Population screening for hemochromatosis: a study in 5370 Spanish blood donors

Journal of Hepatology 38 (2003) 745–750 www.elsevier.com/locate/jhep

Population screening for hemochromatosis: a study in 5370 Spanish blood donors Mayka Sa´nchez 1,2, Margarita Villa 1, Mercedes Ingelmo 1, Cristina Sanz 3, Miquel Bruguera 4, Carlos Ascaso 5, Rafael Oliva 1,2,* 1

Human Genome Laboratory, Faculty of Medicine, University of Barcelona, Institut de Investigacions Biome`diques August Pi i Sunyer (IDIBAPS), Casanova 143, 08036 Barcelona, Spain 2 Genetics Service, IDIBAPS, Hospital Clı´nic and University of Barcelona, Villarroel 170, 08036 Barcelona, Spain 3 Service of Hemotherapy and Hemostasis, Hospital Clinic, Villarroel 170, 08036 Barcelona, Spain 4 Liver Unit, Institut Clı´nic de Malalties Digestives, IDIBAPS, Hospital Clı´nic and University of Barcelona, Villarroel 170, 08036 Barcelona, Spain 5 Biostatistical Unit, IDIBAPS, Faculty of Medicine, University of Barcelona, Casanova 143, 08036 Barcelona, Spain

Background/Aims: Hereditary hemochromatosis is associated with homozygosity for C282Y mutation in the HFE gene, elevated serum transferrin saturation and excess iron deposits throughout the body. We conducted a populationbased study in Spain to asses the prevalence of the HFE mutations and their effect on iron parameters. Methods: We screened 5370 blood donors for the C282Y and H63D HFE mutations by allele-specific polymerase chain reaction. Serum iron, serum ferritin and transferrin saturation were also measured. Results: We have found eight (five men and three women) blood donors who are C282Y homozygotes (0.15%) and 74 C282Y/H63D compound heterozygotes (1.38%). Four out of the eight C282Y homozygotes, all men, had high serum ferritin and transferrin saturation values. No woman was detected with both iron parameters increased. Only one of the 74 C282Y/H63D compound heterozygotes showed elevated serum ferritin and transferrin saturation values (penetrance 1.35%). Serum ferritin and transferrin saturation were significantly higher in C282Y homozygous men as compared with the rest of the genotypes. Conclusions: The C282Y/C282Y genotype frequency in Spain is 1 in 1004. The C282Y/C282Y genotype is clearly associated with an increase in iron parameters. Biochemical expression of the disease was found in 80% of the C282Y/ C282Y men. q 2003 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. Keywords: Hereditary hemochromatosis; Iron overload; HFE gene; C282Y; H63D

1. Introduction Hereditary hemochromatosis (HH) is a common autosomal recessive genetic disorder caused by an increase in intestinal iron absorption [1]. The progressive accumulation of iron in several organs such as liver, pancreas, heart and endocrine glands results in organ damage and even death if untreated [1]. If patients are diagnosed early in the course of the disease and treated by phlebotomy to remove the excess of iron, life expectancy is rescued [2]. Therefore, early diagReceived 10 May 2002; received in revised form 13 February 2003; accepted 17 February 2003 * Corresponding author. Tel.: 134-93-227-5510; fax: 134-93-227-5454. E-mail address: [email protected] (R. Oliva).

nosis and treatment of the disease is essential to prevent organ damage and to avoid the clinical manifestation of the disease. In 1996, two mutations in the HFE gene (C282Y and H63D) were identified as responsible for the disease [3]. The C282Y mutation has been found to be present in more than 90% of typical hemochromatosis patients in northern Europe [4]. The H63D mutation has been involved in the disease in a compound heterozygous state with the C282Y mutation, since this genotype has been found more frequently in hemochromatosis patients than in controls [3]. Therefore, the H63D mutation may contribute to increased hepatic iron levels but does not result in iron overload in the absence of the C282Y mutation. The

0168-8278/03/$30.00 q 2003 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. doi:10.1016/S0 168-8278(03)00 123-5

