Population genetics, sequence diversity and selection in the gene encoding the Plasmodium falciparum apical membrane antigen 1 in clinical isolates from the south-east of Iran

Infection, Genetics and Evolution 17 (2013) 51–61

Contents lists available at SciVerse ScienceDirect

Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid

Population genetics, sequence diversity and selection in the gene encoding the Plasmodium falciparum apical membrane antigen 1 in clinical isolates from the south-east of Iran Akram Abouie Mehrizi a, Masoumeh Sepehri b, Fatemeh Karimi a, Navid Dinparast Djadid a, Sedigheh Zakeri a,⇑ a b

Malaria and Vector Research Group (MVRG), Biotechnology Research Center (BRC), Pasteur Institute of Iran, Tehran 1316943551, Iran Cell Biology Department, Pharmaceutical Sciences Branch, Islamic Azad University, Iran

a r t i c l e

i n f o

Article history: Received 26 January 2013 Received in revised form 17 March 2013 Accepted 23 March 2013 Available online 2 April 2013 Keywords: Genetic diversity Plasmodium falciparum Apical membrane antigen-1 Vaccine Iran

a b s t r a c t The Plasmodium falciparum apical membrane antigen1 (AMA1) is a leading malaria vaccine candidate antigen. In the present investigation, for the first time, the almost full length of the ama1 gene covering domain I (DI), DII and DIII was PCR amplified and sequenced in 21 P. falciparum isolates collected from the southeastern parts of Iran. The result showed the low genetic diversity of Iranian PfAMA1 with 11 PfAMA1 haplotypes in which nine out of 11 haplotypes are novel and have been reported for the first time. The Iranian P. falciparum population indicated a moderate level of genetic differentiation. The difference among the rates of non-synonymous and synonymous mutations, Tajima’s D and McDonald–Kreitman tests suggested that the diversity at DI is due to positive natural selection. In addition, recombination contributes to the diversity of Iranian PfAMA1 and this is supported by the decline of the linkage disequilibrium index R2 with increasing the nucleotide distance. The highly polymorphic residues (positions: 187, 197, 200, 230 and 243) were polymorphic; however, most of the SNPs in non-polymorphic residues were conserved except the residue at position 395. Nevertheless, no mutation was found in the DII loop of the Iranian PfAMA1, indicating that it is subjected to purifying selection. In conclusion, the low genetic diversity in PfAMA1 among Iranian isolates supports and provides valuable information for the development of a PfAMA1-based malaria vaccine. Ó 2013 Elsevier B.V. All rights reserved.

1. Introduction Malaria is one of the most life-threatening diseases in many tropical and sub-tropical countries. According to the World Health Organization (WHO) malaria report, there were about 216 million malaria cases and 655,000 deaths in 2010 (WHO, 2012). Although in the recent years, increased malaria prevention, control and elimination strategies have dramatically decreased the cases (WHO, 2012), malaria burden is still a major global health problem in many countries and every minute a child dies from malaria in Africa (WHO, 2012). The unacceptable health burden of malaria and its influence on economic and social impacts have led to making a plan to scale up malaria control, elimination and global eradication (The malERA Consultative Group on Vaccines, 2011). However, the hopes of achieving this goal are diminishing due to the limited effective control tools. In addition, the emergence of drug-resistant parasites, resistance of anopheles vector to available insecticides, a lack of epidemiological knowledge and the unavailability of a suit⇑ Corresponding author. Tel.: +98 21 66480780; fax: +98 2166465132. E-mail addresses: [email protected], [email protected] (S. Zakeri). 1567-1348/$ - see front matter Ó 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.meegid.2013.03.042

able malaria vaccine further complicate the elimination strategies. To overcome these problems, the recent suggestion made by experts is to scale up control with currently available tools in order to reduce mortality and morbidity in malaria endemic regions. In this regard, the Malaria Eradication Research Agenda (malERA) suggested that in the current research plans identifying key knowledge gaps as well as discovering a new tool such as vaccine should be taken into consideration (Alonso et al., 2011). The vast majority of deaths and severe malaria diseases result from Plasmodium falciparum infections and this parasite has developed the most resistance Plasmodium species for treatment of antimalarial drugs. For these reasons, a reduction in disease and death due to P. falciparum has been the primary objective of most of the malaria researches and control efforts to date; hence, to achieve and complete this goal, a highly effective P. falciparum vaccine could be a critical tool. However, different studies have showed that the main issue in vaccine development is the antigenic diversity of the vaccine candidate antigens that generate variant specific immune response, which is less effective against parasites expressing other variants (Crewther et al., 1996; Hodder et al., 2001; Kennedy et al., 2002; Healer et al., 2004). Therefore, to design an

52

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61

efficient and protective malaria vaccine, it is essential to determine the circulating antigenic variants in different malaria endemic areas that could be applied in the vaccine development (Volkman et al., 2012). Plasmodium falciparum apical membrane antigen 1 (PfAMA1) is the leading vaccine candidate antigen (Hodder et al., 2001; Malkin et al., 2005; Saul et al., 2005; Langermans et al., 2006; Miao et al., 2006), which is expressed on both the pre-erythrocyte and blood stages of the parasite life cycle (Kocken et al., 2000; Hodder et al., 2001). The AMA1 coding gene is comprised of 1866 bp that translates to 622 amino acids (Peterson et al., 1989) with 16 conserved cysteine residues and in the N-terminal form, 8 disulfide bonds resulting ectodomain formation, including domains I (DI), DII and DIII (Waters et al., 1990; Cheng and Saul, 1994). Different studies have revealed that pfama1 sequences from natural infections have shown an extreme diversity with almost 62 polymorphic amino acid sites (10%) in the entire gene (Nair et al., 2002; Takala et al., 2009). Further study has shown that 32 out of 62 polymorphic amino acid positions are located in DI, 11 in DII and 9 in DIII (Remarque et al., 2008) and have clustered in two parts of the protein. Crystal structures of AMA1 have revealed that this protein contains a pair of closely associated PAN domains (Bai et al., 2005; Pizarro et al., 2005) with seven extended loops and a long hydrophobic trough (Bai et al., 2005), proposed as a ligand-binding pocket. The growth-inhibitory monoclonal antibody 1F9, which inhibits merozoite invasion and interacts with an epitope on AMA1, includes residues in the hydrophobic trough and on loops surrounding the trough on DI (Coley et al., 2001, 2006, 2007). Also, clusters of polymorphisms that might contribute to the antibody escape have been identified on all three domains of AMA1 (Dutta et al., 2007). Besides, the level of polymorphism in PfAMA1 DI is greater than in DII and DIII (Polley and Conway, 2001; Cortés et al., 2003), especially in a cluster of amino acids near a hydrophobic pocket (Bai et al., 2005), that is thought to play a role in erythrocyte invasion. This cluster (cluster 1 loop of DI/ C1-L), is a target for inhibitory monoclonal antibody 1F9 (Coley et al., 2007), and the largest interaction is made by the four residues: E197 and H200 (highly polymorphic), F201 (less polymorphic) and D204 (firmly dimorphic). Among them, residue 197 has showed to be a critical residue in this dominant epitope (Coley et al., 2007). In regard to DII and DIII of PfAMA1, independent studies have revealed that these domains are critical for merozoite function (Nair et al., 2002; Lalitha et al., 2004; Feng et al., 2005; Collins et al., 2007; Osier et al., 2010). Also, the clustering polymorphisms in these parts of protein have showed that these domains are targets for protective antibody response in humans (Kocken et al., 1998; Howell et al., 2001; Nair et al., 2002). The growth-inhibitory monoclonal antibody 4G2, which is a potent invasion inhibitor antibody (Kocken et al., 1998), recognizes the loop of DII (Pizarro et al., 2005; Collins et al., 2007; Anstey et al., 2009). However, the non-inhibitory monoclonal antibody F8.12.19 recognizes the epitope that is located in DIII and conserved in several Plasmodial species (Igonet et al., 2007). Moreover, the highly polymorphic region of AMA1 surrounds one end of the hydrophobic trough in DI, but dimorphic residues extend down one side of the protein surface into DII and DIII (Chesne-Seck et al., 2005; Bai et al., 2005). Taking into account the polymorphisms in Plasmodium parasites could hamper the development of an effective malaria vaccine. Therefore, in the present investigation, the sequence diversity at the full length of the pfama1 gene was investigated in a P. falciparum population from seasonal and low malaria endemic areas of Iran. Also, variation in the selection and recombination across the ectodomain of PfAMA1 gene was examined in the same population. Finally, the sequence polymorphism in pfama1 found in natural populations of Iranian P. falciparum was compared with

