- Email: [email protected]
Porous scaffolds with tailored reactivity modulate in-vitro osteoblast responses
Materials Science and Engineering C 32 (2012) 1818–1826
Contents lists available at SciVerse ScienceDirect
Materials Science and Engineering C journal homepage: www.elsevier.com/locate/msec
Porous scaffolds with tailored reactivity modulate in-vitro osteoblast responses Guocheng Wang a, Zufu Lu a, Dennis Dwarte b, Hala Zreiqat a,⁎ a b
Biomaterials and Tissue Engineering Research Unit, School of AMME, The University of Sydney, Australia Australian Centre for Microscopy & Microanalysis, The University of Sydney, Australia
a r t i c l e
i n f o
Article history: Received 22 July 2011 Received in revised form 24 February 2012 Accepted 28 April 2012 Available online 5 May 2012 Keywords: Calcium silicate Hardystonite Primary human osteoblasts Zinc Reactivity
a b s t r a c t CaSiO3 (CS) ceramic has been extensively studied for biomedical applications. The main advantages are its ability to induce bone-like apatite formation and the beneficial effects of the dissolution products on the bone cells, resulting from high reactivity of CS in liquid solutions. However, the high reactivity also results in a rapid degradation rate and accordingly leads to a high pH value in the body fluid, adversely affecting bone cell responses, especially when CS is used as a highly porous scaffold. In this study, we provide an approach to minimize this pH-dependent cell damage and maximize the beneficial effects of the dissolution products of the CS scaffold by adding chemically stable and biocompatible Zn-containing hardystonite (Ca2ZnSi2O7, HT) into the CS scaffold, the resultant composite scaffold is referred to as HT–CS. We investigated the responses of primary human osteoblasts (HOBs) to the CS, HT and the HT–CS scaffolds. HOBs on HT and HT–CS scaffolds attached better than on the CS scaffold. HOBs cultured on the HT–CS scaffolds expressed higher gene expression levels for Runx-2, osteopontin (OPN), osteocalcin (OCN), bone sialoprotein (BSP), and collagen type I (Col-I) and enhanced alkaline phosphatase (ALP) activity compared to those on the CS and HT scaffolds. The higher activity of the HOBs cultured on the HT–CS scaffold was ascribed to the moderate pH variation and the dissolution products containing Ca, Si and Zn. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Choosing an appropriate chemical composition is of great importance in designing scaffolds for bone tissue engineering. The significant effects of calcium (Ca) on bone formation are well-known [1]. Trace elements, such as silicon (Si) and zinc (Zn), also play important roles in bone remodeling and bone regeneration. Si is an essential trace element for metabolic processes associated with the development of bone and connective tissues [2]. It plays important roles during the early stage of bone formation and the calcified process [2,3], by increasing the mRNA expression of osteoblastic genes, such as type I collagen [4,5]. Zn is another important essential trace element in the human body with significant effects on bone formation [6]. At the cellular level, Zn plays a significant role in enhancing osteoblast proliferation [7], increasing the alkaline phosphatase activity and DNA content in bone tissues [8,9], as well as selectively inhibiting osteoclast functions [10]. Inspired by the beneficial effects of these elements, attempts have been made to incorporate these elements into scaffolds for bone tissue regeneration. Both Si substituted-hydroxyapatite (Si-HAp) and α-tricalcium phosphate (Si-α-TCP) exhibited enhanced bone apposition, bone in-growth and cell-mediated degradation compared to stoichiometric HAp controls [11–17]. Encouraging results have also ⁎ Corresponding author at: Biomaterials and Tissue Engineering Research Unit, School of AMME, The University of Sydney, Sydney 2006, Australia. Tel.: + 61 2 93512392; fax: + 61 2 93517060. E-mail address: [email protected] (H. Zreiqat). 0928-4931/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.msec.2012.04.068
