- Email: [email protected]
Poly(U) and polyadenylation termination signals are interchangeable for terminating the expression of shRNA from a pol II promoter
BBRC Biochemical and Biophysical Research Communications 323 (2004) 573–578 www.elsevier.com/locate/ybbrc
Poly(U) and polyadenylation termination signals are interchangeable for terminating the expression of shRNA from a pol II promoter Jun Songa, Shen Panga, Yingchun Lua, Robert Chiua,b,c,* a
Dental Research Institute, UCLA School of Dentistry, Los Angeles, CA 90095, USA b Department of Surgery/Oncology, UCLA School of Medicine, USA c Jonsson Comprehensive Cancer Center, UCLA, USA Received 3 August 2004
Abstract Most short hairpin RNA (shRNA)-expressing vectors use RNA polymerase III promoters, as expression of shRNAs from RNA polymerase II promoters is not well understood, due to the lack of defined transcription initiation sites and functional localization of the transcription termination signal. Here we describe a modified cytomegavirus (CMV) promoter, an RNA polymerase II promoter, to express shRNAs with only four overhangs at the 5 0 end. The expression of shRNAs from the modified CMV promoter was terminated by the transcription termination, the polyadenylation, or the poly(U) termination signal. These results demonstrated that the poly(U) and polyadenylation termination signals are interchangeable for terminating the expression of shRNAs from the CMV promoter and result in similar efficacies in inhibiting endogenous target genes in mammalian cells. Ó 2004 Elsevier Inc. All rights reserved. Keywords: Small interfering RNA; Short hairpin RNA; RNA polymerase II promoter; RNA polymerase III promoters; Transcription termination signal; Cytomegavirus promoter
In the past years, the most exciting development in gene regulation was the discovery of RNA interference (RNAi), through which short interfering RNAs (siRNAs) mediate selective gene inactivation by mRNA destruction [1–7]. Suppression of genes in vivo in mammalian systems using defined RNAi has potential implications for both therapeutics and biomedical research. The majority of the mammalian RNAi systems are driven by polymerase III promoters that express ubiquitously. RNA polymerase II promoters have been used to drive the expression of long hairpin RNAs, which are then cleaved by Dicer into siRNAs that silence target gene expression [8–10]. However, expression of long hairpin
*
Corresponding author. Fax: +1 310 825 0921. E-mail address: [email protected] (R. Chiu).
0006-291X/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.08.128
RNA in mammalian cells induces the interferon response, thereby limiting their usefulness. Pol III, which synthesizes small noncoding RNAs, including tRNAs, 5S rRNA, and U6 snRNA, has an intrinsic ability to terminate transcription upon incorporation of four to six contiguous U residues [11,12]. Pol II synthesizes transcripts with a great diversity of size and functions, and the control of termination by pol II is more complex and less well understood than termination by pol III. The mature 3 0 ends of most protein-coding pol II transcripts are generated by endonucleolytic cleavage, followed by addition of a poly(A) tail to the newly generated 3 0 end [13]. This 3 0 processing is carried out by a complex machinery that associates with pol II during elongation [14]. In addition to mRNA, pol II is responsible for synthesis of many noncoding RNAs, including small nuclear
574
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
and nucleolar RNAs. In the yeast, Saccharomyces cerevisiae, many of these RNAs are synthesized from discrete transcription units, but their 3 0 ends are not processed by cleavage and polyadenylation. Recently, siRNA transcripts expressed from a RNA polymerase II promoter, the cytomegavirus (CMV) promoter, have been shown to be capable of reducing gene expression in mammalian cells [15]. This suggests the utility of RNA polymerase II promoters for expression of shRNAs when suitably modified for both the close juxtaposition of the target sequence to the transcriptional start site and the inclusion of the proper transcription termination signals. We modified the CMV promoter to express short hairpin-loop RNAs (shRNAs) with limited overhangs in the 5 0 end, and terminated the expression of shRNAs by either the poly(U) or the polyadenylation signal.
Materials and methods Plasmids. A construct containing the cytomegavirus (CMV) promoter, either the polyadenylation signal (AATAAA) or the poly(U) termination signal (TTTTT), and the shRNA gene cloning sites, SacII and HindIII, was PCR-amplified with forward and reverse primers, using the pEGFP-N1 vector containing the CMV promoter as a template. For cloning purposes, the forward sequence, 5 0 -ACGTCTAGA TAGTTATTAATAGTAATCAA-3 0 , was flanked with XbaI at the 5 0 end (underlined), and the reverse sequence, 5 0 -GGCGAATTCAAAGC TTTATTCCGCGGTTCACTAAACCAGCTCT-3 0 (Pri-A) or 5 0 -GG CGAATTCAAAAAAAGCTTTACCGCGGTTCACTAAACCAGC TCT-3 0 (Pri-U), was flanked with EcoRI at the 5 0 end (underlined). PCRamplified products were digested with XbaI and EcoRI, and then subcloned into pBluescript II KS+ (Invitrogen, Carlsbad, CA, USA) at the XbaI and EcoRI sites to form pCMVRNAi-A or pCMVRNAi-U. Target sites for RNAi were selected from the human JNK1 (GenBank Accession No. L26318), human JNK2 sequences (GenBank Accession No. L31951), and the mouse cyclophilin A sequence (GenBank Accession No. X52803). These target sequences, flanked by SacII and HindIII, were chemically synthesized, and then inserted into the SacII and HindII sites of pCMVRNAi-A or pCMVRNAi-U. pU6-RNAi-JNK was constructed using the U6 promoter. Cell culture and transfection. HeLa and 293T cells were grown in DulbeccoÕs modified EagleÕs medium supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA). Mouse p19 EC cells were grown in minimum essential medium alpha (MEMa) supplemented with 7.5% bovine calf serum and 2.5% fetal bovine serum (Invitrogen). Transfections were performed using Lipofectamine 2000 according to the manufacturerÕs protocol (Invitrogen). Western blot analyses. Whole-cell lysates were electrophoresed and immunoblotted according to the protocol provided by Santa Cruz Biotechnology, Anti-JNK1, anti-JNK2, and anti-phospho-c-jun antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The anti-cyclophilin A antibody was obtained from BIOMOL Research Laboratory (Plymouth Meeting, PA, USA). The antib-tubulin III and anti-c-jun antibodies were obtained from Berkeley Antibody (Berkeley, CA, USA) and Calbiochem (San Diego, CA, USA), respectively. Dot hybridization. Cell culture and transfection were as described above. Total RNA was isolated from cells using trizol solution (Invitrogen) according to the manufacturerÕs protocol. Total RNA (40 lg) was dotted onto a nylon membrane (Bio-Rad, Hercules, CA, USA). Radiolabeled 20-mer oligonucleotides of the sense target se-
quence of JNK were used as probe. Prehybridization and hybridization were performed as previously described [16].