those of global geographic regions, as understanding the nature and origin of such polymorphism is a key feature for vaccine development based on the AMA1 antigen. 2. Materials and methods 2.1. Study area and subjects This study was carried out in Chabahar, Sistan and Baluchistan province in south-eastern Iran, where 10% of malaria cases are infected with P. falciparum. In this investigation, 66 blood samples were collected from P. falciparum infected patients with symptomatic uncomplicated malaria. The patients attended at the Malaria Health Center in Chabahar Public Health Department in Sistan and Baluchistan province and were confirmed to be positive for P. falciparum by Giemsa-stained blood smears during 2009–2010. All P. falciparum positive samples were verified by molecular diagnosis using the 18ssrRNA gene as described previously (Snounou et al., 1993). One ml venous blood was collected from P. falciparum-infected patients in EDTA tubes after obtaining an informed consent from adults or the parents or legal guardians of children. The collected blood samples were transported to the main laboratory in Pasteur Institute of Iran in a cool condition. The majority of the patients were male (75.75%) with a mean age of 29.4 ± 15.058 years (ranged between 4 and 65 years old). The patients’ travel histories were obtained by a physician prior to sampling. This study was approved by the Ethical Review Committee of Pasteur Institute of Iran. 2.2. Parasite DNA extraction and PfAMA1 gene analysis DNA extraction from the whole blood was performed by using the commercially available DNA purification kit (Promega, Madison, WI, USA) and kept at 20 °C until use. Extracted DNA was used to amplify the amino acids 56-600 including the complete ectodomain (DI, DII and DIII) of the PfAMA1 gene (corresponding to 165– 1800 nucleotides) using the following primers, as designed in our laboratory according to the PfAMA1 gene of 3D7 strain (accession no. XM_001347979): PfAMAF: ACACCAGGTACATACATACCAAC nt: 165–187 PfAMAR: TGCCTCAGGATCTAACATTTC nt: 1780–1800 PCR amplification was carried out in a final volume of 25 ll PCR reaction containing 125 lM each dNTPs, 2 mM MgCl2, 250 nM each primer, 1 mM spermidine, 0.5 U Taq DNA polymerase (Invitrogen, Carlsbad, CA) and 1 ll DNA as template. The cycling parameters for the PCR were 30 cycles of 94 °C for 1 min, annealing at 55 °C for 1 min and extension at 68 °C for 2 min, followed by a final extension at 68 °C for 15 min. PCR fragments were analyzed by electrophoresis on 1% agarose gels (Invitrogen, Carlsbad, CA). 2.3. Nucleotide sequencing and sequence analysis The amplified fragment of Iranian PfAMA1 was gel-purified using the QIAGEN DNA purification kit (Qiagen, Germany) according to the manufacturer’s instructions. Direct sequencing of the full-length ectodomain of PfAMA1 was carried out from both strands by PfAMAF and PfAMAR primers using the dideoxy chain termination procedure (Chemistry V3.1, Applied Biosystems) and the 3730XL DNA analyzer (Applied Biosystems) by MilleGen sequencing service (Labege, France). After confirmation of the obtained sequences by Blast software, the nucleotide sequences were translated to amino acid sequences by GenRunner software. Then, the nucleotide and translated amino acid sequences were aligned with the corresponding 3D7 (accession no. XM_001347979) sequence using CLUSTALW, and the SNPs in DI, DII and DIII of the pfam-

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61

a1 gene were determined in comparison with the 3D7 isolate (accession no. XM_001347979). Moreover, the haplotypes were classified based on amino acid sequences of the examined samples in comparison with the 3D7 isolate (accession no. XM_001347979). In addition, BLAST searches were performed to compare these PfAMA1 haplotypes with other available sequences in the GenBank database. The representing sequences of PfAMA1 haplotypes reported here have been deposited in EMBL, Genbank and DDJB databases under the accession nos. KC413989–KC413999. 2.4. Statistical and phylogenetic analyses The haplotype diversity (Hd), number of haplotypes (H), number of segregating sites (S), nucleotide diversity (p), average number of pairwise nucleotide differences within the population (K), linkage disequilibrium (LD) and recombination parameters (R and Rm) were calculated using the DnaSP package version 5.10.01 (Librado and Rozas, 2009). In addition, the p diversity was also calculated on a sliding window of 100 bases, with a step size of 25 bp, in order to obtain the step-wise diversity across the entire ectodomain as well as DI, DII and DIII. The rates of synonymous (dS) and non-synonymous (dN) mutations were computed using DnaSP version 5.10.01 with the method of Nei and Gojobori (1986) with the Jukes and Cantor (JC) correction (Jukes and Cantor, 1969). The dN–dS difference and Tajima’s D (Tajima, 1989) and the Fu and Li’s D⁄ and F⁄ tests (Fu and Li, 1993) were calculated using the DnaSP package version 5.10.01 (Librado and Rozas, 2009) to test the neutral theory of evolution. Positive values for Nei–Gojobori (dN–dS), Tajima’s D and the Fu and Li’s D⁄ and F⁄ tests correspond to positive natural selection, whereas negative values correspond to negative or purifying selection. Furthermore, the (McDonald and Kreitman, 1991) test was applied as a test of neutrality taking partial P. reichenowi AMA1 sequence (accession no. AJ252087; Kocken et al., 2000) as an out-group using DnaSP version 5.10.01 (Librado and Rozas, 2009). This test compares the different ratios of dS and dN mutations within and among species (McDonald and Kreitman, 1991). Under neutrality, the ratio of non-synonymous/synonynous mutations between species should be the same as within species. However, when this ratio is greater between species than within species, it is assumed that the population is under a positive natural selection. The two-tailed Fisher’s exact test is computed to determine whether the deviations on the ratio of non-synonymous/synonymous between and within species are significant or not. Furthermore, the neutrality index (NI) was calculated by the formula NI = DsPn/DnPs (Rand and Kann, 1996), where Dn and Ds are the numbers of non-synonymous and synonymous substitutions between species, respectively and Pn and Ps are the numbers of non-synonymous and synonymous polymorphisms within P. falciparum species, respectively. Under neutrality, NI is 1, whereas NI > 1 shows positive selection and NI < 1 signifies negative selection. The genetic differentiation among the parasite populations was calculated in terms of the fixation index (Fst) that estimates diversity within a subpopulation with respect to total genetic diversity. This calculation was done based on the published pfama1 sequences in GenBank covering amino acids 147–552. The genetic difference among the parasite populations from Iran (the present study), India (EF543164–EF543176, Rajesh et al., 2008), Thailand (AJ494866–AJ494915, Polley et al., 2003), Venezuela (EU332414– EU332443, Ord et al., 2008), Kenya (FN869569–FN869697, Osier et al., 2010), Nigeria (AJ408300–AJ408350, Polley and Conway, 2001), Mali (FJ898536–FJ899041, Takala et al., 2009), Gambia (FJ555752–FJ555865, Tetteh et al., 2009) and Benin (AJ271168– AJ271190, Kocken et al., 2000) were estimated using the DnaSP package version 5.10.01 (Librado and Rozas, 2009). The Fst values at each locus are considered as no differentiation (0), low genetic

