40
Acknowledgments
39.5 Wild-type
39
pnp
38.5
We thank Stephanie Jones, Kellie Winter, Jennifer Jones and Ann Hoffman for technical assistance and Brian Brunelle and Steven Trabue for critical evaluation of the manuscript. This project was supported by USDA, ARS CRIS funds.
38 0
1
2 3 5 Days Post-inoculation
References
7
7
*
CFU/g Feces (Log10)
6
*
*
*
5
*
4 Wild-type
3
pnp
2 1 0 0
CFU/g Tissue (Log10)
6
1
‡
2 3 5 Days Post-inoculation
*
‡
5 †
4
7
*
3 Wild-type pnp
2 1 0 Tonsil
Peyer's Patch (ileum)
ICLN
Cecal Cecum Contents
Fig. 1. A S. Typhimurium pnp mutant in swine has decreased gastrointestinal colonization, fecal shedding and clinical signs of infection. Eight-week old pigs were intranasally inoculated with 1.0 109 cfu of either wild-type S. Typhimurium (c4232; n ¼ 5) or the pnp mutant (SB 304; n ¼ 5) and monitored for 7 dpi: A) Body temperature. Note that the normal body temperature of a pig is 38.5e39 C. B) Colony forming units of Salmonella per gram of feces (cfu/g). C) Quantitative and qualitative bacterial culturing for Salmonella (cfu/g) at 7 dpi in the following tissues: Tonsil, Peyer’s Patch region of the ileum, ileocecal lymph nodes (ICLN), cecum and contents of the cecum. Symbols denote significance between wild-type S. Typhimurium and the pnp mutant at the specific time point: z is p < 0.05; y is p < 0.01; * is p < 0.001.
investigations have also demonstrated a virulence function for PNPase, including Yersinia [29], Streptococcus pyogenes [30], and the phytopathogenic bacterium Dicheya dadantii [31]. Thus, via RNA metabolism, PNPase plays an important role in regulating the expression of environmentally-induced genes, thereby promoting the adaptation of the microorganisms, including Salmonella, to their diverse and fluctuating surroundings. Disclosure statements Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does
[1] Das SK, Bhutia SK, Sokhi UK, Dash R, Azab B, Sarkar D, et al. Human polynucleotide phosphorylase (hPNPase(old-35)): an evolutionary conserved gene with an expanding repertoire of RNA degradation functions. Oncogene 2011;30:1733e43. [2] Rosenzweig JA, Schesser K. Polynucleotide phosphorylase and the T3SS. Adv Exp Med Biol 2007;603:217e24. [3] Lin-Chao S, Chiou NT, Schuster G. The PNPase, exosome and RNA helicases as the building components of evolutionarily-conserved RNA degradation machines. J Biomed Sci 2007;14:523e32. [4] Carpousis AJ. The RNA degradosome of Escherichia coli: an mRNA-degrading machine assembled on RNase E. Annu Rev Microbiol 2007;61:71e87. [5] Grunberg-Manago M. Messenger RNA stability and its role in control of gene expression in bacteria and phages. Annu Rev Genet 1999;33:193e227. [6] Mohanty BK, Kushner SR. Polynucleotide phosphorylase, RNase II and RNase E play different roles in the in vivo modulation of polyadenylation in Escherichia coli. Mol Microbiol 2000;36:982e94. [7] Py B, Causton H, Mudd EA, Higgins CF. A protein complex mediating mRNA degradation in Escherichia coli. Mol Microbiol 1994;14:717e29. [8] Chen X, Taylor DW, Fowler CC, Galan JE, Wang HW, Wolin SL. An RNA degradation machine sculpted by Ro autoantigen and noncoding RNA. Cell 2013;153:166e77. [9] Yamanaka K, Inouye M. Selective mRNA degradation by polynucleotide phosphorylase in cold shock adaptation in Escherichia coli. J Bacteriol 2001;183:2808e16. [10] Phadtare S. Escherichia coli cold-shock gene profiles in response to overexpression/deletion of CsdA, RNase R and PNPase and relevance to lowtemperature RNA metabolism. Genes