746

M. Sa´ nchez et al. / Journal of Hepatology 38 (2003) 745–750

H63D mutation is commonly present in the general population, with one of the highest frequencies reported in Spain. The allele frequency of this mutation ranges between 15.7 and 30.4% according to five studies performed in the Spanish population [5–9]. It has been described that the frequency of the C282Y mutation decreases from the north to the south of Europe [9]. In Italy the frequency of the C282Y mutation in HH patients has been reported to be the lowest among the European countries, accounting for only 64% of the HH patients [10]. In addition, in Italy other non-classical hereditary hemochromatosis diseases not linked with the HFE gene have been reported, suggesting that in this country the disease is more heterogeneous [11,12]. However, in Spain several studies show that most of the HH patients (81–90%) have the C282Y mutation in a homozygous state [5–7,13]. The diagnosis of HH has previously been based on the demonstration of iron overload in blood tests and liver biopsies, but with the discovery of HFE gene, the genetic screening has become an important diagnostic tool. Genetic diagnosis also prevents liver biopsy in those C282Y homozygous HH patients with less than 1000 mg/l of serum ferritin, normal aspartate aminotransferase value and absence of hepatomegaly, since these patients do not present liver fibrosis or cirrhosis [14]. Therefore, nowadays the screening strategies to detect early hemochromatosis include genetic testing for the C282Y and H63D HFE mutations and/or testing for iron overload by biochemical assays. In a previous pilot study we genetically screened the C282Y and H63D mutations in a total of 485 individuals from our population [5]. Based on this study we estimated that the C282Y/C282Y genotype in Spain was present in 1 out of every 1091 individuals. Only one C282Y homozygote was identified in this study, but it was not possible to carry out biochemical studies in this subject. The aim of the present study was to determine, in a larger Spanish population sample, the percentage of people carrying a genotype of risk (C282Y/C282Y or C282Y/H63D) with abnormal iron parameters (serum ferritin, transferrin saturation (TS) and serum iron) in order to propose them an early preventive treatment.

2. Material and methods 2.1. Subjects Volunteers blood donors (5370) from the Blood Bank of the Hospital Clinic of Barcelona were invited to participate in a screening study for hemochromatosis. This study was approved by the Human Ethics Committee of the hospital and the blood donors agreed to participate after informed consent. Blood samples were collected from June 2000 and for a period of 10 months. Donors were able to withdraw their consent for the testing at any time. All participants were informed of the genetic results and cases from which it was not possible to obtain a result for technical reasons were informed thanking their collaboration anyway.

2.2. Biochemical and genetic analyses Serum iron, serum ferritin and transferrin were measured by standard methods in all C282Y homozygotes and C282Y/H63D compound heterozygotes, as well as in groups of people presenting the rest of genotypes. Transferrin saturation (TS,%) was calculated as [serum iron ðmg=dlÞ £ 100]/ [serum transferring ðg=lÞ £ 1:4 [15]. Values greater than 150 mg/dl for serum iron, greater than 200 mg/l in women and 300 mg/l in men for serum ferritin, and above 50% threshold for TS were considered as pathologic. Blood cell DNA purification was carried out on 96-well plates following a modified protocol from Higuchi [16] and kindly provided by Dr. Larry E. Mobraaten (personal communication). The C282Y mutation was detected by allele-specific polymerase chain reaction PCR (AS-PCR) amplification using the following primers: C282YR1: CCACTGATGACTCCAATGACTA, C282Y-Rm: CCTGGGTGCTCCACCTGGT, C282Y-Fw: GGGAAGAGCAGAGATATACGTG and C282Y-F: TGGCAAGGGTAAACAGATCC. The H63D mutation was detected by an allele-specific PCR amplification using the following primers: 63Fw: AGCTGT TCGTGTTCTATGATC, HFE187Gas: CTCCACACGGCGACTCTCATC, HFEEx2U: GCTCCCCTCCTACTACACAT and HFEEx2L: GGTCCCTATTTCCACCATCC. The AS-PCR was performed at 62 8C, for 35 cycles. Genotypes of all C282Y homozygotes, C282Y/H63D compound heterozygotes and C282Y heterozygotes were confirmed by an independent DNA blood extraction (proteinase K) and multiple-PCR followed by restriction enzyme digestion as described by Stott and collaborators [17]. In this approach both mutations are amplified in one multiple PCR and digested by BbrPlI enzyme to detect the genotype. Both genotyping systems do not use the reverse primer for the C282Y mutation potentially implicated in genotyping errors [18]. PCR amplifications were separated in 3% agarose gels and visualized by ethidium bromide staining.