53

differentiation (0 > 0.05), moderate differentiation (0.05–0.15) and great differentiation (0.15–0.25) (Balloux and Lugon-Moulin, 2002). Finally, phylogenetic analysis was performed by the neighbor-joining method with Kimura 2-parameter distance matrix (Kimura, 1980) using MEGA software version 4.0.2. To assess whether the SNPs of PfAMA1 are involved in immunodominant determinants of this antigen, the potential B-cell epitopes of this protein were identified by using the ABCpred server (www.imtech.res.in/raghava/abcpred). Furthermore, prediction of intrinsically unstructured/disordered regions (IUR) was done by using the regional order neural network (RONN) server (http:// www.strubi.ox.ac.uk/RONN). 3. Results 3.1. Molecular analysis of P. falciparum ama1 gene The pfama1 gene was successfully amplified from the extracted DNA of all 66 P. falciparum-infected blood samples and a 1600-bp band was visualized on agarose gel. Based on the quality of the PCR products, 35 out of 66 samples were subjected to sequencing analysis. We found 10 samples had mixed genotypes and four other samples showed noises in the sequencing results. All these 14 samples were excluded from further analysis; hence, the full-length of the pfama1 gene was sequenced in 21 isolates covering amino acids 56–600 with entire ectodomain. Comparison of the sequences with the 3D7 sequence at the nucleotide level showed that point mutations occur at 43 positions (including one synonymous and 42 non-synonymous mutations). Of these 43 mutations, 20 occurred at the first base of the codon, 15 at the second and 8 at the third bases of the codon, resulting in 48 amino acid changes in the protein (Table 1). Two trimorphic (E187K/N and R503N/H) and two tetramorphic (H200L/D/R and 197D/H/Q/G) sites were identified among the studied isolates, whereas the rest of the sites were dimorphic. Based on amino acid alignment in compare with the 3D7 PfAMA1 sequence, 11 haplotypes were identified with different frequencies (Table 1) and Hd was 0.905 ± 0.047 in the studied isolates. The most frequent haplotype was PfAMA1-A (28.6%) among the examined isolates. Interestingly, PfAMA1-B, -C, -E, -G, -H, -I and -J haplotypes were isolated only from individuals with a travel history to Pakistan one month prior to sampling. However, PfAMA1-F and PfAMA1-K haplotypes were isolated only from individuals with no travel history. 3.2. Population genetic analysis, selection evidences and recombination in pfama1 gene The overall nucleotide diversity (p) in the studied isolates was 0.01008 ± 0.00056, ranging from 0 to 0.04886. Nucleotide diversity at DI, DII and DIII of PfAMA1 among the examined P. falciparum isolates was 0.01624 ± 0.00099, 0.0048 ± 0.00056 and 0.0099 ± 0.00091, respectively (Table 2). The highest nucleotide diversity of the PfAMA1 protein was found in DI, while the minimum diversity was determined in DII of the pfama1 gene (Fig. 1). The average number of pairwise nucleotide differences (K) was 16.495. The majority of SNPs were determined in DI (27 SNPs, almost 4.35 SNP per 100 bp, Table 2), but 6 and 8 SNPs were found in DII (1.45 SNP per 100 bp) and DIII (2.61 SNP per 100 bp) of the sequenced pfama1 genes in the examined isolates, respectively. The nucleotides 516–690 (amino acids 172–230) of Iranian pfama1 gene showed maximum diversity in DI (Fig. 1). To determine whether natural selection contributes to the diversity in DI, DII and DIII of the pfama1 gene, the dN–dS was evaluated and the results showed that the dN–dS was positive

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61

(>1) in the entire gene (0.01269) as well as in DI, DII and DIII of the pfama1 gene (Table 2), suggesting that this part of the gene is under positive selection. Furthermore, the Tajima’s D as well as Fu and Li’s F⁄ and D⁄ statistics were found to be positive in the entire and also in DI, DII and DIII of the pfama1 gene, indicating a balancing selection (Table 2). However, the neutrality test conducted between species using the McDonald–Kreitman test showed a significant departure from neutrality in the entire gene and also in DI and DII but not in DIII (P < 0.05, Table 3). The minimum number of recombination events (Rm) in Iranian pfama1 was 10 between adjacent polymorphic sites, while the values of recombination parameters (R) were 0.0225 between adjacent sites. In addition, the Rm value was 7 and 1 in DI and DIII, respectively, while no recombination site was detected in DII (Table 2). Based on the LD analysis, 286 (out of 903), 104 (out of 325), 4 (out of 15) and 11 (out of 28) pairwise comparisons were found to have significant R2 values (P < 0.05 by Chi-square test) in the entire gene, DI, DII and DIII, respectively (Fig. 2). Together, the values of Rm and the decline of LD index (R2) with an increasing distance between the pairs of nucleotide sites across the entire 1636 bp region indicates that intragenic recombination may occur within Iranian P. falciparum isolates. The values of R and LD indicate that high meiotic recombination may occur between the sites, resulting in genetic diversity in the Iranian pfama1 gene, particularly in DI (Table 2, Fig. 2).

The mutations in trimorphic and tetramorphic sites are shown with shadow. Dots show no mutation in corresponding site.

Table 1 Haplotype frequency and amino acid sequence alignment of the coding region of the PfAMA1 (aa: 56–600) in comparison with 3D7 strain (XM_0013477979) from 21 Iranian isolates using the Clustal W program.

54

3.3. Comparison of the pfama1 gene of isolates in the present study with those in other endemic areas Comparison of the SNPs frequency of the isolates in the present study with those in different endemic regions revealed that all observed SNPs in the Iranian isolates have been previously reported from different endemic areas of the world. However, the frequency of mutations in many mutation sites is different from previously reported sequences in other endemic regions (P < 0.05, data not shown). Furthermore, sliding window of nucleotide diversity of the pfama1 in the present study was resembled to Thai, Kenyan, Nigerian, Mali, Gambian, Benin and Venezuelan but not to Indian PfAMA1 (Fig. 1). Fst values of different populations having fulllength ectodomain sequences in GenBank were evaluated using DnaSP software. The results showed a significant difference among Iranian P. falciparum populations with Indian, Kenyan, Nigerian, Gambian, Benin and Venezuelan (P < 0.05) but not with Thai and Mali isolates (P > 0.05, Table 4).

3.4. Phylogenetic analysis of PfAMA1 A phylogenetic tree was used to analyze the association of pfama1 sequence (aa: 97–544) of Iranian isolates with other isolates from different endemic regions in the world. The 11 Iranian haplotypes were distributed among different isolates worldwide. The PfAMA1-A, -I, -J and -K haplotypes were close related to P. falciparum isolates from Africa (Nigeria, Gambia, Mali and Kenya); however, PfAMA1-E, -G and -H were related to Indian haplotypes. Interestingly, the haplotype PfAMA1-D was identical to the Indian isolate (accession number EF543174; aa: 97–544) as confirmed with blast and located in the same clade with PfAMA1-E (Fig. 3). In addition, PfAMA1-B and PfAMA1-C were close related to Benin and Venezuelan P. falciparum isolates. However, the distances of PfAMA1-D, -E and -F with African, Asian and South American PfAMA1 had a range of 0.0105–0.0195, 0.0097–0.0188 and 0.0082–0.0203, respectively.

0.01269 0.02061 0.00602 0.01252

⁄Amino acids 56–600 of 622 amino acids of PfAMA1 protein was included in this study DI: Domain I codons 97–302; DII: Domain II codons 303–439; DIII: Domain III codons 440–544; S: number of segregating sites; Eta: total no. of mutations; H = Haplotype; Hd = Haploype diversity; K = Average number of pair-wise nucleotide differences (K); p = nucleotide diversity; Rm = minimum number of recombination events; R = estimation of recombination between adjacent sites; D (Ti): tajimas’ D value; D⁄ (F&L): Fu and Li’s D⁄ value; F⁄ (Fu&Li’s): Fu and Li’s F⁄ value; dS = the number of synonymous substitutions per synonymous sites; dN = the number of non-synonymous substitutions per non-synonymous sites; SD = Standard deviation; SE = Standard error.

dN ± SE

0.01278 ± 0.00038 0.02083 ± 0.000638 0.00602 ± 0.000302 0.01252 ± 0.008274 0.00009 ± 0.0000241 0.00022 ± 0.000062 0 0

dS ± SE

1.06617 1.24803 0.53367 0.19214 Entire gene⁄ DI DII DIII

44 27 6 8

45 28 6 8

11 10 6 7

0.905 ± 0.047 0.895 ± 0.046 0.776 ± 0.060 0.852 ± 0.042

16.49524 10.085 1.9714 3.0095

0.01008 ± 0.00056 0.01624 ± 0.00099 0.0048 ± 0.00056 0.0099 ± 0.00091

10 (0.0225) 7 (0.0655) 0 (0.0515) 1 (0.0523)

1.26404 1.1412 0.57202 1.17507

F⁄ (Fu&Li’s) D⁄ (F&L) D(Tj)

Neutrality tests Rm (R)

p ± SD K Hd ± SD H Eta S

Table 2 Result of the nucleotide diversity and tests of neutrality at the ectodomain of Irainan PfAMA1.