Cells 2012;17:850e74. [11] Rath D, Mangoli SH, Pagedar AR, Jawali N. Involvement of pnp in survival of UV radiation in Escherichia coli K-12. Microbiology 2012;158:1196e205. [12] Cardenas PP, Carrasco B, Sanchez H, Deikus G, Bechhofer DH, Alonso JC. Bacillus subtilis polynucleotide phosphorylase 30 -to-50 DNase activity is involved in DNA repair. Nucleic Acids Res 2009;37:4157e69. [13] Wu J, Jiang Z, Liu M, Gong X, Wu S, Burns CM, et al. Polynucleotide phosphorylase protects Escherichia coli against oxidative stress. Biochemistry 2009;48:2012e20. [14] Clements MO, Eriksson S, Thompson A, Lucchini S, Hinton JC, Normark S, et al. Polynucleotide phosphorylase is a global regulator of virulence and persistency in Salmonella enterica. Proc Natl Acad Sci U S A 2002;99: 8784e9. [15] Ygberg SE, Clements MO, Rytkonen A, Thompson A, Holden DW, Hinton JC, et al. Polynucleotide phosphorylase negatively controls spv virulence gene expression in Salmonella enterica. Infect Immun 2006;74:1243e54. [16] Bearson SM, Bearson BL, Rasmussen MA. Identification of Salmonella enterica serovar Typhimurium genes important for survival in the swine gastric environment. Appl Environ Microbiol 2006;72:2829e36. [17] Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 2000;97: 6640e5. [18] Bearson BL, Bearson SM. The role of the QseC quorum-sensing sensor kinase in colonization and norepinephrine-enhanced motility of Salmonella enterica serovar Typhimurium. Microb Pathog 2008;44:271e8. [19] Bearson BL, Bearson SMD, Uthe JJ, Dowd SE, Houghton JO, Lee IS, et al. Iron regulated genes of Salmonella enterica serovar Typhimurium in response to norepinephrine and the requirement of fepDGC for norepinephrine-enhanced growth. Microbes Infect 2008;10:807e16. [20] Bearson SM, Bearson BL, Brunelle BW, Sharma VK, Lee IS. A mutation in the poxA gene of Salmonella enterica serovar Typhimurium alters protein production, elevates susceptibility to environmental challenges, and decreases swine colonization. Foodborne Pathog Dis 2011;8:725e32. [21] Fedorka-Cray PJ, Kelley LC, Stabel TJ, Gray JT, Laufer JA. Alternate routes of invasion may affect pathogenesis of Salmonella typhimurium in swine. Infect Immun 1995;63:2658e64. [22] Rouf SF, Anwar N, Clements MO, Rhen M. Genetic analysis of the pnp-deaD genetic region reveals membrane lipoprotein NlpI as an independent participant in cold acclimatization of Salmonella enterica serovar Typhimurium. FEMS Microbiol Lett 2011;325:56e63. [23] Rouf SF, Ahmad I, Anwar N, Vodnala SK, Kader A, Romling U, et al. Opposing contributions of polynucleotide phosphorylase and the membrane protein
66
[24]
[25]
[26]
[27]
S.M.D. Bearson et al. / Microbial Pathogenesis 65 (2013) 63e66 NlpI to biofilm formation by Salmonella enterica serovar Typhimurium. J Bacteriol 2011;193:580e2. Bearson BL, Bearson SM, Lee IS, Brunelle BW. The Salmonella enterica serovar Typhimurium QseB response regulator negatively regulates bacterial motility and swine colonization in the absence of the QseC sensor kinase. Microb Pathog 2010;48:214e9. Viegas SC, Pfeiffer V, Sittka A, Silva IJ, Vogel J, Arraiano CM. Characterization of the role of ribonucleases in Salmonella small RNA decay. Nucleic Acids Res 2007;35:7651e64. Andrade JM, Arraiano CM. PNPase is a key player in the regulation of small RNAs that control the expression of outer membrane proteins. RNA 2008;14: 543e51. De Lay N, Gottesman S. Role of polynucleotide phosphorylase in sRNA function in Escherichia coli. RNA 2011;17:1172e89.