Results RNAi-mediated gene silencing by the CMV promoter is compatible with that of the U6 promoter We constructed a CMV pol II promoter to express shRNAs that silenced the endogenous target gene (Fig. 1A). The transcription initiation site was merged into the cloning site (SacII) of the vector, which starts from the first G of the cloning site. This arrangement not only simplified the process of subcloning, but also reduced the overhangs at the 5 0 end to four nucleotides, thereby increasing the effects of RNAi. To terminate the transcription of shRNAs from the CMV promoter, the polyadenylation signal (AATAAA) was added into the vector (Fig. 1A). The polyadenylation signal was partially overlapped with the cloning site sequence of HindIII. We tested the vector-based double silencing with the human JNK1 and JNK2 genes by virtue of a
Fig. 1. shRNA-mediated gene silencing using the CMV promoter and the polyadenylation signal. (A) Partial maps of the pCMVRNAi-A vector. The transcription initiation site is indicated as +1; the polyadenylation signal and cloning sites (SacII and HindIII) are indicated. (B) Target site of human JNK1 and JNK2. The consensus sequence from human JNK1 and JNK2 was used as the target site for RNAi. (C) Double gene silencing of JNK1 and JNK2 by pCMVRNAiA-JNK. Cell lysates were prepared 48 h after transfection, and Western blot analysis was used to detect the expression of JNK1 and JNK2. After Western blotting, the membrane was stained with Coomassie brilliant blue R-250 (CBB R250) and used as a loading control [35]. (D) Gene silencing by pCMVRNAi-A-JNK or by pU6RNAi-JNK. Cell lysates were prepared 48 h after transfection, and Western blot analysis was used to detect the expression of JNK1 and JNK2. The CBB R250-stained membrane was used as a loading control after Western blotting.
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
shared stretch of an identical sequence (Fig. 1B). The inhibition of JNK1 and JNK2 was observed in the cells that were transfected with pCMVRNAi-A-JNK and compared to the cells that were transfected with empty vector (Fig. 1C). Our data demonstrated that the shRNAs expressed from the CMV promoter and terminated by the polyadenylation signal resulted in effective inhibition of the target genes. Furthermore, we compared the silencing effects of targeting JNKs by expressing shRNAs from the CMV and the U6 promoters [17,18]. Western blot analysis demonstrated that similar levels of inhibition of JNK1 and JNK2 were obtained using either the U6 or the CMV promoter to express the shRNAs (Fig. 1D). These results indicated that the RNAi effects obtained by expression of shRNAs from the CMV promoter are compatible with those by the U6 promoter. Biological effects of shRNA-mediated gene silencing of JNKs from the CMV promoter
575
is possible that the termination signals affect certain RNA polymerase II promoters in a less specific manner [25]. We developed a vector, pCMVRNAi-U, to determine whether the poly(U) termination signal can terminate the transcription of shRNAs from the CMV promoter (Fig. 3A). We tested this vector using human JNKs as target genes. The difference between the putative transcripts of pCMVRNAi-U-JNK and those of pCMVRNAi-A-JNK was in the 3 0 end of the shRNAs (Fig. 3B). The inhibited expression of JNK was detected in the cells that were transfected with pCMVRNAi-UJNK or pCMVRNAi-A-JNK, but not the empty vector (Fig. 3C). These results indicated that both termination signals could be used to terminate the transcription of shRNAs from the CMV promoter. Dot hybridization was performed to confirm the expressed siRNAs (Fig. 3D). Total RNA isolated from cells transfected with empty vector, pCMVRNAi-UJNK, or pCMVRNAi-A-JNK was used. Oligonucleotides from the sequence of the sense strand of the JNK target site were used as probe. The probe detected an
We further determined whether the inhibition of the JNK family can affect the phosphorylation of its downstream c-Jun protein [19–21]. 293T cells were transfected with the plasmids, then treated with or without anisomycin, which can activate JNK activity [22–24]. Phosphorylated c-Jun was detected only in the cells that were transfected with vector, but not in the cells that were transfected with pCMVRNAi-A-JNK in the presence of anisomycin treatment (Fig. 2). This result suggests that shRNA-mediated gene silencing from the CMV promoter is a technical tool for defining the signaling transduction pathway. The poly(U) transcription termination signal effectively terminates expression of shRNA from the CMV promoter Although the function of the poly(U) termination signal (UUUUU) under control of the RNA polymerase II promoter is not fully understood, similar termination signals have been found in some RNA polymerase II transcription units that terminate transcription; thus, it
Fig. 2. Biological effects of shRNA-mediated gene silencing of the JNK family. 293T cells were transfected with vector and pCMVRNAiA-JNK, then the cells were treated with or without 10 lg/ml anisomycin for 30 min. Expression of phosphorylated c-Jun was detected.
Fig. 3. Gene silencing of the JNK family using the poly(U) transcription termination signal under the CMV promoter. (A) Partial maps of pCMVRNAi-U. The transcription initiation site is indicated as +1, and the poly(U) termination signal is indicated. SacII and HindIII were the cloning sites. (B) Putative transcripts for pCMVRNAi-U-JNK and pCMVRNAi-A-JNK. (C) Gene silencing of the JNK family by pCMVRNAi-U-JNK and pCMVRNAi-A-JNK. pCMVRNAi-U-JNK, pCMVRNAi-A-JNK, or empty vector was transfected into 293T cells, and the expression of JNK1 and JNK2 was detected using Western blot analysis. (D) Expression of siRNAs in JNK-silencing cells, using dot hybridization. b-Actin was used as a control probe.
576
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
anti-sense strand of the target sequence only, but there was no possibility to hybridize the JNK mRNA. Expression of shRNAs was detected in the cells that were transfected with either pCMVRNAi-U-JNK or pCMVRNAi-A-JNK, but not in the cells transfected with empty vector. b-Actin was used as a control probe. These results suggested that siRNA is responsible for knocking down the target genes.
b-Tubulin III was detected in cells that were transfected with pCMVRNAi-U-CypA and then treated with RA (Fig. 4C). These data demonstrated that the silencing of CypA from the CMV promoter expressed shRNAs also affected RA-induced neuron differentiation of p19 cells, and indicated that our vector could also be used in mouse cells.