1.31469 1.41801 0.6297 0.54971

dN-dS

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61

55

3.5. Analysis of the PfAMA1 structure and antigenicity To evaluate the antigenic diversity of PfAMA1 in B-cell epitopes of the PfAMA1 protein, the epitopes were predicted by using ABCpred server and amino acid substitutions were analyzed among the examined Iranian PfAMA1. The results showed that all of SNPs except Y175D, E187K/N, K206E, Y207D, I282K, S283L, Q285E, I435N, N439H, D448 N, K544N, E581K and D584H were involved in predicted B-cell epitopes (Fig. 4). Additionally, the IURs were predicted and the SNPs I97N, I225N, K230E, E267Q, M451K, E581Q and D584H were detected in these regions. Many residues of IURs were overlapped with B-cell epitopes, except the IUR at residues 573–600 (Fig. 4). Furthermore, the regions involved in RBC-binding (aa: 134–153, 174–193, 194–213, 294–313, 314–333, 374–393 and 434–453) were analyzed for SNPs and Y175D, E187 K/N, M190I, D196 N, E197D/H/Q/G, H200L/D/R, F201L, D204N, K206E, Y207D, D296H, K300E, Q308E, P330S, I332N, I435N, N439H, D448N and M451K were found in RBC-binding regions (Fig. 4) Interestingly, two of the identified polymorphic sites (H200L/D/R and E197D/ H/Q/G) were located in C1-L covering amino acids 196–207 in the PfAMA1 protein near the hydrophobic pocket (Fig. 4). Remarkably, no SNPs were found in loop II of PfAMA1 as the target of 4G2 inhibitory antibody in the studied samples (Fig. 4). Besides, some of the amino acid changes (T167K, M190I, D196N, E197H/G, H200D, D204N, K243N, D296H, K300E and K395R) in RBC-binding sites, C1-L and B-cell epitopes were only detected in P. falciparum parasites isolated from individuals with travel history to Pakistan one month prior sampling.

4. Discussion Vaccines could be a crucial component of any effort to eliminate and eventually eradicate malaria, particularly in the light of increasing drug resistance (Dondorp et al., 2011) and the declining efficacy of vector control interventions (Trape et al., 2011). More than 70 P. falciparum vaccine candidates are currently under development and 23 of them are undergoing clinical testing; however, no vaccine has provided a long-lasting immune response yet (Wykes and Good, 2007). One of the most promising antigens for a malaria blood-stage vaccine is the AMA1 due to the efficacy observed after challenges in animal models (Stowers et al., 2002; Herrera et al., 2007; Dutta et al., 2009). However, one of the main obstacles reported in vaccine development is the genetic diversity of AMA1 that might interfere with vaccine development (Girard et al., 2007; Genton and Reed, 2007). In this regard, vaccination with multivalent PfAMA1 that cover most of the amino acid variability observed in PfAMA1increases the levels of antibodies to common allele epitopes and induce broader functional immunity (Miura et al., 2007; Dutta et al., 2007; Remarque et al., 2008; Kusi et al., 2009; Biswas et al., 2011 Kusi et al., 2011). Therefore, in the present study, the gene sequence encoding the AMA1, from 21 P. falciparum isolates collected from a malaria endemic region in southeastern Iran, were analyzed. In this study, sequence analysis of Iranian pfama1 gene (n = 21) revealed 11 different haplotypes that was lower than those reported from India (13 haplotypes in 13 isolates, Rajesh et al., 2008), Benin (23 haplotypes in 23 isolates, Kocken et al., 2000), Nigeria (45 haplotypes in 49 samples, Polley and Conway, 2001), Thailand (27 haplotypes in 50 isolates, Polley et al., 2003) and Kenya (78 haplotypes in 129 isolates, Osier et al., 2010) but not from Venezuela (6 haplotypes in 30 isolates, Ord et al., 2008) and Mali (214 haplotypes in 506 isolates, Takala et al., 2009). The lower haplotype diversity in the present investigation could be explained by lower transmission intensity in the study area as reported previously (Hoffmann et al., 2001; Schoepflin et al., 2009).

56

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61

Fig. 1. The Comparison of sliding window plot of nucleotide diversity (p) based on nucleotide sequences of Iranian pfama1 gene with other P. falciparum populations from different malaria endemic regions, including India (Rajesh et al., 2008), Thailand (Polley et al., 2003), Venezuela (Ord et al., 2008), Gambia (Tetteh et al., 2009), Mali (Takala et al., 2009), Nigeria (Polley and Conway, 2001), Kenya (Osier et al., 2010) and Benin (Kocken et al., 2000). A window size of 100 bp with a step size of 25 bp was used for the analysis using DnaSP software. Nucleotide acids 444–1662 (based on 3D7 strain, accession no. XM_001347979) were included for this analysis and the maximum diversity was observed between the nucleotide positions 516 and 690 bp.

Furthermore, GenBank BLAST search was performed for each haplotype and revealed that 9 of 11 haplotypes were novel, while two of them (PfAMA1-B and PfAMA1-G haplotypes) had been previously reported from India (accession nos. AY016428 and AY016434, respectively; Escalante et al., 2001). Since both of these haplotypes were isolated from individuals with a travel history to Pakistan one month prior the sampling, it could be concluded that these isolates had been introduced through India to Pakistan and then to Iran. Besides, the highest prevalent haplotype (PfAMA1-A, 28.6%) with 8 other novel haplotypes in the present investigation have been isolated from patients with a travel history to Pakistan. This result suggests that the circulating parasites among Iran and its neighboring countries, Pakistan and Afghanistan, could be exchanged through human migrations. Therefore, it desired to design common effective malaria control tools such as vaccine for these countries to eliminate malaria from this western extension of the oriental region. However, the present data also revealed the diversity in prevalence of pfama1 alleles among parasites from southwest Asia (the present study), Far East, Africa, and South America. This difference suggests that the efficacy of the AMA1-based vaccine might also vary by geographic location that, in fact, needs to be considered in the development of a universal AMA1-based vaccine.

All of the sequence diversities in the gene encoding AMA1 is in the form of SNPs, which are thought to be maintained by balancing selection (Verra and Hughes, 2000; Polley and Conway, 2001; Polley et al., 2003; Cortés et al., 2003; Garg et al., 2007). These polymorphisms are located predominantly on one face of the AMA1 protein with the most polymorphic residues concentrated near a hydrophobic trough in DI that is hypothesized to be a binding site between AMA1 and associated ligand for erythrocyte invasion (Bai et al., 2005). Among Iranian PfAMA1, all detected SNPs (n = 43) had been reported previously, but their frequencies were significantly lower than PfAMA1 from India (n = 130, Rajesh et al., 2008), Kenya (n = 78, Osier et al., 2010), Nigeria (n = 62, Polley and Conway, 2001), Mali (n = 62, Takala et al., 2009) and Thailand (n = 51, Polley et al., 2003). The limited diversity detected among Iranian PfAMA1 was in agreement with our expectation for the P. falciparum population from areas with low-level than high-level transmission. Moreover, the majority of SNPs were determined in DI of PfAMA1 that is in agreement with previous reports from Thailand (Polley et al., 2003), Venezuela (Ord et al., 2008), Kenya (Osier et al., 2010), Nigeria (Polley and Conway, 2001), Mali (Takala et al., 2009), Gambia (Tetteh et al., 2009) and Benin (Kocken et al., 2000). In contrast, in the study conducted in

Table 3 McDonald and Kreitman analysis of AMA1 in Iranian P. falciparum isolates. Region

Entire genea DI DII DIII ⁄

Polymorphic changes within P. falciparum

Fixed differences between species

Synonymous (Ps)

Non-synonymous (Pn)

Synonymous (Ds)

Nonsynonymous (Dn)

0 0 0 0

39 22 6 8

16 6 5 2

37 9 4 6

Neutrality index

Fisher’s exact test

– – – –

0.000051⁄⁄⁄ 0.002153⁄⁄ 0.043956⁄ 0.466666

P < 0.05, ⁄⁄P < 0.001, ⁄⁄⁄P < 0.0001 were considered significant; The P. reichenowi ama1 sequence (accession no. AJ252087; Kocken et al., 2000) was used as an out group for McDonald and Kreitman analysis. a amino acids 56–600 of 622 amino acids of PfAMA1 protein was included in this study.

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61

57

Fig. 2. Linkage disequilibrium (LD) index (R2) across Iranian pfama1 gene. The nucleotide acids 165–1800 of Iranian pfama1 gene (based on 3D7 strain, accession no. XM_001347979) were included for this study and the analysis was performed considering all polymorphic sites. The R2 values are plotted against the distance between nucleotides of almost the entire gene (nt: 165–1800), DI (nt: 239–906), DII (nt: 907–1317) and DIII (nt: 1318–1632) separately. The pairs of sites that show statistically significant LD (Chi-square test, P < 0.05) have been indicated as black circles. The R2 values decline with the increase in the nucleotide distance, indicating recombination events are taking place.