been obtained with Zn modified bioglass [18], glass-ceramics [19,20], calcium phosphate [21–23] and calcium sulfate [24]. Collectively, these results suggest that chemical modification with these trace elements has the potential to improve the quality of the current existing biomaterials. In recent years, calcium silicate ceramics (CaSiO3, referred to as CS in this study) have been widely studied as a potential biomaterial for bone tissue engineering due to their ability to induce bone-like apatite formation in simulated body fluid (SBF) and the beneficial effects of their dissolution effects on osteogenesis [25–27]. The apatite formation ability of CaSiO3 ceramics is largely due to their high reactivity which can cause preferential release of Ca ions from the ceramics and an increase in the pH value of the SBF solution. Studies into the effect of dissolution products of Ca–Si based ceramics or coatings showed that Ca and Si ions support osteoblast adhesion and enhance cell proliferation and differentiation in cell culture medium with physiological pH level [28,29]. However, when used as tissue engineering scaffolds, the CS degrades at a much higher rate as the specific surface area of a porous scaffold is significantly higher than ceramic coatings or disks. This high degradation rate is likely to cause the collapse of the scaffold's structure prior to the formation of sufficient bone extracellular matrix. Additionally, the big deviation in pH values from the physiological level caused by excessive dissolution products of CS scaffolds may cause damage to surrounding cells [30,31]. Hardystonite (Ca2ZnSi2O7, HT) is a more chemically stable material, which can be synthesized by the addition of Zn into CS. Its ability to release a certain amount of Zn ions is supposed to contribute to the good
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
biocompatibility of HT ceramics [20,32,33]. However, the degradation rate of the HT ceramics is slow, making this material unsuitable for use as a scaffold [32]. The ideal scaffold should have a mediate degradation rate to enable the controlled release of ions such as Ca, Si and Zn, without resulting in a big variance in the pH value of the surrounding fluid from the physiological level. To address the high degradation rate of the CS scaffolds, we incorporated HT into the CS scaffold to develop a composite scaffold with enhanced biocompatibility. HOBs were cultured on HT, CS, and HT–CS scaffolds and their attachment and differentiation were determined. 2. Materials and methods 2.1. Powder fabrication Composite powders were made by a combined method of high temperature solid reaction and sol–gel. Briefly, HT powders were first fabricated by sintering well-mixed CaCO3, ZnO and SiO2 powders (2:1:2 in mole percent) at 1200 °C for 2 h, followed by milling and sieving. All reagents used in this study were from Sigma-Aldrich, with a purity > 99.9%. Powders with particle size below 75 μm were put into a milling bottle with zirconia milling balls and a certain amount of absolute ethanol was used as the milling medium. After 24 h of milling, the suspension was added dropwise into the CS sol prepared in advance. The preparation of CS sol was according to the procedure used in our previous work [32]. The weight percentage of HT used in this study was 23%. The CS sol containing HT powders was aged at 60 °C, dried at 100 °C, and then sintered in air at 1200 °C for 2 h. 2.2. Scaffold fabrication The scaffolds were fabricated using fully reticulated polyurethane foam (40 ppi, Foambooth AU) as a sacrificial template. Before use, the foam was washed with absolute ethanol and ultrapure water, followed by drying at 37 °C. In a typical process, 0.5 g of polyvinyl alcohol (PVA, Sigma Aldrich, USA) was first dissolved in 8 ml of ultrapure water and 6 g of composite powders was added into the PVA solution under stirring to make a slurry. Polyurethane sponges with dimensions of 7 mm × 7 mm × 7 mm were immersed in the prepared slurry, alternately compressed and released to allow the slurry to penetrate into the sponges. After several recycles, the excessive slurry was removed by squeezing the fully impregnated sponges. The coated sponges were recoated by the slurry after 15 min of drying at room temperature, dried at 37 °C for 1 day, and finally sintered at 1250 °C for 3 h with a temperature rise rate of 1 °C/min from the room temperature to 550 °C and 4 °C/min from 550 °C to 1250 °C. For comparison, CS and HT scaffolds were also fabricated using the same procedure as that used for composite scaffolds (HT–CS). 