2.3. Statistics Allele frequencies are reported as the value ^ 95% confidence half-interval (CI). The prevalence of the genotypes has been estimated with ^95% CI assuming convergence of the binomial distribution to the normal. To evaluate differences in the biochemical variables between homozygotes and other genotypes we have used models of variance analysis which take into account the effect of gender and age. Variables not following a normal distribution (ferritin and age) have been transformed into logarithm. In cases where the effect of gender was not constant in all genotypes (interaction gender–genotype) the analysis of variance (ANOVA) analysis has been done stratifying by genera. Multiple comparisons have been performed with a Bonferroni correction. Statistical analyses have been done using the statistical package SPSS 10.1 with an alpha error of 0.05.

3. Results This study includes 5370 volunteer blood donors, 3467 men and 1903 women. The median age is 28 years (range 18–68 years). The results of the genotypes and the allele frequencies of C282Y and H63D mutations are shown in Table 1. We found eight homozygotes for the C282Y mutation (0.15%) and 74 compound heterozygotes for the C282Y and H63D mutations (1.38%). We did not find any individual in which the C282Y and H63D mutations occur on the same chromosome. According to these results, the C282Y allele frequency in the Spanish population is 3.16 ^ 0.46%, which predicts one C282Y homozygote in every 1004 individuals. The prevalence of the C282Y/C282Y genotype in our study is 1 in 671

M. Sa´ nchez et al. / Journal of Hepatology 38 (2003) 745–750

747

Table 1 HFE genotypes in 5370 Spanish blood donors a C282Y

H63D

1 /1 1 /2 1 /2 2 /2 2 /2 2 /2 Total

2 /2 1 /2 2 /2 1 /1 1 /2 2 /2

All

Women

N

%

^ CI

N

%

^ CI

N

%

^ CI

8 74 249 248 1664 3127 5370

0.15 1.38 4.64 4.62 30.99 58.23

0.10 0.31 0.56 0.56 1.23 1.31

5 44 171 168 1059 2020 3467

0.14 1.27 4.93 4.85 30.55 58.26

0.12 0.39 0.70 0.71 1.53 1.64

3 30 78 80 605 1107 1903

0.16 1.58 4.10 4.20 31.79 58.17

0.17 0.56 0.89 0.90 2.09 2.21

3.16 20.80

0.46 1.09

3.24 20.75

0.58 1.35

3.00 20.89

0.20 1.82

Allele frequency ^ 95% CI C282Y H63D a

Men

N, number of subjects tested. Genotypes: 1 indicates mutated allele, 2 indicates wild-type allele. ^CI indicates 95% confidence half-interval.

(eight out of 5370). The C282Y carrier frequency is 6.1% (one out of 16). The H63D allele frequency is 20.8 ^ 1.09%, predicting one H63D homozygote in every 23 individuals. The H63D carrier frequency is 32.9% (one out of three). The frequencies were not significantly different between men and women (Table 1). The iron parameters from the eight C282Y homozygotes (five men and three women) detected in this study are described in Table 2. None of the C282Y homozygous blood donors had symptoms of hemochromatosis at the time of the study. However, six of the eight had persistent TS $ 50% (four men and two women) and four (all men) had TS . 50% as well as elevated ferritin values (normal ferritin values ranging from 20 to 300 mg/l in men and 15 to 200 mg/l in women). Subject case numbers 2 and 5 have finished the first stage of phlebotomy treatment, 3740 mg of

iron being removed from each. These subjects will continue the maintenance phlebotomy treatment every 3 months. Subject number 7 has just started phlebotomy treatment, which has removed 2860 mg of iron until now. Interestingly, one C282Y homozygous man had low levels of serum ferritin (18 ng/ml) and TS (24%). None of the three C282Y homozygous women had serum ferritin values above normal (Table 2). The number of units of blood donated by C282Y homozygotes before their genetic diagnosis is also shown in Table 2. In C282Y homozygous men serum ferritin levels decrease as number of units of blood donations increase, except in case 3. This case 3 is a young male with low serum ferritin and TS values (18 ng/ml, 24%) and with a number of blood units donated equal to case 2 which presents high serum ferritin and TS values (632 ng/ml, 104%) (Table 2).