India by Rajesh et al. (2008), more SNPs were detected in DII of Indian PfAMA1. Although the reason for such a discrepancy between Indian isolates, reported by this group and with other independent studies from different global regions, is not obvious, but the sampling procedure and collection period as well as the level of endemicity might influence the result. In this study, the neutrality tests including dN-dS, Tajimid’s D, Fu and Li’s D⁄ and F⁄ showed positive selection as well as a departure from neutrality in the entire pfama1 gene and also ectodomain. The positive balancing selection in DI of PfAMA1 has been reported previously from various global isolates of P. falciparum (Kocken et al., 2000; Polley and Conway, 2001; Polley et al., 2003; Ord et al., 2008; Osier et al., 2010; Takala et al., 2009; Tetteh et al., 2009; Mardani et al., 2012). Furthermore, the results of the neutrality tests between species using McDonald-Kreitman showed positive selection in all domains of Iranian PfAMA1; how-

ever, this positive trend was not significant in DIII that supports the data obtained from the PfAMA1 analysis in Nigeria (Polley and Conway, 2001). In addition, significant positive/balancing selection in Iranian PfAMA1 indicates that amino acid replacements are usually favored in PfAMA1 presumably due to host immune pressure. Intragenic recombination and positive selection are two important factors responsible for gene evolution and genetic diversity of the pfama1 gene (Eisen et al., 1999). Also, the level of sexual outcrossing, population recombination rates and linkage disequilibrium are influenced by natural selection, the level of endemicity and transmission intensity of malaria (Mu et al., 2005). Moreover, endemicity was documented to have a negative correlation with the decline of linkage disequilibrium in the parasite populations (Anderson et al., 2000) and a positive correlation with the levels of population recombination (Mu et al., 2005). In this study, the predicted frequency of recombination within the studied

Table 4 Pairwise FST estimates for PfAMA1ectodomain.

Fst values are shown in the lower left quadrant and average number of pair-wise nucleotide differences between populations (K) are shown in the upper right quadrant. Fst, a measure of genetic differentiation between populations (range from 0 to +1). Stars show Fst values with P < 0.05.

58

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61

Fig. 3. A neighbor-joining tree was constructed by the MEGA 4 program based on the amino acid sequences (aa: 97–544 based on 3D7 strain, accession no. XM_001347979) of Iranian PfAMA1 protein (KC413989-KC413999) and published sequences from other malaria endemic regions. The distance matrix was prepared using the Kimura 2parameter evolutionary model. Alignment substitutions were considered for analysis, while gaps were ignored. The bootstrap values on the branches have been shown by the number of times in 1000 replications. Only bootstrap values above 50% have been shown. The scale bar represents a genetic distance. The new haplotypes are marked with asterisks.

population was relatively low (10 sites), which was significantly lower than African (Kocken et al., 2000; Polley and Conway, 2001; Polley et al., 2003; Takala et al., 2009; Osier et al., 2010;

Tetteh et al., 2009) and Asian (Polley et al., 2003; Rajesh et al., 2008), but higher than Venezuelan P. falciparum populations (Ord et al., 2008). This result suggests and supports the fact that the

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61

59

Fig. 4. The Location of detected SNPs in the present study in RBC-binding regions (Urquiza et al., 2000), the predicted B-cell epitopes (using ABCpred server) and the predicted IURs (using RONN server) in PfAMA1 protein sequence. The codons 56–600 of PfAMA1 protein were included in the analysis. Polymorphic residues in the Iranian pfama1 gene from the current study have been shown by a gray shadow. C1-L (cluster 1 of loop I, aa: 196–207) in DI and loop II (aa: 348–392) in DII have been shown with solid and dashed arrows, respectively. The cysteine residues have been shown in bold and underline. DI: domain I codons 97–302; DII: domain II codons 303–439; DIII: domain III codons 440–544. Dashed lines show the RBC-binding regions, while solid and double lines show predicted B-cell epitopes and IURs, respectively.

P. falciparum population from study areas with low and seasonal malaria endemic regions has a minimal opportunity for recombination that leads to a low level of PfAMA1 genetic diversity. Taking into account the presence of both P. falciparum and P. vivax in the study areas with more than 20% mixed infection detected by a molecular diagnostic tool (Zakeri et al., 2010), a genetic analysis of ama1 gene in both P. vivax and P. falciparum from the same study areas was carried out (the present study; Zakeri et al., 2013). Of 37 pvama1 sequences obtained (Zakeri et al., 2013), there were 29 unique haplotypes compared to the 11 haplotypes from 21 pfama1 sequences. The overall diversity estimates for pvama1 and pfama1 (Hd = 0.982 and Hd = 0.905, respectively) revealed a higher diversity in the P. vivax population. This result was in concurrence with a similar study carried out in Venezuela with low transmission intensity (Ord et al., 2008). The majority of the diversity was observed among the ama1 sequences in DI of Iranian P. falciparum (the present study) and P. vivax (Zakeri et al., 2013) populations, which is in agreement with other similar studies from global malaria endemic regions (Cheng and Saul, 1994; Figtree et al., 2000; Kocken et al., 2000; Polley and Conway, 2001; Polley et al., 2003; Gunasekera et al., 2007; Ord et al., 2008; Takala et al., 2009; Tetteh et al., 2009; Osier et al., 2010; Moon et al., 2010). The pattern of polymorphisms detected in DI show a significant positive departure from neutrality. This finding suggests that DI is under biological functional controls and it is a target for host immune mechanisms that supports the development of a potential malaria vaccine based on DI of AMA1 against both P. vivax and P. falciparum. The degree of gene flow and genetic differentiation among the populations in this study was investigated by estimating Fst values, which measure the level of population subdivision. Considering the studied Iranian P. falciparum populations with those from different malaria endemic areas, the overall Fst value was found to be 0.118 indicating moderate levels of genetic differentiation; however, the Fst values between Iranian and Venezuelan populations (0.34244) showed evidence for strong population subdivision. In addition, Fst values for Iranian P. falciparum in comparison with other different geographical populations (India, Kenya, Mali, Gambia, Thailand, Nigeria, and Benin, Fst values ranging from 0.05839 to 0.14348) showed moderate levels of genetic differentiation. In addition, the phylogenetic analysis of the sequences revealed that only PfAMA1-D and PfAMA1-E alleles were shared by Indian allele, but the remaining alleles were shared by more than one geographical area. This finding suggests that those two alleles might be regional specific alleles. Therefore, the data on

phylogeny and Fst values indicated a moderate level of genetic differentiation among Iranian P. falciparum populations with other Asian and African populations. Apart from population analysis, the selection of a particular antigenic and immunogenic epitope that elicits protective antibodies after immunization would provide an easy strategic approach to overcome the hurdles observed in vaccine development. Therefore, in this regard, defining sequence polymorphisms in the target antigen is very critical for antibody binding. A previous study establishing the epitope recognition by the invasion-inhibitory monoclonal antibody 4G2 specific for PfAMA1 has demonstrated the importance of not only conformational epitopes but also a particular disordered region with no electron density between residues 348 and 389 (equivalent to residues 293 to 334 in PvAMA1/ DII loop) during parasite invasion (Pizarro et al., 2005). The high degree of amino acid sequence conservation in the DII loop in both P. falciparum and P. vivax AMA1 across the global isolates (the present study; Zakeri et al., 2013; Polley and Conway, 2001; Chesne-Seck et al., 2005; Gunasekera et al., 2007; Putaporntip et al., 2009) suggested that this region in both Plasmodium species might be an important antigenic region in DII of AMA1. The report by Bueno et al. (2011) supports this suggestion for DII of PvAMA1; however, the real contribution of the antibody response against the DII loop of PfAMA1 remains to be addressed. In addition, the highly polymorphic residues (positions: 187, 197, 200, 230 and 243; Bai et al., 2005) were also polymorphic among Iranian PfAMA1; however, most of SNPs in non-polymorphic residues (positions: 121, 325, 393 and 395) were conserved except the residue at position 395. Interestingly, many of the amino acid substitutions at positions M190I, D196N, E197D/H/Q/G, H200L/D/R, F201L, D204N, D296H, K300E, Q308E, P330S, I332N and M451K among Iranian isolates were found in the B-cell epitopes shared with RBC-binding regions, indicating a mechanism to evade from protective inhibitory antibodies. In fact, the findings of a recent in vitro study (Dutta et al., 2007) showed that residues within the C1-L cluster of DI had the greatest effect on antigenic escape, as inhibitory monoclonal antibody 1F9 showed that mutations at positions E197, H200, F201 and D204 in C1-L avoid binding of this antibody (Coley et al., 2006, 2007). The E197 was found as the most polymorphic residue among Iranian PfAMA1, but it is less polymorphic than the African PfAMA1 (Kocken et al., 2000; Polley and Conway, 2001; Takala et al., 2009; Tetteh et al., 2009; Osier et al., 2010). Interestingly, in all analyzed samples at residue 201 of PfAMA1, we found either leucine or phenylalanine but not valine. These substitutions might abrogate the binding of