The poly(U) transcription termination signal supports RNAi-mediated gene silencing of cyclophilin A from the CMV promoter
Discussion
We also confirmed our results using our vector in mouse cell lines by targeting mouse genes for cyclophilin A (CypA). A shorter loop sequence was used to determine whether the length of the loop would affect the efficacy of RNAi (Fig. 4A). pCMVRNAi-A-CypA, pCMVRNAiU-CypA, or empty vector was transfected into mouse p19 cells in which expression of CypA had been detected previously. The expression of CypA was inhibited in cells that were transfected with pCMVRNAi-A-CypA or pCMVRNAi-U-CypA (Fig. 4B). CypA demonstrated its role in the retinoic acid (RA)-induced neuronal differentiation of p19 cells [26]. Accordingly, p19 cells were transfected with or without pCMVRNAi-U-CypA, then RA-induced neuronal differentiation was performed according to the method described by Jones-Villeneuve et al. [27]. The neuron differentiation marker, b-tubulin III, was used as a marker of neuronal differentiation.
Fig. 4. Gene silencing of mouse CypA using different termination signals. (A) Putative transcripts of pCMVRNAi-U-CypA and pCMVRNAi-A-CypA. (B) Gene silencing of CypA using the CMV promoter and different termination signals. Expression of CypA was examined in mouse p19 cells that were transfected with pCMVRNAiU-CypA, pCMVRNAi-A-CypA, or empty vector. (C) CypA is involved in the neuronal differentiation of p19 cells. Mouse p19 cells were transfected with vector or pCMVRNAi-U-CypA and then treated with or without RA. b-Tubulin III was used as a neuron differentiation marker.
RNA polymerase II promoters were used to drive the expression of long hairpin RNA cleaved by Dicer into siRNAs that silence target gene expression [8–10]. However, expression of long hairpin RNA in mammalian cells induces the interferon response, thereby limiting their usefulness. Long hairpin RNA has also been used in organisms with weak or absent interferon responses. These long hairpin expression systems have effectively silenced target genes in several different organisms, including mouse oocytes and pre-implantation embryos [8], Caenorhabditis elegans [9], and Drosophila [10]. RNA polymerase II promoters allow inducible, tissue-specific or cell-type-specific RNA expression, and are thus very valuable for both biomedical research and clinical applications, such as gene therapy. A Gal4-inducible system was used to express a hairpin RNA to target b-galactosidase in Drosophila by placing the expression of the Gal4 transactivator under the control of the heat shock protein 70 promoter [10]. Recently, siRNA transcripts expressed from the CMV promoter were shown to be capable of reducing gene expression in mammalian cells [15]. In our system, expression of shRNAs with limited 5 0 overhangs from the RNA polymerase II promoter could be terminated by either the poly(U) termination or the polyadenylation signal. Inhibition of the endogenous target genes by the shRNAs was observed, and the biological consequences of their effects on the target genes were confirmed (Figs. 2B and 4C). One of the factors that affected RNAi was the length of the overhangs at the 5 0 and 3 0 ends of the shRNAs. It is increasingly shown that long overhangs at the 5 0 and 3 0 ends affect the ability to target messenger RNA cleavage [7,15,28–30]. An attempt was made to modify the CMV promoter to express shRNAs that have fewer overhangs at the 5 0 end. We merged the transcription initiation site into the cloning site (CCGCGG) of the vectors, pCMVRNAi-A and pCMVRNAi-U. The transcription initiation site starts from the first G of the cloning site, so that the shRNAs only carry four nucleotide overhangs (GCGG) at the 5 0 end (Figs. 1A and 3A). Because the transcription initiation site was the first G in the cloning site (Figs. 1A and 3A), the sequence of the target site beginning with G, GG, CGG, or GCGG will shorten the overhangs at the 5 0 end from three nucleotides to none. The target sequences we selected
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
started with a single G, which limited the overhangs to three nucleotides (Figs. 3B and 4A). Although the restricted nucleotides at the beginning of the target sequence may narrow down the selection of the candidate sites, greater effects of RNAi may be expected. The poly(U) termination signal has been found in some RNA polymerase II transcription units that terminate transcription. The poly(U) termination signal may have effects on certain RNA polymerase II promoters in a less specific manner [25]. We found that both the poly(U) termination signal and the polyadenylation signal are interchangeable for terminating expression of shRNAs from the CMV polymerase II promoter (Figs. 3 and 4). The effectiveness of the expression of shRNA and the inhibition of the target genes were compatible, although the shRNAs terminated by the poly(U) termination signal would have stronger RNAi effect than those by the polyadenylation signal, because the former has more short 3 0 end overhangs than the latter. It is possible that the poly(A) tail may have some special features that avoid repression of the RNAi effect, as shown by other long overhangs. Other signals such as the MAZ (myc-associated zinc finger protein)-binding site were also used to terminate transcription from the RNA polymerase II promoter to express long double-strand RNA [31]. A MAZ site is present in many RNA polymerase II genes, such as human genes for complement C2 and factor B, g11-C4, and within an intron of the mouse IgM-D gene [32]. It is reported that the sequence of the MAZ-binding site mediates RNA polymerase II transcriptional pausing [33,34]. Different transcription termination signals under control of the RNA polymerase II promoters to express siRNAs not only provide diversity, but also indicate that the transcription termination machinery may be partly shared between different types of promoters. Acknowledgments The authors are grateful to Kristen Lum for a critical review of the manuscript and Susan Chou for assistance with experiments. This work was supported by Public Health Services Grant CA66746 to R.C. from the National Cancer Institute.
References [1] A. Fire, S. Xu, M.K. Montgomery, S.A. Kostas, S.E. Driver, C.C. Mello, Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans, Nature 391 (1998) 806–811. [2] R.A. Jorgensen, R.G. Atkinson, R.L. Forster, W.J. Lucas, An RNA-based information superhighway in plants, Science 279 (1998) 1486–1487. [3] S.M. Elbashir, J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, T. Tuschl, Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells, Nature 411 (2001) 494–498.