Table 2 C282Y homozygotes discovered through population screening a Subject

1 2 3 4 5 6 7 8

Men Women All

Sex Age (years)

F M M F M M M F

1st analysis

2nd analysis

Units of blood

TS (%)

Serum ferritin (mg/l)

Serum iron (mg/dl)

TS (%)

Serum ferritin (mg/l)

Serum iron (mg/dl)

21 104 24 81 104 76 64 50

39 632 18 91 473 355 1100 35

45 228 92 200 274 189 179 149

5 103 N/A 62 95 N/A 104 N/A

7 745 N/A 99 646 N/A 1252 N/A

15 227 N/A 165 230 N/A 236 N/A

3 4 4 4 6 8 3 31

Median (range) Mean (SD) Median (range)

Mean (SD)

Mean (SD) Median (range)

Mean (SD)

Median (range)

36 (27–57) 29 (24–62) 33 (24–62)

192 (67) 131 (79) 170 (73)

101 (5) 34 (40) 74 (42)

231 (5) 90 (106) 175 (94)

4 (3–8) 4 (3–31) 4 (3–31)

24 27 29 29 36 42 57 62

74 (33) 51 (30) 65 (32)

473 (18–1100) 39 (35–91) 223 (18–1100)

745 (646–1252) 53 (7–99) 646 (7–1252)

a TS, transferrin saturation; serum ferritin: men 20–300 mg/l, women 15–200 mg/l; units of blood, units of blood donated before genetic testing for C282Y and H63D mutations; N/A, not available; SD, standard deviation; F, female; M, male.

M. Sa´ nchez et al. / Journal of Hepatology 38 (2003) 745–750

748

in precirrhotic individuals. In the last years, increasing interest has been focused on phenotypic and genotypic analyses to report the frequency of the disease in different populations [19–26]. In this study we have established the frequency of the HFE mutations in a large sample of Spanish blood donors and analyzed their effects on iron parameters such as serum ferritin and TS. Our results show that, in Spain, the C282Y and H63D mutations occur with an allelic frequency of 3.16 ^ 0.46% and 20.8 ^ 1.09%, respectively (Table 1). Therefore, 1 in 1004 Spanish subjects is predicted to be homozygous for the C282Y mutation and 1 in 16 is heterozygous. These results have allowed us to determine more accurately the frequency of the HFE mutations as compared with our first analysis [5]. The C282Y/C282Y frequency found in Spain is not as high as that reported in other population studies involving people of Northern European ancestry, where between 1 in 147 and 1 in 327 subjects are homozygous for the C282Y mutation [19–25]; but definitely it is higher than the reported in a wide population study conducted in Italy, where a 1 in 3900 frequency has been found [26]. With regard to the H63D allele frequency, our figure of 20.8% is one of the highest ever reported for this mutation, and it is in concordance with other smaller previous Spanish population studies [6–9]. The high frequency of the H63D mutation in Spain prompted some authors to hypothesize that H63D originated in the Iberian peninsula [27]. Although blood donors have been used as research subjects in several studies [22,24,26] they may not be the best representative sample for a whole population. Preselecting of blood donors may contribute to explain why the prevalence of the C282Y/C282Y genotype is higher (1 in

Serum iron, serum ferritin and serum transferrin were analyzed in all C282Y homozygotes, all compound heterozygotes and in a group of 25–26 randomly selected samples from the rest of genotypes. Means and medians of the biochemical analyses are reported in Table 3. Serum iron levels and serum ferritin levels were within the normal range in all genotype groups except in C282Y/C282Y men (Table 3). TS values greater than 50% were found in both genders in C282Y homozygotes (Table 3). Serum iron levels were significantly elevated in C282Y homozygotes as compared with the following groups: compound heterozygotes, C282Y heterozygotes, H63D heterozygotes and wild-type blood donors (Table 3). No significant differences were found between men and women. The TS values were also significantly elevated in the C282Y homozygous donors as compared with all the other genotype groups (Table 3). No significant differences between men and women were detected. Serum ferritin was significantly elevated only in C282Y homozygous men as compared with the rest of genotypes (Table 3). In women, serum ferritin levels were not significantly higher in C282Y homozygotes as compared to other genotypes (Table 3).