[28] McMurry LM, Levy SB. Tn5 insertion in the polynucleotide phosphorylase (pnp) gene in Escherichia coli increases susceptibility to antibiotics. J Bacteriol 1987;169:1321e4. [29] Rosenzweig JA, Chromy B, Echeverry A, Yang J, Adkins B, Plano GV, et al. Polynucleotide phosphorylase independently controls virulence factor expression levels and export in Yersinia spp. FEMS Microbiol Lett 2007;270: 255e64. [30] Barnett TC, Bugrysheva JV, Scott JR. Role of mRNA stability in growth phase regulation of gene expression in the group A streptococcus. J Bacteriol 2007;189:1866e73. [31] Zeng Q, Ibekwe AM, Biddle E, Yang CH. Regulatory mechanisms of exoribonuclease PNPase and regulatory small RNA on T3SS of Dickeya dadantii. Mol Plant Microbe Interact 2010;23:1345e55.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Short communication
Polynucleotide phosphorylase (PNPase) is required for Salmonella enterica serovar Typhimurium colonization in swine S.M.D. Bearson a, *, B.L. Bearson b, I.S. Lee c, J.D. Kich d a
USDA/ARS/National Animal Disease Center, Ames, IA, USA USDA/ARS/National Laboratory for Agriculture and the Environment, Ames, IA, USA c Hannam University, Daejeon, South Korea d Embrapa Swine and Poultry, Concórdia, SC, Brazil b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 August 2012 Received in revised form 24 September 2013 Accepted 3 October 2013 Available online 11 October 2013
The pnp gene encodes polynucleotide phosphorylase, an exoribonuclease involved in RNA processing and degradation. A mutation in the pnp gene was previously identified by our group in a signature-tagged mutagenesis screen designed to search for Salmonella enterica serovar Typhimurium genes required for survival in an ex vivo swine stomach content assay. In the current study, attenuation and colonization potential of a S. Typhimurium pnp mutant in the porcine host was evaluated. Following intranasal inoculation with 109 cfu of either the wild-type S. Typhimurium c4232 strain or an isogenic derivative lacking the pnp gene (n ¼ 5/group), a significant increase (p < 0.05) in rectal temperature (fever) was observed in the pigs inoculated with wild-type S. Typhimurium compared to the pigs inoculated with the pnp mutant. Fecal shedding of the pnp mutant was significantly reduced during the 7-day study compared to the wild-type strain (p < 0.001). Tissue colonization was also significantly reduced in the pigs inoculated with the pnp mutant compared to the parental strain, including the tonsils, ileocecal lymph nodes, Peyer’s Patch region of the ileum, cecum and contents of the cecum (p < 0.05). The data indicate that the pnp gene is required for S. Typhimurium virulence and gastrointestinal colonization of the natural swine host. Published by Elsevier Ltd.
Keywords: Polynucleotide phosphorylase PNPase Salmonella Virulence Swine Colonization
1. Introduction In bacteria, polynucleotide phosphorylase (PNPase) is an exoribonuclease involved in mRNA degradation, tRNA processing and small RNA (sRNA) turnover, with homologues described in eukaryotes [1e4]. A multifunctional protein, PNPase is responsible for 30 / 50 processive phosphorolytic degradation and polyadenylation of RNA and is associated with the RNA degradosome, a multiprotein complex consisting of RNase E, enolase and RNA helicase RhlB [5e8]. PNPase has been shown to be involved in the environmental cold shock response of Escherichia coli [9,10], protection against H2O2 and UV induced damage in E. coli and Bacillus subtilis [11e13], and regulation of virulence gene expression of Salmonella enterica [14]. A point mutation in the pnp gene resulting in a truncated PNPase allowed S. enterica serovar Typhimurium (S. Typhimurium) to establish a persistent infection in BALB/c mice, presumably due to the observed increased expression of invasion-associated genes of
Salmonella Pathogenicity Island 1 and 2 [15]. Altered stability of a regulatory small RNA (sRNA) or the mRNA of a regulatory protein, such as SpvR, could account for the elevated expression of the Salmonella virulence genes in the presence of the mutated PNPase. The ability of S. Typhimurium with a truncated PNPase to establish a chronic carrier state in mice and our prior identification of a pnp mutant with reduced survival following exposure to the swine stomach environment [16] prompted our further investigation of the role of the pnp gene product in S. Typhimurium pathogenesis and colonization in pigs. In the current study, deletion of the pnp gene from S. Typhimurium resulted in decreased 1) fecal shedding of Salmonella in pigs, 2) clinical signs of disease and 3) swine gastrointestinal colonization.