577
[4] N.J. Caplen, S. Parrish, F. Imani, A. Fire, R.A. Morgan, Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems, Proc. Natl. Acad. Sci. USA. 98 (2001) 9742–9747. [5] T.R. Brummelkamp, R. Bernards, R. Agami, A system for stable expression of short interfering RNAs in mammalian cells, Science 296 (2002) 550–553. [6] M.T. McManus, C.P. Petersen, B.B. Haines, J. Chen, P.A. Sharp, Gene silencing using micro-RNA designed hairpins, RNA 8 (2002) 842–850. [7] P.J. Paddison, A.A. Caudy, E. Bernstein, G.J. Hannon, D.S. Conklin, Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells, Genes Dev. 16 (2002) 948–958. [8] P. Svoboda, P. Stein, R.M. Schultz, RNAi in mouse oocytes and preimplantation embryos: effectiveness of hairpin dsRNA, Biochem. Biophys. Res. Commun. 287 (2001) 1099–1104. [9] N. Tavernarakis, S.L. Wang, M. Dorovkov, A. Ryazanov, M. Driscoll, Heritable and inducible genetic interference by doublestranded RNA encoded by transgenes, Nat. Genet. 24 (2000) 180– 183. [10] J.R. Kennerdell, R.W. Carthew, Heritable gene silencing in Drosophila using double-stranded RNA, Nat. Biotechnol. 18 (2000) 896–898. [11] D.S. Allison, B.D. Hall, Effects of alterations in the 3 0 flanking sequence on in vivo and in vitro expression of the yeast SUP4-o tRNATyr gene, EMBO J. 4 (1985) 2657–2664. [12] F.E. Campbell Jr., D.R. Setzer, Transcription termination by RNA polymerase III: uncoupling of polymerase release from termination signal recognition, Mol. Cell Biol. 12 (1992) 2260–2272. [13] J. Zhao, L. Hyman, C. Moore, Formation of mRNA 3 0 ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis, Microbiol. Mol. Biol. Rev. 63 (1999) 405–445. [14] N. Proudfoot, J. OÕSullivan, Polyadenylation: a tail of two complexes, Curr. Biol. 12 (2002) R855–R857. [15] H. Xia, Q. Mao, H.L. Paulson, B.L. Davidson, siRNA-mediated gene silencing in vitro and in vivo, Nat. Biotechnol. 20 (2002) 1006–1010. [16] J. Song, H. Murakami, H. Tsutsui, H. Ugai, C. Geltinger, T. Murata, M. Matsumura, K. Itakura, I. Kanazawa, K. Sun, K.K. Yokoyama, Structural organization and expression of the mouse gene for Pur-1, a highly conserved homolog of the human MAZ gene, Eur. J. Biochem. 259 (1999) 676–683. [17] C.P. Paul, P.D. Good, I. Winer, D.R. Engelke, Effective expression of small interfering RNA in human cells, Nat. Biotechnol. 20 (2002) 505–508. [18] N.S. Lee, T. Dohjima, G. Bauer, H. Li, M.J. Li, A. Ehsani, P. Salvaterra, J. Rossi, Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells, Nat. Biotechnol. 20 (2002) 500–505. [19] G.L. Johnson, R. Lapadat, Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases, Science 298 (2002) 1911–1912. [20] C. Dunn, C. Wiltshire, A. MacLaren, D.A. Gillespie, Molecular mechanism and biological functions of c-Jun N-terminal kinase signalling via the c-Jun transcription factor, Cell. Signal. 14 (2002) 585–593. [21] C.R. Weston, R.J. Davis, The JNK signal transduction pathway, Curr. Opin. Genet. Dev. 12 (2002) 14–21. [22] H.S. Camp, S.R. Tafuri, T. Leff T, c-Jun N-terminal kinase phosphorylates peroxisome proliferator-activated receptorgamma1 and negatively regulates its transcriptional activity, Endocrinology 140 (1999) 392–397. [23] H.S. Park, M.S. Kim, S.H. Huh, J. Park, J. Chung, S.S. Kang, E.J. Choi, Akt (protein kinase B) negatively regulates SEK1 by means of protein phosphorylation, J. Biol. Chem. 277 (2002) 2573–2578.
578
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
[24] S. Morton, R.J. Davis, A. McLaren, P. Cohen, A reinvestigation of the multisite phosphorylation of the transcription factor c-Jun, EMBO J. 22 (2003) 3876–3886. [25] B. Lewin, Nuclear Splicing, Gene VII, Oxford University Press, New York, 2000, pp. 711–718. [26] J. Song, Y. Lu, K.K. Yokoyama, J. Rossi, R. Chiu, Cyclophilin A is required for retinoic acid-induced neuronal differentiation in p19 cells, J. Biol. Chem. 279 (2004) 24414–24419. [27] E.M.V. Jones-Villeneuve, M.A. Rudnicki, J.F. Harris, M.W. McBurney, Retinoic acid-induced neural differentiation of embryonal carcinoma cells, Mol. Cell. Biol. 3 (1983) 2271–2279. [28] D.M. Dykxhoorn, C.D. Novina, P.A. Sharp, Killing the messenger: short RNAs that silence gene expression, Nat. Rev. Mol. Cell. Biol. 4 (2003) 457–467. [29] N.J. Caplen, S. Parrish, F. Imani, A. Fire, R.A. Morgan, Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems, Proc. Natl. Acad. Sci. USA 98 (2001) 9742–9747.
[30] A. Nykanen, B. Haley, P.D. Zamore, ATP requirements and small interfering RNA structure in the RNA interference pathway, Cell 107 (2001) 309–321. [31] T. Shinagawa, S. Ishii, Generation of Ski-knockdown mice by expressing a long double-strand RNA from an RNA polymerase II promoter, Genes Dev. 17 (2003) 1340–1345. [32] R. Ashfield, A.J. Patel, S.A. Bossone, H. Brown, R.D. Campbell, K.B. Marcu, N.J. Proudfoot, MAZ-dependent termination between closely spaced human complement genes, EMBO J. 13 (1994) 5656–5667. [33] M. Yonaha, N.J. Proudfoot, Specific transcriptional pausing activates polyadenylation in a coupled in vitro system, Mol. Cell 3 (1999) 593–600. [34] M. Yonaha, N.J. Proudfoot, Transcriptional termination and coupled polyadenylation in vitro, EMBO J. 19 (2000) 3770–3777. [35] J. Song, Y. Lu, S. Pang, R. Chiu, An internal control for immunoblot analysis using the blotted membrane, Analyt. Biochem. 331 (1) (2004) 201–203.