60

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61

1F9 monoclonal antibody to PfAMA1 (Coley et al., 2007) as a result of ability of the parasite to invade immune recognition. Therefore, molecular analysis of these residues within DI C1-L may be useful to evaluate its inclusion in a polyvalent AMA1-based vaccine. Nevertheless, no mutation was found in the DII loop of Iranian PfAMA1 (recognized with inhibitory monoclonal antibody 4G2; Collins et al., 2007), indicating that it is subjected to a purifying selection that might also be used as a component of a PfAMA1-based vaccine. The present result is in agreement with that reported from Nigerian PfAMA1 (Polley and Conway, 2001). However, uncommon amino acid substitutions have been reported in PfAMA1 from India, Thailand, Kenya, Mali, Gambia, Venezuela and Benin (Rajesh et al., 2008; Kocken et al., 2000; Polley et al., 2003; Ord et al., 2008; Takala et al., 2009; Tetteh et al., 2009; Osier et al., 2010), in which the role of these substitutions in the binding activity to monoclonal antibody 4G2 remains to be determined. In conclusion, we report here the low genetic diversity of PfAMA1 among Iranian isolates with 11 haplotypes that nine of them were novel and not reported previously. Most of the polymorphic sites identified among Iranian isolates are located on the surface of the protein, which imply increased exposure to the human immune system. Considering PfAMA1 as one of the most promising vaccine candidate antigens, our data provides valuable information for the development of a PfAMA1-based malaria vaccine. Acknowledgements We are grateful for the hospitality and generous collaboration of Zahedan University of Medical Sciences, and the staff of the Public Health Department, Sistan and Baluchistan province, especially in Chabahar district, for their assistance in collecting blood samples from the field. The authors also would like to thank to Mrs. M. Saffari for English editing of the manuscript. This investigation received a financial support from Pasteur Institute of Iran. References Alonso, P.L., Brown, G., Arevalo-Herrera, M., Binka, F., Chitnis, C., Collins, F., Doumbo, O.K., Greenwood, B., Hall, B.F., Levine, M.M., Mendis, K., Newman, R.D., Plowe, C.V., Rodríguez, M.H., Sinden, R., Slutsker, L., Tanner, M., 2011. A research agenda to underpin malaria eradication. PLoS. Med. 8, e1000406. Anderson, T.J., Haubold, B., Williams, J.T., Estrada-Franco, J.G., Richardson, L., Mollinedo, R., Bockarie, M., Mokili, J., Mharakurwa, S., French, N., Whitworth, J., Velez, I.D.A., Brockman, H., Nosten, F., Ferreira, M.U., Day, K.P., 2000. Microsatellite markers reveal a spectrum of population structures in the malaria parasite Plasmodium falciparum. Mol. Biol. Evol. 17, 1467–1482. Anstey, N.M., Russell, B., Yeo, T.W., Price, R.N., 2009. The pathophysiology of vivax malaria. Trends Parasitol. 25, 220–227. Bai, T., Becker, M., Gupta, A., Strike, P., Murphy, V.J., Anders, R.F., Batchelor, A.H., 2005. Structure of AMA1 from Plasmodium falciparum reveals a clustering of polymorphisms that surround a conserved hydrophobic pocket. Proc. Natl. Acad. Sci. USA 102, 12736–12741. Balloux, F., Lugon-Moulin, N., 2002. The estimation of population differentiation with microsatellite markers. Mol. Ecol. 11, 155–165. Biswas, S., Dicks, M.D.J., Long, C.A., Remarque, E.J., Siani, L., et al., 2011. Transgene Optimization, Immunogenicity and in vitro Efficacy of Viral Vectored Vaccines Expressing Two Alleles of Plasmodium falciparum AMA1. PLoS One 6 (6), e20977. http://dx.doi.org/10.1371/journal.pone.0020977. Bueno, L.L., Lobo, F.P., Morais, C.G., Mourão, L.C., de Ávila, R.A., Soares, I.S., Fontes, C.J., Lacerda, M.V., Chavez Olórtegui, C., Bartholomeu, D.C., Fujiwara, R.T., Braga, E.M., 2011. Identification of a highly antigenic linear B cell epitope within Plasmodium vivax apical membrane antigen 1 (AMA-1). PLoS One 6, e21289. Cheng, Q., Saul, A., 1994. Sequence analysis of the apical membrane antigen I (AMA1) of Plasmodium vivax. Mol. Biochem. Parasitol. 65, 183–187. Chesne-Seck, M.L., Pizarro, J.C., Vulliez-Le Normand, B., Collins, C.R., Blackman, M.J., Faber, B.W., Remarque, E.J., Kocken, C.H., Thomas, A.W., Bentley, G.A., 2005. Structural comparison of apical membrane antigen1 orthologues and paralogues in apicomplexan parasites. Mol. Biochem. Parasitol. 144, 55–67. Coley, A.M., Campanale, N.V., Casey, J.L., Hodder, A.N., Crewther, P.E., Anders, R.F., Tilley, L.M., Foley, M., 2001. Rapid and precise epitope mapping of monoclonal antibodies against Plasmodium falciparum AMA1 by combined phage display of fragments and random peptides. Protein Eng. 14, 691–698. Coley, A.M., Parisi, K., Masciantonio, R., Hoeck, J., Casey, J.L., Murphy, V.J., Harris, K.S., Batchelor, A.H., Anders, R.F., Foley, M., 2006. The most polymorphic residue on