2.3. Scaffold characterization The surface morphology of the scaffold was examined by field emission scanning electron microscopy (SEM, Zeiss EVO 50). The structure and architecture of the scaffolds were analyzed using the Skyscan 1172 high resolution micro-CT (Skyscan NV, Kontich, Belgium), equipped with a 100 kV/100 μA X-ray source and a Hamamatsu 10 megapixel X-ray sensitive CCD camera. The specimens were individually scanned at 360° with a rotation step of 0.22° using an accelerating voltage of 100 kV and a beam current of 100 μA. The image pixel size was 9.47 μm. The porosity (P) was calculated according to the equation: P = [(Vtotal pore) / (Vscaffold)] · 100%, where Vtotal pore is the total pore volume and Vscaffold is the scaffold volume. The phase composition of the coatings was analyzed using X-ray diffraction (XRD, Siemens D6000, Germany) using Cu Kα radiation with a scanning step size
1819
of 0.02°. Data was obtained from 15 to 75° 2theta at a scanning rate of 4° min − 1. 2.4. Degradation and pH variation Scaffolds were immersed for 7, 14, 21 and 28 days in a 15 ml sodium chloride solution (pH 7.4) buffered with tris(hydroxymethyl) aminomethane (Amresco, Ohio, USA) and hydrochloric acid (SigmaAldrich) (HCl–Tris buffered solution) to measure their degradation rate. After soaking, the solution was transferred to new tubes to measure their pH values. The ion concentration in the buffer solution was measured using inductively coupled plasma atomic emission spectroscopy (ICP-OES, Optima 3000 DV, USA). The soaked scaffolds were filtrated and rinsed with ultrapure water, dried at 40 °C until no further weight loss, and weighed using an analytical balance. The weight loss of the scaffolds was expressed as a percentage of the initial mass. Four samples for each type of scaffold were tested and results are presented as the mean± standard deviation (SD). The pH variation in the cell culture medium caused by the scaffolds was also tested at days 1, 3 and 7 to determine the pH microenvironment surrounding the osteoblasts seeded on the scaffolds. Three samples of each type of scaffold were tested per time point for statistic analysis. 2.5. Mechanical test of the scaffolds The compressive strength of the scaffolds was determined using a computer-controlled universal testing machine (Endura TEC, ELE 3400, Bose, USA) with a ramp rate of 0.5 mm min − 1. Five identical specimens with dimensions of 7 mm× 7 mm× 7 mm for each type of scaffold were tested and the results were presented as the mean ± standard deviation (SD). 2.6. Isolation and culture of primary human osteoblasts (HOBs) Permission to use discarded human tissue was granted by the Human Ethics Committee of the University of Sydney and informed consent was obtained. Primary human osteoblasts (HOBs) were isolated from normal human trabecular bone as previously described [30]. Briefly, bone was divided into 1 mm 3 pieces, washed several times in PBS, and digested with 0.02% (w/v) trypsin (Sigma-Aldrich, USA) in PBS, pH 7.2, for 90 min at 37 °C. Cells were then cultured in complete media containing α-minimal essential medium (α-MEM, Gibco Laboratories, USA), supplemented with 10% (v/v) heat-inactivated fetal calf serum (FCS, Gibco Laboratories, USA), 2 mM L-glutamine (Gibco Laboratories, USA), 25 mM Hepes Buffer (Gibco Laboratories, USA), 2 mM sodium pyruvate, 30 mg/ml penicillin, 100 mg/ml streptomycin (Gibco Laboratories, USA) and 0.1 mM L-ascorbic acid phosphate magnesium salt (Wako Pure Chemicals, Osaka, Japan). Cells were cultured at 37 °C in an atmosphere of 5% CO2 and media was refreshed every 3 days. Upon confluence, cells were passaged and those at passage 3 were used in the experiments. 2.7. Cell attachment and morphological observation After the cells reached 80–90% confluence, they were trypsinized using TrypLE™ Express (Invitrogen, Carlsbad, AU), subsequently centrifuged and suspended in complete media to produce cell suspension. Then, a 100 cell suspension containing 11 × 104 cells was added into each scaffold placed in 24-well cell culture plate. After 1 h of incubation in a 37 °C incubator, l ml cell culture medium was added into each well. For SEM observation, cells at each time point were fixed in a 4% paraformaldehyde (BDH Laboratory supplies, UK) solution, post-fixed in 1% osmium tetroxide (Sigma-Aldrich, USA) in PBS for 1 h, then dehydrated in a serial of graded ethanol solution (30, 50, 70, 90, 95, and 100%), and finally dried in hexamethyldisilizane (HMDS, Sigma-Aldrich, AU) for