Poly(U) and polyadenylation termination signals are interchangeable for terminating the expression of shRNA from a pol II promoter Jun Songa, Shen Panga, Yingchun Lua, Robert Chiua,b,c,* a
Dental Research Institute, UCLA School of Dentistry, Los Angeles, CA 90095, USA b Department of Surgery/Oncology, UCLA School of Medicine, USA c Jonsson Comprehensive Cancer Center, UCLA, USA Received 3 August 2004
Abstract Most short hairpin RNA (shRNA)-expressing vectors use RNA polymerase III promoters, as expression of shRNAs from RNA polymerase II promoters is not well understood, due to the lack of defined transcription initiation sites and functional localization of the transcription termination signal. Here we describe a modified cytomegavirus (CMV) promoter, an RNA polymerase II promoter, to express shRNAs with only four overhangs at the 5 0 end. The expression of shRNAs from the modified CMV promoter was terminated by the transcription termination, the polyadenylation, or the poly(U) termination signal. These results demonstrated that the poly(U) and polyadenylation termination signals are interchangeable for terminating the expression of shRNAs from the CMV promoter and result in similar efficacies in inhibiting endogenous target genes in mammalian cells. Ó 2004 Elsevier Inc. All rights reserved. Keywords: Small interfering RNA; Short hairpin RNA; RNA polymerase II promoter; RNA polymerase III promoters; Transcription termination signal; Cytomegavirus promoter
In the past years, the most exciting development in gene regulation was the discovery of RNA interference (RNAi), through which short interfering RNAs (siRNAs) mediate selective gene inactivation by mRNA destruction [1–7]. Suppression of genes in vivo in mammalian systems using defined RNAi has potential implications for both therapeutics and biomedical research. The majority of the mammalian RNAi systems are driven by polymerase III promoters that express ubiquitously. RNA polymerase II promoters have been used to drive the expression of long hairpin RNAs, which are then cleaved by Dicer into siRNAs that silence target gene expression [8–10]. However, expression of long hairpin
*
Corresponding author. Fax: +1 310 825 0921. E-mail address: [email protected] (R. Chiu).
0006-291X/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.08.128
RNA in mammalian cells induces the interferon response, thereby limiting their usefulness. Pol III, which synthesizes small noncoding RNAs, including tRNAs, 5S rRNA, and U6 snRNA, has an intrinsic ability to terminate transcription upon incorporation of four to six contiguous U residues [11,12]. Pol II synthesizes transcripts with a great diversity of size and functions, and the control of termination by pol II is more complex and less well understood than termination by pol III. The mature 3 0 ends of most protein-coding pol II transcripts are generated by endonucleolytic cleavage, followed by addition of a poly(A) tail to the newly generated 3 0 end [13]. This 3 0 processing is carried out by a complex machinery that associates with pol II during elongation [14]. In addition to mRNA, pol II is responsible for synthesis of many noncoding RNAs, including small nuclear
574
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
and nucleolar RNAs. In the yeast, Saccharomyces cerevisiae, many of these RNAs are synthesized from discrete transcription units, but their 3 0 ends are not processed by cleavage and polyadenylation. Recently, siRNA transcripts expressed from a RNA polymerase II promoter, the cytomegavirus (CMV) promoter, have been shown to be capable of reducing gene expression in mammalian cells [15]. This suggests the utility of RNA polymerase II promoters for expression of shRNAs when suitably modified for both the close juxtaposition of the target sequence to the transcriptional start site and the inclusion of the proper transcription termination signals. We modified the CMV promoter to express short hairpin-loop RNAs (shRNAs) with limited overhangs in the 5 0 end, and terminated the expression of shRNAs by either the poly(U) or the polyadenylation signal.
Materials and methods Plasmids. A construct containing the cytomegavirus (CMV) promoter, either the polyadenylation signal (AATAAA) or the poly(U) termination signal (TTTTT), and the shRNA gene cloning sites, SacII and HindIII, was PCR-amplified with forward and reverse primers, using the pEGFP-N1 vector containing the CMV promoter as a template. For cloning purposes, the forward sequence, 5 0 -ACGTCTAGA TAGTTATTAATAGTAATCAA-3 0 , was flanked with XbaI at the 5 0 end (underlined), and the reverse sequence, 5 0 -GGCGAATTCAAAGC TTTATTCCGCGGTTCACTAAACCAGCTCT-3 0 (Pri-A) or 5 0 -GG CGAATTCAAAAAAAGCTTTACCGCGGTTCACTAAACCAGC TCT-3 0 (Pri-U), was flanked with EcoRI at the 5 0 end (underlined). PCRamplified products were digested with XbaI and EcoRI, and then subcloned into pBluescript II KS+ (Invitrogen, Carlsbad, CA, USA) at the XbaI and EcoRI sites to form pCMVRNAi-A or pCMVRNAi-U. Target sites for RNAi were selected from the human JNK1 (GenBank Accession No. L26318), human JNK2 sequences (GenBank Accession No. L31951), and the mouse cyclophilin A sequence (GenBank Accession No. X52803). These target sequences, flanked by SacII and HindIII, were chemically synthesized, and then inserted into the SacII and HindII sites of pCMVRNAi-A or pCMVRNAi-U. pU6-RNAi-JNK was constructed using the U6 promoter. Cell culture and transfection. HeLa and 293T cells were grown in DulbeccoÕs modified EagleÕs medium supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA). Mouse p19 EC cells were grown in minimum essential medium alpha (MEMa) supplemented with 7.5% bovine calf serum and 2.5% fetal bovine serum (Invitrogen). Transfections were performed using Lipofectamine 2000 according to the manufacturerÕs protocol (Invitrogen). Western blot analyses. Whole-cell lysates were electrophoresed and immunoblotted according to the protocol provided by Santa Cruz Biotechnology, Anti-JNK1, anti-JNK2, and anti-phospho-c-jun antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The anti-cyclophilin A antibody was obtained from BIOMOL Research Laboratory (Plymouth Meeting, PA, USA). The antib-tubulin III and anti-c-jun antibodies were obtained from Berkeley Antibody (Berkeley, CA, USA) and Calbiochem (San Diego, CA, USA), respectively. Dot hybridization. Cell culture and transfection were as described above. Total RNA was isolated from cells using trizol solution (Invitrogen) according to the manufacturerÕs protocol. Total RNA (40 lg) was dotted onto a nylon membrane (Bio-Rad, Hercules, CA, USA). Radiolabeled 20-mer oligonucleotides of the sense target se-
quence of JNK were used as probe. Prehybridization and hybridization were performed as previously described [16].