Plasmodium falciparum apical membrane antigen 1 determines binding of an invasion-inhibitory antibody. Infect. Immun. 74, 2628–2636. Coley, A.M., Gupta, A., Murphy, V.J., Bai, T., Kim, H., Foley, M., Anders, R.F., Batchelor, A.H., 2007. Structure of the malaria antigen AMA1 in complex with a growthinhibitory antibody. PLoS Pathog. 3, 1308–1319. Collins, C.R., Withers-Martinez, C., Bentley, G.A., Batchelor, A.H., Thomas, A.W., Blackman, M.J., 2007. Fine mapping of an epitope recognized by an invasioninhibitory monoclonal antibody on the malaria vaccine candidate apical membrane antigen1. J. Biol. Chem. 282, 7431–7441. Cortés, A., Mellombo, M., Mueller, I., Benet, A., Reeder, J.C., Anders, R.F., 2003. Geographical structure of diversity and differences between symptomatic and asymptomatic infections for Plasmodium falciparum vaccine candidate AMA1. Infect. Immun. 71, 1416–1426. Crewther, P.E., Matthew, M.L., Flegg, R.H., Anders, R.F., 1996. Protective immune responses to apical membrane antigen 1 of Plasmodium chabaudi involve recognition of strain-specific epitopes. Infect. Immun. 64, 3310–3317. Dondorp, A.M., Fairhurst, R.M., Slutsker, L., Macarthur, J.R., Breman, J.G., Guerin, P.J., Wellems, T.E., Ringwald, P., Newman, R.D., Plowe, C.V., 2011. The threat of artemisinin-resistant malaria. N. Engl. J. Med. 365, 1073–1075. Dutta, S., Lee, S.Y., Batchelor, A.H., Lanar, D.E., 2007. Structural basis of antigenic escape of a malaria vaccine candidate. Proc. Natl. Acad. Sci. USA 104, 12488– 12493. Dutta, S., Sullivan, J.S., Grady, K.K., Haynes, J.D., Komisar, J., Batchelor, A.H., Soisson, L., Diggs, C.L., Heppner, D.G., Lanar, D.E., Collins, W.E., Barnwell, J.W., 2009. High antibody titer against apical membrane antigen-1 is required to protect against malaria in the Aotus model. PLoS One 4, e8138. Eisen, D.P., Marshall, V.M., Billman-Jacobe, H., Coppel, R.L., 1999. A Plasmodium falciparum apical membrane antigen-1 (AMA-1) gene apparently generated by intragenic recombination. Mol. Biochem. Parasitol. 100, 243–246. Escalante, A.A., Grebert, H.M., Chaiyaroj, S.C., Magris, M., Biswas, S., Nahlen, B.L., Lal, A.A., 2001. Polymorphism in the gene encoding the apical membrane antigen-1 (AMA-1) of Plasmodium falciparum. X. Asembo Bay Cohort project. Mol. Biochem. Parasitol. 113, 279–287. Feng, Z.P., Keizer, D.W., Stevenson, R.A., Yao, S., Babon, J.J., Murphy, V.J., Anders, R.F., Norton, R.S., 2005. Structure and inter-domain interactions of domain II from the blood-stage malarial protein, apical membrane antigen 1. J. Mol. Biol. 350, 641–656. Figtree, M., Pasay, C.J., Slade, R., Cheng, Q., Cloonan, N., Walker, J., Saul, A., 2000. Plasmodium vivax synonymous substitution frequencies, evolution and population structure deduced from diversity in AMA-1 and MSP-1 genes. Mol. Biochem. Parasitol. 108, 53–66. Fu, Y.X., Li, W.H., 1993. Statistical tests of neutrality of mutations. Genetics 133, 693–709. Garg, S., Alam, M.T., Das, M.K., Dev, V., Kumar, A., Dash, A.P., Sharma, Y.D., 2007. Sequence diversity and natural selection at domain I of the apical membrane antigen 1 among Indian Plasmodium falciparum populations. Malar. J. 22 (6), 154. Genton, B., Reed, Z.H., 2007. Asexual blood-stage malaria vaccine development: facing the challenges. Curr. Opin. Infect. Dis. 20, 467–475. Girard, M.P., Reed, Z.H., Friede, M., Kieny, M.P., 2007. A review of human vaccine research and development: malaria. Vaccine 25, 1567–1580. Gunasekera, A.M., Wickramarachchi, T., Neafsey, D.E., Ganguli, I., Perera, L., Premaratne, P.H., Hartl, D., Handunnetti, S.M., Udagama-Randeniya, P.V., Wirth, D.F., 2007. Genetic diversity and selection at the Plasmodium vivax apical membrane antigen-1 (PvAMA-1) locus in a Sri Lankan population. Mol. Biol. Evol. 24, 939–947. Healer, J., Murphy, V., Hodder, A.N., Masciantonio, R., Gemmill, A.W., Anders, R.F., Cowman, A.F., Batchelor, A., 2004. Allelic polymorphisms in apical membrane antigen-1 are responsible for evasion of antibody-mediated inhibition in Plasmodium falciparum. Mol. Microbiol. 52, 159–168. Herrera, S., Corradin, G., Arévalo-Herrera, M., 2007. An update on the search for a Plasmodium vivax vaccine. Trends Parasitol. 23, 122–128. Hodder, A.N., Crewther, P.E., Anders, R.F., 2001. Specificity of the protective antibody response to apical membrane antigen 1. Infect. Immun. 69, 3286– 3294. Hoffmann, E.H., da Silveira, L.A., Tonhosolo, R., Pereira, F.J., Ribeiro, W.L., Tonon, A.P., Kawamoto, F., Ferreira, M.U., 2001. Geographical patterns of allelic diversity in the Plasmodium falciparum malaria-vaccine candidate, merozoite surface protein-2. Ann. Trop. Med. Parasitol. 95, 117–132. Howell, S.A., Withers-Martinez, C., Kocken, C.H., Thomas, A.W., Blackman, M.J., 2001. Proteolytic processing and primary structure of Plasmodium falciparum apical membrane antigen-1. J. Biol. Chem. 276, 31311–31320. Igonet, S., Vulliez-Le Normand, B., Faure, G., Riottot, M.M., Kocken, C.H., Thomas, A.W., Bentley, G.A., 2007. Cross-reactivity studies of an anti-Plasmodium vivax apical membrane antigen 1 monoclonal antibody: binding and structural characterization. J. Mol. Biol. 366, 1523–1537. Jukes, T.H., Cantor, R.C., 1969. Evolution of protein molecules. In: Munro, H.N. (Ed.), Mammalian Protein Metabolism. Academic Press, New York, pp. 21–132. Kennedy, M.C., Wang, J., Zhang, Y., Miles, A.P., Chitsaz, F., Saul, A., Long, C.A., Miller, L.H., Stowers, A.W., 2002. In vitro studies with recombinant Plasmodium falciparum apical membrane antigen 1 (AMA1): production and activity of an AMA1 vaccine and generation of a multiallelic response. Infect. Immun. 70, 6948–6960. Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120.

A.A. Mehrizi et al. / Infection, Genetics and Evolution 17 (2013) 51–61 Kocken, C.H., van der Wel, A.M., Dubbeld, M.A., Narum, D.L., van de Rijke, F.M., van Gemert, G.J., van der Linde, X., Bannister, L.H., Janse, C., Waters, A.P., Thomas, A.W., 1998. Precisetiming of expression of a Plasmodium falciparum-derived transgene in Plasmodium berghei is a critical determinant of subsequent subcellular localization. J. Biol. Chem. 273, 15119–15124. Kocken, C.H., Narum1, D.L., Massougbodji, A., Ayivi, B., Dubbeld, M.A., van der Wel, A., Conway, D.J., Sanni, A., Thomas, A.W., 2000. Molecular characterization of Plasmodium reichenowi apical membrane antigen-1 (AMA-1), comparison with P. falciparum AMA-1, and antibody-mediated inhibition of red cell invasion. Mol. Biochem. Parasitol. 109, 147–156. Kusi, K.A., Faber, B.W., Thomas, A.W., Remarque, E.J., 2009. Humoral immune response to mixed PfAMA1 alleles; multivalent PfAMA1 vaccines induce broad specificity. PLoS One 4, e8110. Kusi, K.A., Remarque, E.J., Riasat, V., Walraven, V., Thomas, A.W., Faber, B.W., Kocken, C.H., 2011. Safety and immunogenicity of multi-antigen AMA1-based vaccines formulated with CoVaccine HT™ and Montanide ISA 51 in rhesus macaques. Malar. J. 4 (10), 182. Lalitha, P.V., Ware, L.A., Barbosa, A., Dutta, S., Moch, J.K., Haynes, J.D., Fileta, B.B., White, C.E., Lanar, D.E., 2004. Production of the subdomains of the Plasmodium falciparum apical membrane antigen 1ectodomain and analysis of the immune response. Infect. Immun. 72, 4464–4470. Langermans, J.A., Hensmann, M., van Gijlswiik, M., Zhang, D., Pan, W., Giersing, B.K., Locke, E., Dubovsk, F., Wittes, J., Thomas, A.W., 2006. Preclinical evaluation of a chimeric malaria vaccine candidate in Montanide ISA 720: immunogenicity and safety in rhesus macaques. Hum. Vaccin. 2, 222–226. Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25, 1451–1452. malERA Consultative Group on Vaccines, 2011. A research agenda for malaria eradication: vaccines. PLoS Med. 8, e1000398. Malkin, E.M., Diemert, D.J., McArthur, J.H., Perreault, J.R., Miles, A.P., Giersing, B.K., Mullen, G.E., Orcutt, A., Muratova, O., Awkal, M., Zhou, H., Wang, J., Stowers, A., Long, C.A., Mahanty, S., Miller, L.H., Saul, A., Durbin, A.P., 2005. Phase 1 clinical trial of apical membrane antigen 1: an asexual blood-stage vaccine for Plasmodium falciparum malaria. Infect. Immun. 73, 3677–3685. Mardani, A., Keshavarz, H., Heidari, A., Hajjaran, H., Raeisi, A., Khorramizadeh, M.R., 2012. Genetic diversity and natural selection at the domain I of apical membrane antigen-1 (AMA-1) of Plasmodium falciparum in isolates from Iran. Exp. Parasitol. 130, 456–462. McDonald, J.H., Kreitman, M., 1991. Adaptive protein evolution at the Adh locus in Drosophila. Nature 351, 652–654. Miao, J., Li, X., Liu, Z., Xue, C., Bujard, H., Cui, L., 2006. Immune responses in mice induced by prime-boost schemes of the Plasmodium falciparum apical membrane antigen 1 (PfAMA1)-based DNA, protein and recombinant modified vaccinia Ankara vaccines. Vaccine 24, 6187–6198. Miura, K., Zhou, H., Muratova, O.V., Orcutt, A.C., Giersing, B., Miller, L.H., Long, C.A., 2007. In immunization with Plasmodium falciparum apical membrane antigen 1, the specificity of antibodies depends on the species immunized. Infect. Immun. 75, 5827–5836. Moon, S.U., Na, B.K., Kang, J.M., Kim, J.Y., Cho, S.H., Park, Y.K., Sohn, W.M., Lin, K., Kim, T.S., 2010. Genetic polymorphism and effect of natural selection at domain I of apical membrane antigen-1 (AMA-1) in Plasmodium vivax isolates from Myanmar. Acta. Trop. 114, 71–75. Mu, J., Awadalla, P., Duan, J., McGee, K.M., Joy, D.A., McVean, G.A., Su, X.Z., 2005. Recombination hotspots and population structure in Plasmodium falciparum. PLoS Biol. 3, e335. Nair, M., Hinds, M.G., Coley, A.M., Hodder, A.N., Foley, M., Anders, R.F., Norton, R.S., 2002. Structure of domain III of the blood-stage malaria vaccine candidate, Plasmodium falciparum apical membrane antigen 1 (AMA1). J. Mol. Biol. 322, 741–753. Nei, M., Gojobori, T., 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3, 418–426. Ord, R.L., Tami, A., Sutherland, C.J., 2008. Ama 1 genes of sympatric Plasmodium vivax and P falciparum from Venezuela differ significantly in genetic diversity and recombination frequency. PLoS One 3, e3366. Osier, F.H., Weedall, G.D., Verra, F., Murungi, L., Tetteh, K.K., Bull, P., Faber, B.W., Remarque, E., Thomas, A., Marsh, K., Conway, D.J., 2010. Allelic diversity and naturally acquired allele-specific antibody responses to Plasmodium falciparum apical membrane antigen 1 in Kenya. Infect. Immun. 8, 4625–4633. Peterson, M.G., Marshall, V.M., Smythe, J.A., Crewther, P.E., Lew, A., Silva, A., Anders, R.F., Kemp, D.J., 1989. Integral membrane protein located in the apical complex of Plasmodium falciparum. Mol. Cell. Biol. 9, 3151–3154. Pizarro, J.C., Vulliez-Le Normand, B., Chesne-Seck, M.L., Collins, C.R., WithersMartinez, C., Hackett, F., Blackman, M.J., Faber, B.W., Remarque, E.J., Kocken, C.H., Thomas, A.W., Bentley, G.A., 2005. Crystal structure of the malaria vaccine candidate apical membrane antigen 1. Science 308, 408–411. Polley, S.D., Conway, D.J., 2001. Strong diversifying selection on domains of the Plasmodium falciparum apical membrane antigen1 gene. Genetics 158, 1505– 1512.