2. Materials and methods 2.1. Construction and characterization of a S. Typhimurium pnp mutant by recombineering
* Corresponding author. 1920 Dayton Ave, Room 1403, Ames, IA 50010, USA. Tel.: þ1 515 337 7455; fax: þ1 515 337 6190. E-mail address: [email protected] (S.M.D. Bearson). 0882-4010/$ e see front matter Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.micpath.2013.10.001
PCR primers oSBI 220 (50 gtattatgccgtcaaaaattggaaaggat attattttgcttaatccgatagctgaatgagtgacgtgc 30 ) and oSBI 221 (50 ct
64
S.M.D. Bearson et al. / Microbial Pathogenesis 65 (2013) 63e66
tctttaatgctcagacgtacacggccctggcggtcaacttccagcatagagcagtgacgta gtcgc 30 ) were constructed for the PCR amplification of a linear DNA fragment to knockout the S. Typhimurium pnp gene by recombineering [17]. The 50 end of the primers contain 47 and 46 bp of nucleotide sequence (bold) that is identical to either the upstream or downstream region of the pnp gene, respectively. On the 30 end of the primers (underlined) is a universal sequence containing stop codons in all three reading frames for amplification of the neo gene and was previously described [18,19]. Following arabinoseinduction and electroporation of oSBI 220/221-neo into SX49 [20], kanamycin resistant transformants were selected on LuriaeBertani (LB) agar medium containing 50 mg kanamycin ml1. The knockout mutation was subsequently moved to virulent S. Typhimurium c4232 [21] by P22 transduction. A pnp::Km colony was screened by PCR to confirm the pnp knockout mutation, and the strain was designated SB 304. To confirm that insertion of the neo gene into the pnp gene by recombineering did not affect the downstream nlpI gene, two experiments were performed: transcriptional analysis of the nlpI gene to demonstrate nlpI expression in the pnp mutant, and a phenotypic analysis for biofilm formation, illustrating the loss of the red, dry and rough (rdar) colony morphology that is complemented by a plasmid expressing the pnp gene from an arabinose-inducible promoter. First, real-time RT-PCR was performed as described previously [20] using S. Typhimurium c4232 and SB 304 grown in LB medium at 37 C to O.D.600 ¼ 0.5 and processed in RNAprotect bacteria reagent (Qiagen). Using expression of the gyrB gene as the internal control [20], transcripts were amplified in duplicate from four experiments: 95 C for 10 min, 39 cycles at 94 C for 60 s, 58 C for 60 s, 72 C for 30 s. In wild-type S. Typhimurium c4232, amplification was identical for the pnp (sequence of primers oSBI 506 and oSBI 507: 50 CGGATAAACGTGTAGAGAAAG 30 and 50 GCAGCCGCAGGTTGAGACT 30 , respectively) and nlpI (sequence of primers oSBI 508 and oSBI 509: 50 TGGCGCGTATGGAACAGAT 30 and 50 CGCGCTAATGCCCTCAAACC 30 , respectively) genes. As expected, no pnp amplification product was observed in the pnp::Km mutant SB 304. Similar to Rouf et al. [22] whereby expression of nlpI was initiated from the tetracycline resistance gene promoter inserted in the pnp* mutant, we observed transcriptional amplification of the nlpI gene in SB 304, presumably due to expression from the neo gene promoter of the pnp::Km mutant (data no shown); a slight but insignificant increase was observed in nlpI transcription (<2-fold) compared to the wild-type strain. Thus, nlpI is expressed in SB 304. In a phenotypic assay for biofilm formation on solid medium [23], the pnp mutant SB 304 on Congo red LB agar plates (40 mg/ml Congo Red, 20 mg/ml Coomassie brilliant blue) without salt at room temperature for 48 h revealed a delay in the production of the rdar colony phenotype compared to the wild-type strain, as similarly observed by Rouf et al. [23]. Complementation with a cloned pnp gene (PCR primers oSBI 505 and oSBI 513: 50 GCAAAAGGCTACCTT ACTCG 30 and 50 TAGGAAAGGATATTATTTTGCTTAATC 30 , respectively) in the pBAD TOPOÒ TA expression vector (Invitrogen) restored the rdar colony morphology in the pnp mutant when Larabinose (0.1%) was included in the medium (data not shown). Thus, mutation of the pnp gene in SB 304 is responsible for the phenotype loss. 2.2. Swine study Ten male and female crossbred piglets from a conventional Midwestern farm were weaned and shipped to the National Animal Disease Center, Ames, IA at 12 days of age. Pigs were divided into two groups of five, separately housed in isolation facilities, and confirmed three times over a six week period to be fecal-negative for Salmonella spp. using bacteriological culture techniques [24].