Results RNAi-mediated gene silencing by the CMV promoter is compatible with that of the U6 promoter We constructed a CMV pol II promoter to express shRNAs that silenced the endogenous target gene (Fig. 1A). The transcription initiation site was merged into the cloning site (SacII) of the vector, which starts from the first G of the cloning site. This arrangement not only simplified the process of subcloning, but also reduced the overhangs at the 5 0 end to four nucleotides, thereby increasing the effects of RNAi. To terminate the transcription of shRNAs from the CMV promoter, the polyadenylation signal (AATAAA) was added into the vector (Fig. 1A). The polyadenylation signal was partially overlapped with the cloning site sequence of HindIII. We tested the vector-based double silencing with the human JNK1 and JNK2 genes by virtue of a
Fig. 1. shRNA-mediated gene silencing using the CMV promoter and the polyadenylation signal. (A) Partial maps of the pCMVRNAi-A vector. The transcription initiation site is indicated as +1; the polyadenylation signal and cloning sites (SacII and HindIII) are indicated. (B) Target site of human JNK1 and JNK2. The consensus sequence from human JNK1 and JNK2 was used as the target site for RNAi. (C) Double gene silencing of JNK1 and JNK2 by pCMVRNAiA-JNK. Cell lysates were prepared 48 h after transfection, and Western blot analysis was used to detect the expression of JNK1 and JNK2. After Western blotting, the membrane was stained with Coomassie brilliant blue R-250 (CBB R250) and used as a loading control [35]. (D) Gene silencing by pCMVRNAi-A-JNK or by pU6RNAi-JNK. Cell lysates were prepared 48 h after transfection, and Western blot analysis was used to detect the expression of JNK1 and JNK2. The CBB R250-stained membrane was used as a loading control after Western blotting.
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
shared stretch of an identical sequence (Fig. 1B). The inhibition of JNK1 and JNK2 was observed in the cells that were transfected with pCMVRNAi-A-JNK and compared to the cells that were transfected with empty vector (Fig. 1C). Our data demonstrated that the shRNAs expressed from the CMV promoter and terminated by the polyadenylation signal resulted in effective inhibition of the target genes. Furthermore, we compared the silencing effects of targeting JNKs by expressing shRNAs from the CMV and the U6 promoters [17,18]. Western blot analysis demonstrated that similar levels of inhibition of JNK1 and JNK2 were obtained using either the U6 or the CMV promoter to express the shRNAs (Fig. 1D). These results indicated that the RNAi effects obtained by expression of shRNAs from the CMV promoter are compatible with those by the U6 promoter. Biological effects of shRNA-mediated gene silencing of JNKs from the CMV promoter
575
is possible that the termination signals affect certain RNA polymerase II promoters in a less specific manner [25]. We developed a vector, pCMVRNAi-U, to determine whether the poly(U) termination signal can terminate the transcription of shRNAs from the CMV promoter (Fig. 3A). We tested this vector using human JNKs as target genes. The difference between the putative transcripts of pCMVRNAi-U-JNK and those of pCMVRNAi-A-JNK was in the 3 0 end of the shRNAs (Fig. 3B). The inhibited expression of JNK was detected in the cells that were transfected with pCMVRNAi-UJNK or pCMVRNAi-A-JNK, but not the empty vector (Fig. 3C). These results indicated that both termination signals could be used to terminate the transcription of shRNAs from the CMV promoter. Dot hybridization was performed to confirm the expressed siRNAs (Fig. 3D). Total RNA isolated from cells transfected with empty vector, pCMVRNAi-UJNK, or pCMVRNAi-A-JNK was used. Oligonucleotides from the sequence of the sense strand of the JNK target site were used as probe. The probe detected an
We further determined whether the inhibition of the JNK family can affect the phosphorylation of its downstream c-Jun protein [19–21]. 293T cells were transfected with the plasmids, then treated with or without anisomycin, which can activate JNK activity [22–24]. Phosphorylated c-Jun was detected only in the cells that were transfected with vector, but not in the cells that were transfected with pCMVRNAi-A-JNK in the presence of anisomycin treatment (Fig. 2). This result suggests that shRNA-mediated gene silencing from the CMV promoter is a technical tool for defining the signaling transduction pathway. The poly(U) transcription termination signal effectively terminates expression of shRNA from the CMV promoter Although the function of the poly(U) termination signal (UUUUU) under control of the RNA polymerase II promoter is not fully understood, similar termination signals have been found in some RNA polymerase II transcription units that terminate transcription; thus, it
Fig. 2. Biological effects of shRNA-mediated gene silencing of the JNK family. 293T cells were transfected with vector and pCMVRNAiA-JNK, then the cells were treated with or without 10 lg/ml anisomycin for 30 min. Expression of phosphorylated c-Jun was detected.
Fig. 3. Gene silencing of the JNK family using the poly(U) transcription termination signal under the CMV promoter. (A) Partial maps of pCMVRNAi-U. The transcription initiation site is indicated as +1, and the poly(U) termination signal is indicated. SacII and HindIII were the cloning sites. (B) Putative transcripts for pCMVRNAi-U-JNK and pCMVRNAi-A-JNK. (C) Gene silencing of the JNK family by pCMVRNAi-U-JNK and pCMVRNAi-A-JNK. pCMVRNAi-U-JNK, pCMVRNAi-A-JNK, or empty vector was transfected into 293T cells, and the expression of JNK1 and JNK2 was detected using Western blot analysis. (D) Expression of siRNAs in JNK-silencing cells, using dot hybridization. b-Actin was used as a control probe.
576
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
anti-sense strand of the target sequence only, but there was no possibility to hybridize the JNK mRNA. Expression of shRNAs was detected in the cells that were transfected with either pCMVRNAi-U-JNK or pCMVRNAi-A-JNK, but not in the cells transfected with empty vector. b-Actin was used as a control probe. These results suggested that siRNA is responsible for knocking down the target genes.
b-Tubulin III was detected in cells that were transfected with pCMVRNAi-U-CypA and then treated with RA (Fig. 4C). These data demonstrated that the silencing of CypA from the CMV promoter expressed shRNAs also affected RA-induced neuron differentiation of p19 cells, and indicated that our vector could also be used in mouse cells.