4. Discussion Hemochromatosis is an attractive candidate for largescale population screening programs, since it is a common disorder with a simple and effective treatment that alters the natural history of the disease and preserves life expectancy Table 3 Iron parameters in blood donors stratified by genotype and gender a Genotype

Men Women All Men Women All Men Women All Men Women All Men Women All Men Women All a

N

C282Y

H63D

1 /1 1 /1 1 /1 1 /2 1 /2 1 /2 1 /2 1 /2 1 /2 2 /2 2 /2 2 /2 2 /2 2 /2 2 /2 2 /2 2 /2 2 /2

2 /2 2 /2 2 /2 1 /2 1 /2 1 /2 2 /2 2 /2 2 /2 1 /1 1 /1 1 /1 1 /2 1 /2 1 /2 2 /2 2 /2 2 /2

5 3 8 44 30 74 18 8 26 13 12 25 13 13 26 21 4 25

Serum iron (mg/dl) x

(SD)

192 131 170 117 105 112 89 99 92 135 127 131 110 89 100 92 99 93

(67) (79) (73) (47) (76) (60) (28) (90) (53) (42) (83) (64) (30) (41) (37) (33) (26) (32)

TS (%) P

*

*

*

*

Serum ferritin (mg/l)

x

(SD)

74 51 65 39 34 37 32 37 34 43 40 42 33 25 29 26 28 26

(33) (30) (32) (17) (26) (21) (13) (38) (23) (12) (27) (20) (9) (12) (11) (10) (8) (10)

P

*

*

*

*

*

md

(range)

473 39 223 76 13 38 81 13 48 46 26 36 41 14 21 88 25 81

(18–1110) (35–91) (18–1110) (76–588) (4–110) (4–588) (29–593) (3–54) (3–593) (8–213) (6–216) (6–216) (6–118) (3–69) (3–118) (19–243) (11–39) (11–243)

Age (years) P

*

*

*

*

*

md

(range)

36 29 33 36 26 31 35 25 30 26 21 23 29 21 26 27 20 27

(27–57) (24–62) (24–62) (19–66) (19–65) (19–66) (18–62) (19–31) (18–62) (18–48) (18–56) (18–56) (18–42) (18–52) (18–52) (18–41) (18–43) (18–43)

 mean; SD, standard deviation; md, median. *P # 0:01; Genotypes: 1 indicates mutated allele, 2 indicates wild-type allele. TS, transferrin saturation. x, significant differences with respect to C282Y homozygote group by ANOVA multiple comparative test with Bonferroni correction (SPSS 10.1).

M. Sa´ nchez et al. / Journal of Hepatology 38 (2003) 745–750

671) than our predicted data (1 in 1004), since we are excluding subjects with anemia that are a priori carrying a normal allele for the C282Y mutation. The screening of 5370 Spanish blood donors has led to the detection of 82 subjects with a genotype of risk to develop HH, eight C282Y/C282Y and 74 C282Y/H63D. Among the eight C282Y homozygotes, five were men and three were women. Only one of the 74 C282Y/H63D compound heterozygotes was detected with elevated serum ferritin and TS values, confirming that this genotype has a low penetrance (1.35%) as reported in other studies [3,28]. There was no evidence of iron overload in the rest of the genotypes. None of the three C282Y homozygous women detected had elevated values for both serum ferritin and TS, although one had persistent TS greater than 50% and another one had a TS equal to 50% (Table 2). It has been reported that iron overload develops at a lower rate in women with hereditary hemochromatosis as compared with men due to iron loss associated with menses and pregnancy in women [1]. However, we may not exclude that other factors could be involved in the protection of women against iron accumulation, such as an estrogen effect in the regulation of iron genes [29]. A recent publication has concluded that only 1% of C282Y homozygous subjects in the United States express clinically, a figure they claim would not justify screening. But these authors also found that, after controlling for age and sex, the C282Y homozygotes were more likely to report liver disorders or to have raised aspartate aminotransferase values [25]. Our data indicates that 80% of men carrying the C282Y/C282Y genotype express biochemically the disease. Whether these biochemically expressing homozygous men would become clinically ill is difficult to address since we consider that it would be unethical not to implement treatment in those subjects. Further studies are needed to determine the clinical evolution of the C282Y/C282Y blood donors with normal iron parameters, and to identify the modifiers that influence their individual variability in iron metabolism.