At 8 weeks of age (day zero), the ten pigs were intranasally inoculated with 1 ml PBS containing either 1.0 109 colony forming units (cfu) of c4232 (wild-type; n ¼ 5) or SB 304 (pnp::Km; n ¼ 5). Body temperatures (assessed using a rectal thermometer) were taken at 0, 1, 2, 3, 5, 7 days post-inoculation (d.p.i.). Statistical analysis of daily body temperatures for each treatment group was performed in GraphPad Prism 5 using repeated measures two-way ANOVA (analysis of variance) with Bonferroni post-tests to compare data for individual days. Pig fecal samples were obtained on 0, 1, 2, 3, 5 and 7 d.p.i. and pig tissue samples were obtained at 7 d.p.i. for quantitative and qualitative Salmonella culture analyses (described in detail in Ref. [24]). Statistical analysis of the number of Salmonella present (cfu/g) in the daily fecal samples was performed in GraphPad Prism 5 using repeated measures two-way ANOVA (analysis of variance) with Bonferroni post-tests to compare data for individual days following Log10 transformation of the data. Statistical analysis of the number of Salmonella present (cfu/g) in the tissues at 7 dpi (necropsy) was analyzed in GraphPad Prism 5 using the paired t-test following Log10 transformation of the data. Procedures involving animals followed humane protocols as approved by the USDA, ARS, NADC Animal Care and Use Committee. 3. Results and discussion A signature-tagged mutagenesis screen previously performed by our group identified genes of S. enterica serovar Typhimurium that are important for survival in an ex vivo swine stomach content assay [16]. A transposon insertion in the pnp gene of S. Typhimurium resulted in a 1000-fold reduction in survival following exposure to the swine stomach content compared to the parental wildtype strain. Since the pnp gene encodes polynucleotide phosphorylase (PNPase), an exoribonuclease implicated in S. enterica virulence gene expression [14,15], the current study compared wildtype S. Typhimurium c4232 to an isogenic pnp mutant for survival and colonization potential in the natural porcine host. Over a 7-day study, rectal temperatures (fever) assessed clinical signs of infection, while quantitative and qualitative bacteriological evaluation of fecal and tissue samples measured the level of Salmonella shedding and tissue colonization in the inoculated pigs. A significantly higher rectal temperature was observed at 2 (p < 0.01) and 3 (p < 0.05) d.p.i. for the pigs inoculated with wild-type S. Typhimurium compared to the pigs inoculated with the pnp mutant (Fig. 1A). Fecal shedding of the pnp mutant was significantly reduced throughout the 7-day study compared to the wild-type strain at each day tested (Fig. 1B; p < 0.001). Tissue colonization assessed at 7 d.p.i. was also dramatically reduced in the pigs inoculated with the pnp mutant compared to the parental strain, including the tonsils (p < 0.05), ileocecal lymph nodes (p < 0.01), Peyer’s Patch region of the ileum (p < 0.05), cecum (p < 0.001) and contents of the cecum (p < 0.001) (Fig. 1C). The results indicate that the loss of PNPase in S. Typhimurium resulted in decreased colonization fitness in the natural swine host. As a major regulator in the decay of small noncoding RNAs (sRNAs) involved in posttranscriptional regulation of gene expression, PNPase influences sRNA gene regulatory functions such as the production of outer membrane proteins (OMP) and adaptation to rapid environmental changes [25e27]. Alterations in the OMP composition may influence cellular permeability, a likely explanation for the increased susceptibility to antibiotics of an E. coli pnp mutant [28] and the increased sensitivity of a S. Typhimurium pnp mutant to the contents of the swine stomach and lactic acid observed by our group [16]. Ygberg et al. [15] showed that PNPase suppresses spv gene expression (Salmonella plasmid virulence) under inducing conditions, suggesting that PNPase provides a fine-tuning mechanism for optimal virulence gene expression during infection. Other
S.M.D. Bearson et al. / Microbial Pathogenesis 65 (2013) 63e66
Rectal Temperature ( °C)
40.5
†
65
not imply recommendations or endorsement by the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer.
‡
40
Acknowledgments
39.5 Wild-type
39
pnp
38.5
We thank Stephanie Jones, Kellie Winter, Jennifer Jones and Ann Hoffman for technical assistance and Brian Brunelle and Steven Trabue for critical evaluation of the manuscript. This project was supported by USDA, ARS CRIS funds.