1820
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
3 min. The dried coating samples were gold-sputtered prior to scanning electron microscopy (SEM) observation. 2.8. HOBs differentiation on scaffolds: quantitative real time polymerase chain reaction (qRT-PCR) and alkaline phosphatase (ALP) activity HOBs were seeded into the scaffold with a cell number of 15 × 10 4 and cultured for 1 and 7 days. After each time point, total RNA was isolated from HOBs cultured on the scaffolds by using Trizol (Sigma) following the manufacturer's instructions. First-strand cDNA was synthesized from 0.7 μg total RNA using the Omniscript RT Kit (Qiagen, USA) according to the manufacturer's instructions. The cDNA was then analyzed by real-time PCR (Rotor-Gene 6000, Corbett Life Science, AU) for the osteoblast-related genes: Runx-2, collagen type I (Col-I), osteocalcin (OCN), osteopontin (OPN) and bone sialoprotein (BSP) and their relative gene expression levels were obtained by normalizing to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers used for the selected genes are listed in Table 1. For ALP activity, cell layer was washed gently, lysed in Tris buffer containing 0.2% NP-40 solution, sonicated, and centrifuged. Two microliters of the lysate was added to 100 μl of 16.3 mM/l p-nitrophenol phosphate (ThermoFisher, USA) in 96-well plate and incubated for 30 min at 37 °C. The reaction was stopped using 100 μl of 0.1 N NaOH and the absorbance was read at 405 nm using a microplate reader (PathTech, Australia). ALP activity was calculated from a standard curve after normalizing the total protein content, which was measured using BCA protein assay kit (Pierce, Thermo Scientific, Rockford, USA). Results were expressed in millimoles of p-nitrophenol produced per hour per milligram of protein.
Fig. 1. XRD patterns of the HT–CS, CS and HT scaffolds.
Micro-CT 2D slices and 3D architectures (insets) of the HT–CS, HT and CS scaffolds are shown in Fig. 2. All pores within the porous structure of the scaffolds maintained their open porosity in all the
2.9. Statistical analysis The data were obtained from four independent experiments and expressed as mean ± standard deviation (SD). For statistical analysis, SPSS 17.0 program was used. Levene's test was performed to determine the homogeneity of variance for all the data, and then Tukey HSD post hoc tests were used for the data with homogeneous variance, otherwise Tamhane's T2 post hoc was employed. A p value of less than 0.05 was considered significant. 3. Results 3.1. Characterization of the scaffolds XRD patterns of the HT–CS, HT and CS scaffolds are shown in Fig. 1. The CS scaffold was composed of CaSiO3 (PDF No. 31‐0300) and the HT scaffold was composed of Ca2ZnSi2O7 (PDF No. 35‐0745). Diffraction peaks of both CS and HT appeared in the XRD patterns of the HT–CS scaffolds, confirming that the HT–CS scaffold consisted of both CS and HT. Table 1 Primers used for the qRT-PCR. Gene
Sequence (5′–3′)
Melting temperature (°C)
GAPDH
F ACCCAGAAGACTGTGGATGG R CAGTGAGCTTCCCGTTCAG F ATGCTTCATTCGCCTCAC R ACTGCTTGCAGCCTTAAAT F TTCCAAGTAAGTCCAACGAAAG R GTGACCAGTTCATCAGATTCAT F AGGGTCCCAACGAGATCGAGATCCG R ACAGGAAGCAGACAGGGCCAACGTCG F ATGGCCTGTGCTTTCTCAATG R GGATAAAAGTAGGCATGCTTG F ATGAGAGCCCTCACACTCCTCG R GTCAGCCAACTCGTCACAGTCC
60
Runx-2 Osteopontin Collagen I Bone sialoprotein Osteocalcin
60 60 60 60 60
Fig. 2. Micro-computed 3D tomography (insets) and 2D slices of the HT–CS (A), HT (B) and CS (C) scaffolds.
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
slices for all the three types of scaffolds. SEM micrographs of the three types of scaffolds are shown in Fig. 3, further demonstrating the high porosity (~ 90%) of the scaffolds (Fig. 3A, C and E) with a pore size of about 900 μm as shown in Table 2. The strut thickness and other structural parameters of the scaffolds which were analyzed by a CTAn program can also be found in Table 2. Fig. 3B, D and F shows the high magnification view of the grains in the scaffolds reflecting their sintering behaviors. Well-crystallized grains and obvious grain boundaries are evident in HT and CS scaffolds (Fig. 3D and F). Glass phase was formed at the grain boundary of the HT– CS scaffold, (Fig. 3B, arrows), indicating its improved sintering behavior.