Acknowledgements The authors thank the staff of the Hemotherapy and Hemostasis Service, Hospital Clinic of Barcelona, Spain for kindly support in sample collection. We gratefully acknowledge Dr. Larry E. Mobraaten for kindly providing of details and modifications of the DNA extraction protocol, the excellent technical assistance provided by Vanessa Martı´n and the excellent administrative support provided by Montserrat Riego. This study is supported by the follow´ TV3 98-1010, La ing grants: FIS 98-0145, La MARATO ´ TV3 99-1510 and 2001SGR-00382 to R.O., and MARATO University of Barcelona ‘Recerca i Doce`ncia’ fellowship to M.S.

749

References [1] Powell LW, Jazwinska E, Halliday JW. Primary iron overload. In: Brock JH, Halliday JW, Pippard MJ, Powell LW, editors. Iron metabolism in health and disease, London: Saunders, 1994. pp. 227–270. [2] Niederau C, Fischer R, Purschel A, Stremmel W, Haussinger D, Strohmeyer G. Longterm survival in patients with hereditary hemochromatosis. Gastroenterology 1996;110:1107–1119. [3] Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 1996;13:399–408. [4] Worwood M, Shearman JD, Wallace DF, Dooley LS, MerryweatherClarke AT, Pointon LL, et al. A simple genetic test identifies 90% of UK patients with haemochromatosis. Gut 1997;41:841–844. [5] Sa´ nchez M, Bruguera M, Bosch J, Rodes J, Ballesta F, Oliva R. Prevalence of the Cys282Tyr and His63Asp HFE gene mutations in Spanish patients with hereditary hemochromatosis and in controls. J Hepatol 1998;29:725–728. [6] Moreno L, Vallcorba P, Boixeda D, Cabello P, Bermejo F, San Roman C. The usefulness of the detection of Cys282Tyr and His63Asp mutations in the diagnosis of hereditary hemochromatosis. Rev Clin Esp 1999;199:632–636. [7] Guix P, Picornell A, Parera M, Galmes A, Obrador A, Ramon MM, Castro JA. Distribution of HFE C282Y and H63D mutations in the Balearic Islands (NE Spain). Clin Genet 2002;61:43–48. [8] Baiget M, Barcelo MJ, Gimferrer E. Frequency of the C282Y and H63D mutations in distinct ethnic groups living in Spain. J Med Genet 1998;35:701. [9] Merryweather-Clarke AT, Pointon JJ, Jouanolle AM, Rochette J, Robson KJ. Geography of HFE C282Y and H63D mutations. Genet Test 2000;4:183–198. [10] Carella M, D’Ambrosio L, Totaro A, Grifa A, Valentino MA, Piperno A, et al. Mutation analysis of the HLA-H gene in Italian hemochromatosis patients. Am J Hum Genet 1997;60:828–832. [11] Camaschella C, Roetto A, Cali A, De Gobbi M, Garozzo G, Carella M, et al. The gene TFR2 is mutated in a new type of haemochromatosis mapping to 7q22. Nat Genet 2000;25:14–15. [12] Montosi G, Donovan A, Totaro A, Garuti C, Pignatti E, Cassanelli S, et al. Autosomal dominant hemochromatosis is associated with a mutation in the ferroportin (SCL11A3) gene. J Clin Invest 2001;108:619–623. [13] Sa´ nchez M, Bruguera M, Quintero E, Marrio Y, Mazzara R, Rode´ s J, Oliva R. Hereditary hemochromatosis in Spain. Genet Test 2000;4:171–176. [14] Guyader D, Jacquelinet C, Moirand R, Turlin B, Mendler MH, Chaperon L, et al. Noninvasive prediction of fibrosis in C282Y homozygous hemochromatosis. Gastroenterology 1998;115:929–936. [15] Fairbanks VF, Klee GG. Biochemical aspects of haematology. In: Tietz NW, Burtis CA, Ashwood ER, editors. Textbook of clinical chemistry, 2nd ed. Philadelphia, PA: Saunders, 1986. pp. 2061–2065. [16] Higuchi R. DNA from whole blood for PCR. Amplifications 1989;2:1–3. [17] Stott MK, Fellowes AP, Upton JD, Burt MJ, George PM. Simple multiplex PCR for the simultaneous detection of the C282Y and H63D hemochromatosis (HFE) gene mutations. Clin Chem 1999;45:426–428. [18] Jeffrey GP, Chakrabarti S, Hegele RA, Adams PC. Polymorphism in intron 4 of HFE may cause overestimation of C282Y homozygote prevalence in haemochromatosis [Letter]. Nat Genet 1999;22:325– 326. [19] Burt MJ, George PM, Upton JD, Collett JA, Frampton CMA, Chapman TM, et al. The significance of haemochromatosis gene mutations in the general population: implications for screening. Gut 1998;43:830–836. [20] Olynyk JK, Cullen DJ, Aquilia S, Rossi E, Summerville L, Powell