38 0
1
2 3 5 Days Post-inoculation
References
7
7
*
CFU/g Feces (Log10)
6
*
*
*
5
*
4 Wild-type
3
pnp
2 1 0 0
CFU/g Tissue (Log10)
6
1
‡
2 3 5 Days Post-inoculation
*
‡
5 †
4
7
*
3 Wild-type pnp
2 1 0 Tonsil
Peyer's Patch (ileum)
ICLN
Cecal Cecum Contents
Fig. 1. A S. Typhimurium pnp mutant in swine has decreased gastrointestinal colonization, fecal shedding and clinical signs of infection. Eight-week old pigs were intranasally inoculated with 1.0 109 cfu of either wild-type S. Typhimurium (c4232; n ¼ 5) or the pnp mutant (SB 304; n ¼ 5) and monitored for 7 dpi: A) Body temperature. Note that the normal body temperature of a pig is 38.5e39 C. B) Colony forming units of Salmonella per gram of feces (cfu/g). C) Quantitative and qualitative bacterial culturing for Salmonella (cfu/g) at 7 dpi in the following tissues: Tonsil, Peyer’s Patch region of the ileum, ileocecal lymph nodes (ICLN), cecum and contents of the cecum. Symbols denote significance between wild-type S. Typhimurium and the pnp mutant at the specific time point: z is p < 0.05; y is p < 0.01; * is p < 0.001.
investigations have also demonstrated a virulence function for PNPase, including Yersinia [29], Streptococcus pyogenes [30], and the phytopathogenic bacterium Dicheya dadantii [31]. Thus, via RNA metabolism, PNPase plays an important role in regulating the expression of environmentally-induced genes, thereby promoting the adaptation of the microorganisms, including Salmonella, to their diverse and fluctuating surroundings. Disclosure statements Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does
[1] Das SK, Bhutia SK, Sokhi UK, Dash R, Azab B, Sarkar D, et al. Human polynucleotide phosphorylase (hPNPase(old-35)): an evolutionary conserved gene with an expanding repertoire of RNA degradation functions. Oncogene 2011;30:1733e43. [2] Rosenzweig JA, Schesser K. Polynucleotide phosphorylase and the T3SS. Adv Exp Med Biol 2007;603:217e24. [3] Lin-Chao S, Chiou NT, Schuster G. The PNPase, exosome and RNA helicases as the building components of evolutionarily-conserved RNA degradation machines. J Biomed Sci 2007;14:523e32. [4] Carpousis AJ. The RNA degradosome of Escherichia coli: an mRNA-degrading machine assembled on RNase E. Annu Rev Microbiol 2007;61:71e87. [5] Grunberg-Manago M. Messenger RNA stability and its role in control of gene expression in bacteria and phages. Annu Rev Genet 1999;33:193e227. [6] Mohanty BK, Kushner SR. Polynucleotide phosphorylase, RNase II and RNase E play different roles in the in vivo modulation of polyadenylation in Escherichia coli. Mol Microbiol 2000;36:982e94. [7] Py B, Causton H, Mudd EA, Higgins CF. A protein complex mediating mRNA degradation in Escherichia coli. Mol Microbiol 1994;14:717e29. [8] Chen X, Taylor DW, Fowler CC, Galan JE, Wang HW, Wolin SL. An RNA degradation machine sculpted by Ro autoantigen and noncoding RNA. Cell 2013;153:166e77. [9] Yamanaka K, Inouye M. Selective mRNA degradation by polynucleotide phosphorylase in cold shock adaptation in Escherichia coli. J Bacteriol 2001;183:2808e16. [10] Phadtare S. Escherichia coli cold-shock gene profiles in response to overexpression/deletion of CsdA, RNase R and PNPase and relevance to lowtemperature RNA metabolism. Genes Cells 2012;17:850e74. [11] Rath D, Mangoli SH, Pagedar AR, Jawali N. Involvement of pnp in survival of UV radiation in Escherichia coli K-12. Microbiology 2012;158:1196e205. [12] Cardenas PP, Carrasco B, Sanchez H, Deikus G, Bechhofer DH, Alonso JC. Bacillus subtilis polynucleotide phosphorylase 30 -to-50 DNase activity is involved in DNA repair. Nucleic Acids Res 2009;37:4157e69. [13] Wu J, Jiang Z, Liu M, Gong X, Wu S, Burns CM, et al. Polynucleotide phosphorylase protects Escherichia coli against oxidative