3.2. Compressive strength The CS scaffold has a compressive strength of 0.03 ± 0.007 MPa at a porosity of ~ 90% (Fig. 4), which is lower than that of previously reported values for CS scaffolds at a porosity of ~ 80% [34]. The compressive strength for the HT scaffold (0.06 ± 0.008 MPa) was higher than that of the CS scaffold. The composite HT–CS scaffold had a compressive strength of 0.12 ± 0.02 MPa (Fig. 4); four times stronger than that of the CS scaffold and doubles that of the HT scaffold, indicating that the addition of the 23 wt.% HT enhances the compressive strength of the CS scaffold.
1821
Table 2 Average pore sizes, porosity and structural parameters of the HT–CS, HT and CS scaffolds. Average strut Porosity (%) Scaffolds Surface to volume ratio thickness (μm) (1/μm) HT CS HT–CS
0.037 0.044 0.043
106.8 94.0 99.7
Degree of Pore size anisotropy (μm)
86.94 ± 1. 63 2.28±0.56 919.6 ± 66.72 89.22 ± 0.89 2.99±0.67 929.4 ± 85.91 88.92 ± 1.17 1.36±0.27 923.3 ± 95.08
3.3. Weight loss, ion releases and pH variation HT scaffold exhibited the slowest degradation rate while the CS scaffold showed the fastest, as reflected in the weight loss data presented in Fig. 5. As expected, the degradation rate of the HT–CS composite scaffold fell in between those for the HT and CS scaffolds. In other words, the addition of HT into CS controlled the degradation rate of the CS scaffolds. Ion concentrations in the buffer solution after the immersion of scaffolds are listed in Table 3. CS scaffolds released much higher levels of Ca ions into the buffer solution compared to the HT and HT–CS scaffolds, which was directly related to their degradation rates. Compared to the CS scaffolds, the level of Ca ions released from HT–CS scaffolds was apparently lower, but the difference in the Si ion level was relatively smaller. Besides Ca and Si ions, HT and HT–CS scaffolds
Fig. 3. SEM micrographs of the HT–CS (A, B), HT (C, D) and CS (E, F) scaffolds, and micrographs on the right show the sintering behaviors of the scaffolds (B, D and F).
1822
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
3.4. HOB attachment and adhesion on the scaffolds The typical morphology of the HOBs cultured on the HT, CS and HT–CS scaffolds for 2 h is displayed in Fig. 7. HOBs attached and adhered to all the three types of scaffolds in 24 h of culture (Fig. 7C, F and I). However, their behaviors on the different types of scaffolds were slightly different. After 2 h of culture, HOBs on the HT and the HT–CS scaffolds commenced the spreading process (Fig. 7A and G). However, HOBs on the CS scaffold still exhibited a round shape (Fig. 7D), with obvious microvilli and filopodia interacting with underlying scaffold surface. This indicates that osteoblast adhesion on the CS scaffold was relatively slower, in comparison with those on the HT and HT–CS scaffolds. After 5 h of culture, HOBs cultured on the HT scaffold grew larger exhibiting an elongated morphology (Fig. 7B), while HOBs on the CS scaffold exhibited a less pronounced spreading (Fig. 7E). At this time point, HOBs on the HT–CS scaffold extended more cellular protrusions that interact with the underlying scaffold surface (Fig. 7H), suggesting better cell–material interaction [35], compared to HOBs cultured on the HT and CS scaffolds.
Fig. 4. Compressive strength of the HT, CS and HT & CS scaffolds.