The poly(U) transcription termination signal supports RNAi-mediated gene silencing of cyclophilin A from the CMV promoter
Discussion
We also confirmed our results using our vector in mouse cell lines by targeting mouse genes for cyclophilin A (CypA). A shorter loop sequence was used to determine whether the length of the loop would affect the efficacy of RNAi (Fig. 4A). pCMVRNAi-A-CypA, pCMVRNAiU-CypA, or empty vector was transfected into mouse p19 cells in which expression of CypA had been detected previously. The expression of CypA was inhibited in cells that were transfected with pCMVRNAi-A-CypA or pCMVRNAi-U-CypA (Fig. 4B). CypA demonstrated its role in the retinoic acid (RA)-induced neuronal differentiation of p19 cells [26]. Accordingly, p19 cells were transfected with or without pCMVRNAi-U-CypA, then RA-induced neuronal differentiation was performed according to the method described by Jones-Villeneuve et al. [27]. The neuron differentiation marker, b-tubulin III, was used as a marker of neuronal differentiation.
Fig. 4. Gene silencing of mouse CypA using different termination signals. (A) Putative transcripts of pCMVRNAi-U-CypA and pCMVRNAi-A-CypA. (B) Gene silencing of CypA using the CMV promoter and different termination signals. Expression of CypA was examined in mouse p19 cells that were transfected with pCMVRNAiU-CypA, pCMVRNAi-A-CypA, or empty vector. (C) CypA is involved in the neuronal differentiation of p19 cells. Mouse p19 cells were transfected with vector or pCMVRNAi-U-CypA and then treated with or without RA. b-Tubulin III was used as a neuron differentiation marker.
RNA polymerase II promoters were used to drive the expression of long hairpin RNA cleaved by Dicer into siRNAs that silence target gene expression [8–10]. However, expression of long hairpin RNA in mammalian cells induces the interferon response, thereby limiting their usefulness. Long hairpin RNA has also been used in organisms with weak or absent interferon responses. These long hairpin expression systems have effectively silenced target genes in several different organisms, including mouse oocytes and pre-implantation embryos [8], Caenorhabditis elegans [9], and Drosophila [10]. RNA polymerase II promoters allow inducible, tissue-specific or cell-type-specific RNA expression, and are thus very valuable for both biomedical research and clinical applications, such as gene therapy. A Gal4-inducible system was used to express a hairpin RNA to target b-galactosidase in Drosophila by placing the expression of the Gal4 transactivator under the control of the heat shock protein 70 promoter [10]. Recently, siRNA transcripts expressed from the CMV promoter were shown to be capable of reducing gene expression in mammalian cells [15]. In our system, expression of shRNAs with limited 5 0 overhangs from the RNA polymerase II promoter could be terminated by either the poly(U) termination or the polyadenylation signal. Inhibition of the endogenous target genes by the shRNAs was observed, and the biological consequences of their effects on the target genes were confirmed (Figs. 2B and 4C). One of the factors that affected RNAi was the length of the overhangs at the 5 0 and 3 0 ends of the shRNAs. It is increasingly shown that long overhangs at the 5 0 and 3 0 ends affect the ability to target messenger RNA cleavage [7,15,28–30]. An attempt was made to modify the CMV promoter to express shRNAs that have fewer overhangs at the 5 0 end. We merged the transcription initiation site into the cloning site (CCGCGG) of the vectors, pCMVRNAi-A and pCMVRNAi-U. The transcription initiation site starts from the first G of the cloning site, so that the shRNAs only carry four nucleotide overhangs (GCGG) at the 5 0 end (Figs. 1A and 3A). Because the transcription initiation site was the first G in the cloning site (Figs. 1A and 3A), the sequence of the target site beginning with G, GG, CGG, or GCGG will shorten the overhangs at the 5 0 end from three nucleotides to none. The target sequences we selected
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
started with a single G, which limited the overhangs to three nucleotides (Figs. 3B and 4A). Although the restricted nucleotides at the beginning of the target sequence may narrow down the selection of the candidate sites, greater effects of RNAi may be expected. The poly(U) termination signal has been found in some RNA polymerase II transcription units that terminate transcription. The poly(U) termination signal may have effects on certain RNA polymerase II promoters in a less specific manner [25]. We found that both the poly(U) termination signal and the polyadenylation signal are interchangeable for terminating expression of shRNAs from the CMV polymerase II promoter (Figs. 3 and 4). The effectiveness of the expression of shRNA and the inhibition of the target genes were compatible, although the shRNAs terminated by the poly(U) termination signal would have stronger RNAi effect than those by the polyadenylation signal, because the former has more short 3 0 end overhangs than the latter. It is possible that the poly(A) tail may have some special features that avoid repression of the RNAi effect, as shown by other long overhangs. Other signals such as the MAZ (myc-associated zinc finger protein)-binding site were also used to terminate transcription from the RNA polymerase II promoter to express long double-strand RNA [31]. A MAZ site is present in many RNA polymerase II genes, such as human genes for complement C2 and factor B, g11-C4, and within an intron of the mouse IgM-D gene [32]. It is reported that the sequence of the MAZ-binding site mediates RNA polymerase II transcriptional pausing [33,34]. Different transcription termination signals under control of the RNA polymerase II promoters to express siRNAs not only provide diversity, but also indicate that the transcription termination machinery may be partly shared between different types of promoters. Acknowledgments The authors are grateful to Kristen Lum for a critical review of the manuscript and Susan Chou for assistance with experiments. This work was supported by Public Health Services Grant CA66746 to R.C. from the National Cancer Institute.
References [1] A. Fire, S. Xu, M.K. Montgomery, S.A. Kostas, S.E. Driver, C.C. Mello, Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans, Nature 391 (1998) 806–811. [2] R.A. Jorgensen, R.G. Atkinson, R.L. Forster, W.J. Lucas, An RNA-based information superhighway in plants, Science 279 (1998) 1486–1487. [3] S.M. Elbashir, J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, T. Tuschl, Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells, Nature 411 (2001) 494–498.