stress. Biochemistry 2009;48:2012e20. [14] Clements MO, Eriksson S, Thompson A, Lucchini S, Hinton JC, Normark S, et al. Polynucleotide phosphorylase is a global regulator of virulence and persistency in Salmonella enterica. Proc Natl Acad Sci U S A 2002;99: 8784e9. [15] Ygberg SE, Clements MO, Rytkonen A, Thompson A, Holden DW, Hinton JC, et al. Polynucleotide phosphorylase negatively controls spv virulence gene expression in Salmonella enterica. Infect Immun 2006;74:1243e54. [16] Bearson SM, Bearson BL, Rasmussen MA. Identification of Salmonella enterica serovar Typhimurium genes important for survival in the swine gastric environment. Appl Environ Microbiol 2006;72:2829e36. [17] Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 2000;97: 6640e5. [18] Bearson BL, Bearson SM. The role of the QseC quorum-sensing sensor kinase in colonization and norepinephrine-enhanced motility of Salmonella enterica serovar Typhimurium. Microb Pathog 2008;44:271e8. [19] Bearson BL, Bearson SMD, Uthe JJ, Dowd SE, Houghton JO, Lee IS, et al. Iron regulated genes of Salmonella enterica serovar Typhimurium in response to norepinephrine and the requirement of fepDGC for norepinephrine-enhanced growth. Microbes Infect 2008;10:807e16. [20] Bearson SM, Bearson BL, Brunelle BW, Sharma VK, Lee IS. A mutation in the poxA gene of Salmonella enterica serovar Typhimurium alters protein production, elevates susceptibility to environmental challenges, and decreases swine colonization. Foodborne Pathog Dis 2011;8:725e32. [21] Fedorka-Cray PJ, Kelley LC, Stabel TJ, Gray JT, Laufer JA. Alternate routes of invasion may affect pathogenesis of Salmonella typhimurium in swine. Infect Immun 1995;63:2658e64. [22] Rouf SF, Anwar N, Clements MO, Rhen M. Genetic analysis of the pnp-deaD genetic region reveals membrane lipoprotein NlpI as an independent participant in cold acclimatization of Salmonella enterica serovar Typhimurium. FEMS Microbiol Lett 2011;325:56e63. [23] Rouf SF, Ahmad I, Anwar N, Vodnala SK, Kader A, Romling U, et al. Opposing contributions of polynucleotide phosphorylase and the membrane protein
66
[24]
[25]
[26]
[27]
S.M.D. Bearson et al. / Microbial Pathogenesis 65 (2013) 63e66 NlpI to biofilm formation by Salmonella enterica serovar Typhimurium. J Bacteriol 2011;193:580e2. Bearson BL, Bearson SM, Lee IS, Brunelle BW. The Salmonella enterica serovar Typhimurium QseB response regulator negatively regulates bacterial motility and swine colonization in the absence of the QseC sensor kinase. Microb Pathog 2010;48:214e9. Viegas SC, Pfeiffer V, Sittka A, Silva IJ, Vogel J, Arraiano CM. Characterization of the role of ribonucleases in Salmonella small RNA decay. Nucleic Acids Res 2007;35:7651e64. Andrade JM, Arraiano CM. PNPase is a key player in the regulation of small RNAs that control the expression of outer membrane proteins. RNA 2008;14: 543e51. De Lay N, Gottesman S. Role of polynucleotide phosphorylase in sRNA function in Escherichia coli. RNA 2011;17:1172e89.
[28] McMurry LM, Levy SB. Tn5 insertion in the polynucleotide phosphorylase (pnp) gene in Escherichia coli increases susceptibility to antibiotics. J Bacteriol 1987;169:1321e4. [29] Rosenzweig JA, Chromy B, Echeverry A, Yang J, Adkins B, Plano GV, et al. Polynucleotide phosphorylase independently controls virulence factor expression levels and export in Yersinia spp. FEMS Microbiol Lett 2007;270: 255e64. [30] Barnett TC, Bugrysheva JV, Scott JR. Role of mRNA stability in growth phase regulation of gene expression in the group A streptococcus. J Bacteriol 2007;189:1866e73. [31] Zeng Q, Ibekwe AM, Biddle E, Yang CH. Regulatory mechanisms of exoribonuclease PNPase and regulatory small RNA on T3SS of Dickeya dadantii. Mol Plant Microbe Interact 2010;23:1345e55.