750

[21]

[22]

[23]

[24]

M. Sa´ nchez et al. / Journal of Hepatology 38 (2003) 745–750 LWA. Population-based study of the clinical expression of the hemochromatosis gene. N Engl J Med 1999;341:718–724. McDonnell SM, Hover A, Gloe D, Ou CY, Cogswell ME, GlummerStawn L. Population-based screening for hemochromatosis using phenotypic and DNA testing among employees of health maintenance organizations in Springfield, Missouri. Am J Med 1999;107:3037. Adams PC, Kertesz AE, Mclaren CE, Barr R, Bamford A, Chakrabarti S. Population screening for hemochromatosis: a comparison of unbound iron binding capacity, transferrin saturation and C282Y genotyping in 5,211 voluntary blood donors. Hepatology 2000;31:1160–1164. Asberg A, Hveem K, Thorstensen K, Ellekjter E, Kannelonning K, Fjosne U, et al. Screening for hemochromatosis: high prevalence and low morbidity in an unselected population of 65,238 persons. Scand J Gastroenterol 2001;36:1108–1115. Jackson HA, Carter K, Darke C, Guttridge MG, Ravine D, Hutton RD, et al. HFE mutations, iron deficiency and overload in 10,500 blood donors. Br J Haematol 2001;114:474–484.

[25] Beutler E, Felitti VJ, Koziol JA, Ho NJ, Gelbart T. Penetrance of 845G-A (C282Y) HFE hereditary haemochromatosis mutation in the USA. Lancet 2002;359:211–218. [26] Cassanelli S, Pignatti E, Montosi G, Garuti C, Mariano M, Campioli D, et al. Frequency and biochemical expression of C282Y/H63D hemochromatosis (HFE) gene mutations in the healthy adult population in Italy. J Hepatol 2001;34:523–528. [27] Aguilar-Martinez P, Thelcide C, Jeanjean P, Masmejean C, Giansily M, Schved JF. Haplotype analysis of the HFE gene: implications for the origins of hemochromatosis related mutations. Blood Cells Mol Dis 1999;25:166–169. [28] Jouanolle AM, Gandon G, Jezequel P, Blayau M, Campion ML, Yaouanq J, et al. Haemochromatosis and HLA-H [Letter]. Nat Genet 1996;14:251–252. [29] Laine F, Ropert M, Lan CL, Loreal O, Bellissant E, Jard C, et al. Serum ceruloplasmin and ferroxidase activity are decreased in HFE C282Y homozygote male iron-overloaded patients. J Hepatol 2002;36:60–65.