577
[4] N.J. Caplen, S. Parrish, F. Imani, A. Fire, R.A. Morgan, Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems, Proc. Natl. Acad. Sci. USA. 98 (2001) 9742–9747. [5] T.R. Brummelkamp, R. Bernards, R. Agami, A system for stable expression of short interfering RNAs in mammalian cells, Science 296 (2002) 550–553. [6] M.T. McManus, C.P. Petersen, B.B. Haines, J. Chen, P.A. Sharp, Gene silencing using micro-RNA designed hairpins, RNA 8 (2002) 842–850. [7] P.J. Paddison, A.A. Caudy, E. Bernstein, G.J. Hannon, D.S. Conklin, Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells, Genes Dev. 16 (2002) 948–958. [8] P. Svoboda, P. Stein, R.M. Schultz, RNAi in mouse oocytes and preimplantation embryos: effectiveness of hairpin dsRNA, Biochem. Biophys. Res. Commun. 287 (2001) 1099–1104. [9] N. Tavernarakis, S.L. Wang, M. Dorovkov, A. Ryazanov, M. Driscoll, Heritable and inducible genetic interference by doublestranded RNA encoded by transgenes, Nat. Genet. 24 (2000) 180– 183. [10] J.R. Kennerdell, R.W. Carthew, Heritable gene silencing in Drosophila using double-stranded RNA, Nat. Biotechnol. 18 (2000) 896–898. [11] D.S. Allison, B.D. Hall, Effects of alterations in the 3 0 flanking sequence on in vivo and in vitro expression of the yeast SUP4-o tRNATyr gene, EMBO J. 4 (1985) 2657–2664. [12] F.E. Campbell Jr., D.R. Setzer, Transcription termination by RNA polymerase III: uncoupling of polymerase release from termination signal recognition, Mol. Cell Biol. 12 (1992) 2260–2272. [13] J. Zhao, L. Hyman, C. Moore, Formation of mRNA 3 0 ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis, Microbiol. Mol. Biol. Rev. 63 (1999) 405–445. [14] N. Proudfoot, J. OÕSullivan, Polyadenylation: a tail of two complexes, Curr. Biol. 12 (2002) R855–R857. [15] H. Xia, Q. Mao, H.L. Paulson, B.L. Davidson, siRNA-mediated gene silencing in vitro and in vivo, Nat. Biotechnol. 20 (2002) 1006–1010. [16] J. Song, H. Murakami, H. Tsutsui, H. Ugai, C. Geltinger, T. Murata, M. Matsumura, K. Itakura, I. Kanazawa, K. Sun, K.K. Yokoyama, Structural organization and expression of the mouse gene for Pur-1, a highly conserved homolog of the human MAZ gene, Eur. J. Biochem. 259 (1999) 676–683. [17] C.P. Paul, P.D. Good, I. Winer, D.R. Engelke, Effective expression of small interfering RNA in human cells, Nat. Biotechnol. 20 (2002) 505–508. [18] N.S. Lee, T. Dohjima, G. Bauer, H. Li, M.J. Li, A. Ehsani, P. Salvaterra, J. Rossi, Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells, Nat. Biotechnol. 20 (2002) 500–505. [19] G.L. Johnson, R. Lapadat, Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases, Science 298 (2002) 1911–1912. [20] C. Dunn, C. Wiltshire, A. MacLaren, D.A. Gillespie, Molecular mechanism and biological functions of c-Jun N-terminal kinase signalling via the c-Jun transcription factor, Cell. Signal. 14 (2002) 585–593. [21] C.R. Weston, R.J. Davis, The JNK signal transduction pathway, Curr. Opin. Genet. Dev. 12 (2002) 14–21. [22] H.S. Camp, S.R. Tafuri, T. Leff T, c-Jun N-terminal kinase phosphorylates peroxisome proliferator-activated receptorgamma1 and negatively regulates its transcriptional activity, Endocrinology 140 (1999) 392–397. [23] H.S. Park, M.S. Kim, S.H. Huh, J. Park, J. Chung, S.S. Kang, E.J. Choi, Akt (protein kinase B) negatively regulates SEK1 by means of protein phosphorylation, J. Biol. Chem. 277 (2002) 2573–2578.
578
J. Song et al. / Biochemical and Biophysical Research Communications 323 (2004) 573–578
[24] S. Morton, R.J. Davis, A. McLaren, P. Cohen, A reinvestigation of the multisite phosphorylation of the transcription factor c-Jun, EMBO J. 22 (2003) 3876–3886. [25] B. Lewin, Nuclear Splicing, Gene VII, Oxford University Press, New York, 2000, pp. 711–718. [26] J. Song, Y. Lu, K.K. Yokoyama, J. Rossi, R. Chiu, Cyclophilin A is required for retinoic acid-induced neuronal differentiation in p19 cells, J. Biol. Chem. 279 (2004) 24414–24419. [27] E.M.V. Jones-Villeneuve, M.A. Rudnicki, J.F. Harris, M.W. McBurney, Retinoic acid-induced neural differentiation of embryonal carcinoma cells, Mol. Cell. Biol. 3 (1983) 2271–2279. [28] D.M. Dykxhoorn, C.D. Novina, P.A. Sharp, Killing the messenger: short RNAs that silence gene expression, Nat. Rev. Mol. Cell. Biol. 4 (2003) 457–467. [29] N.J. Caplen, S. Parrish, F. Imani, A. Fire, R.A. Morgan, Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems, Proc. Natl. Acad. Sci. USA 98 (2001) 9742–9747.
[30] A. Nykanen, B. Haley, P.D. Zamore, ATP requirements and small interfering RNA structure in the RNA interference pathway, Cell 107 (2001) 309–321. [31] T. Shinagawa, S. Ishii, Generation of Ski-knockdown mice by expressing a long double-strand RNA from an RNA polymerase II promoter, Genes Dev. 17 (2003) 1340–1345. [32] R. Ashfield, A.J. Patel, S.A. Bossone, H. Brown, R.D. Campbell, K.B. Marcu, N.J. Proudfoot, MAZ-dependent termination between closely spaced human complement genes, EMBO J. 13 (1994) 5656–5667. [33] M. Yonaha, N.J. Proudfoot, Specific transcriptional pausing activates polyadenylation in a coupled in vitro system, Mol. Cell 3 (1999) 593–600. [34] M. Yonaha, N.J. Proudfoot, Transcriptional termination and coupled polyadenylation in vitro, EMBO J. 19 (2000) 3770–3777. [35] J. Song, Y. Lu, S. Pang, R. Chiu, An internal control for immunoblot analysis using the blotted membrane, Analyt. Biochem. 331 (1) (2004) 201–203.