61

Polley, S.D., Chokejindachai, W., Conway, D.J., 2003. Allele frequency-based analyses robustly map sequence site under balancing selection in a malaria vaccine candidate antigen. Genetics 165, 555–561. Putaporntip, C., Jongwutiwes, S., Grynberg, P., Cui, L., Hughes, A.L., 2009. Nucleotide sequence polymorphism at the apical membrane antigen-1 locus reveals population history of Plasmodium vivax in Thailand. Infect. Genet. Evol. 9, 1295–1300. Rajesh, V., Singamsetti, V.K., Vidya, S., Gowrishankar, M., Elamaran, M., Tripathi, J., Radhika, N.B., Kochar, D., Ranjan, A., Roy, S.K., Das, A., 2008. Plasmodium falciparum: genetic polymorphism in apical membrane antigen-1 gene from Indian isolates. Exp. Parasitol. 119, 144–151. Rand, D.M., Kann, L.M., 1996. Excess amino acid polymorphism in mitochondrial DNA: contrasts among genes from Drosophila, mice, and humans. Mol. Biol. Evol. 13, 735–748. Remarque, E.J., Faber, B.W., Kocken, C.H., Thomas, A.W., 2008. A diversity-covering approach to immunization with Plasmodium falciparum apical membrane antigen 1 induces broader allelic recognition and growth inhibition responses in rabbits. Infect. Immun. 76, 2660–2670. Saul, A., Lawrence, G., Allworth, A., Elliott, S., Anderson, K., Rzepczyk, C., Martin, L.B., Taylor, D., Eisen, D.P., Irving, D.O., Pye, D., Crewther, P.E., Hodder, A.N., Murphy, V.J., Anders, R.F., 2005. A human phase 1 vaccine clinical trial of the Plasmodium falciparum malaria vaccine candidate apical membrane antigen 1 in Montanide ISA720 adjuvant. Vaccine 23, 3076–3083. Schoepflin, S., Valsangiacomo, F., Lin, E., Kiniboro, B., Mueller, I., Felger, I., 2009. Comparison of Plasmodium falciparum allelic frequency distribution in different endemic settings by high-resolution genotyping. Malar. J. 8, 250. Snounou, G., Viriyakosol, S., Zhu, X.P., Jarra, W., Pinheiro, L., do Rosario, V.E., Thaithong, S., Brown, K.N., 1993. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol. Biochem. Parasitol. 61, 315–320. Stowers, A.W., Kennedy, M.C., Keegan, B.P., Saul, A., Long, C.A., Miller, L.H., 2002. Vaccination of monkeys with recombinant Plasmodium falciparum apical membrane antigen 1 confers protection against blood-stage malaria. Infect. Immun. 70, 6961–6967. Tajima, F., 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123, 585–595. Takala, S.L., Coulibaly, D., Thera, M.A., Batchelor, A.H., Cummings, M.P., Escalante, A.A., Ouattara, A., Traoré, K., Niangaly, A., Djimdé, A.A., Doumbo, O.K., Plowe, C.V., 2009. Extreme polymorphism in a vaccine antigen and risk of clinical malaria implications for vaccine development. Sci. Trans. Med. 1, 25. Tetteh, K.K., Stewart, L.B., Ochola, L.I., Amambua-Ngwa, A., Thomas, A.W., Marsh, K., Weedall, G.D., Conway, D.J., 2009. Prospective identification of malaria parasite genes under balancing selection. PLoS One 4, e5568. Trape, J.F., Tall, A., Diagne, N., Ndiath, O., Ly, A.B., Faye, J., Dieye-Ba, F., Roucher, C., Bouganali, C., Badiane, A., Sarr, F.D., Mazenot, C., Touré-Baldé, A., Raoult, D., Druilhe, P., Mercereau-Puijalon, O., Rogier, C., Sokhna, C., 2011. Malaria morbidity and pyrethroid resistance after the introduction of insecticidetreated bed nets and artemisinin-based combination therapies: a longitudinal study. Lancet Infect. Dis. 11, 925–932. Urquiza, M., Suarez, J.E., Cardenas, C., Lopez, R., Puentes, A., Chavez, F., Calvo, J.C., Patarroyo, M.E., 2000. Plasmodium falciparum AMA-1 erythrocyte binding peptide simplicate AMA-1 as erythrocyte binding protein. Vaccine 19, 508–513. Verra, F., Hughes, A.L., 2000. Evidence for ancient balanced polymorphism at the Apical Membrane Antigen-1 (AMA-1) locus of Plasmodium falciparum. Mol. Biochem. Parasitol. 105, 149–153. Volkman, S.K., Ndiaye, D., Diakite, M., Koita, O.A., Nwakanma, D., Daniels, R.F., Park, D.J., Neafsey, D.E., Muskavitch, M.A., Krogstad, D.J., Sabeti, P.C., Hartl, D.L., Wirth, D.F., 2012. Application of genomics to field investigations of malaria by the international centers of excellence for malaria research. Acta Trop. 121, 324– 332. Waters, A.P., Thomas, A.W., Deans, J.A., Mitchell, G.H., Hudson, D.E., Miller, L.H., McCutchan, T.F., Cohen, S., 1990. A merozoite receptor protein from Plasmodium knowlesi is highly conserved and distributed throughout Plasmodium. J. Biol. Chem. 265, 17974–17979. WHO report, 2012: . Wykes, M., Good, M.F., 2007. A case for whole-parasite malaria vaccines. Int. J. Parasitol. 37, 705–712. Zakeri, S., Kakar, Q., Ghasemi, F., Raeisi, A., Butt, W., Safi, N., Afsharpad, M., Memon, M.S., Gholizadeh, S., Salehi, M., Atta, H., Zamani, G., Djadid, N.D., 2010. Detection of mixed Plasmodium falciparum & P. vivax infections by nested-PCR in Pakistan, Iran & Afghanistan. Indian. J. Med. Res. 132, 31–35. Zakeri, S., Sadeghi, H., Mehrizi, A.A., Djadid, N.D., 2013. Population genetic structure and polymorphism analysis of gene encoding apical membrane antigen-1(AMA1) of Iranian Plasmodium vivax wild isolates. Acta Trop. 126, 269–279.