3.5. HOB differentiation on the scaffolds: gene expression levels and ALP activity The differentiation of HOBs cultured on CS, HT and HT–CS scaffolds was determined by qRT-PCR. The expression levels of early (Col-I, Runx-2 and OPN) and late (ALP, OCN and BSP) osteogenic marker by HOBs cultured on the HT–CS, HT and CS scaffolds are displayed in Fig. 8. At day 1, there was no significant difference in the levels of Runx-2 expression between groups; however, significant difference was evident after 7 days of culture. Runx-2 mRNA expression levels were higher on the HT–CS scaffold, compared to those on HT and CS scaffolds; higher levels of OPN mRNA expression can be observed on the CS and HT–CS scaffolds compared to that on the HT scaffold at day 1. After 7 days of culture, the differences between groups become more evident and the advantages of the HT–CS scaffold in promoting OPN expression become more prominent. BSP expression levels on the CS scaffold was lower than those on the HT and HT–CS scaffolds at days 1 and 7, although the differences between the CS and HT–CS scaffolds were not significant. HOBs cultured on the CS and HT–CS scaffolds showed higher levels of the OCN expression compared to the HT scaffold at day 1. After 7 days of culture, the level of OCN expression in HOBs cultured on the HT and CS scaffolds was both lower than those on the HT–CS scaffold. The expression of Col I by HOBs cultured on the HT–CS scaffold was superior to that for HT and CS scaffolds. At day 1, ALP activity on the CS scaffold was higher than that for HT–CS scaffold; both were significantly higher compared to the HT scaffold. At day 7, ALP activity on the HT–CS scaffold was higher than that for the CS and HT scaffolds, although the difference between the former two was not significant. In summary, the combination of HT and CS significantly enhanced all osteoblastic genes tested. An exception is the BSP upregulation on the HT scaffold at day 1. In contrast, OCN and ALP gene expression levels at day 1 were higher on the CS scaffold, compared to the HT–CS scaffold; and by day 7, the expression levels of almost all the genes tested were
Fig. 5. Weight losses of the HT–CS, HT and CS scaffolds versus the immersion time.
also released a certain amount of Zn ion. Fig. 6 shows the pH variation of the buffer solution and of the cell culture medium in relation to the immersion time of the scaffolds. The pH values of the buffer solution after soaking the CS scaffolds were significantly higher than those for the HT scaffolds. As the immersion time increased, the pH values of the buffer solution with CS scaffolds significantly increased, reaching up to about 8.6 after 28 days of immersion. By contrast, the pH values of the buffer solution with HT scaffolds did not significantly change and were maintained below 7.6 throughout the immersion process. The buffer solution with HT–CS scaffolds showed lower pH values compared to that with CS scaffolds throughout the whole soaking period, which was ascribed to the retardation of the degradation. The pH variation of the cell culture medium within 7 days is depicted in the dashed dot line frame in Fig. 6. The trend of the pH variation in the culture medium between different types of scaffolds was similar to that in the buffer solution, but the pH values of the culture medium after scaffold soaking were higher than those of the buffer solution after soaking with the same type of scaffolds.
Table 3 Ion concentrations of the released Ca, Si and Zn into the buffer solution from the scaffolds. Ion concentration (ppm)
HT–CS
HT
CS
7 days
28 days
7 days
28 days
7 days
28 days
Ca Si Zn Ca/Si (mole ratio)
99.0 ± 2.95 22.5 ± 1.58 0.17 ± 0.09 3.08
153.5 ± 3.16 32.3 ± 1.42 0.40 ± 0.05 3.33
21.9 ± 1.03 4.8 ± .37 1.03 ± 0.11 3.19
24.2 ± 1.28 6.3 ± 0.13 1.69 ± 0.08 2.68
143.5 ± 2.82 18.7 ± 1.11 NA 5.39
222.0 ± 5.42 25.4 ± 0.92 NA 6.13
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
1823
ALP activity at day 7 were lower than those at day 1 on all tested scaffolds. The possible reason for this discrepancy might lie in the fact that most of the osteogenesis-related genes display fluctuating expression patterns depending on the stages of the osteogenic differentiation [36]. HOBs tested in our study might be at stages characterized by the down-regulation of these three genes at day 7. All together, these results demonstrated that the HT–CS scaffold was superior to the CS and the HT scaffolds in inducing the in-vitro HOB differentiation. 4. Discussion 4.1. Degradation rate, ion releases, and reactivity
Fig. 6. pH variations of the Tris–HCl buffered solution (in dash frame) and cell culture medium (in dash dot frame) after the immersion of HT–CS, HT and CS scaffolds for various times.
higher on the HT–CS scaffold compared to that for the CS scaffold. As indicated in Fig. 5, the degradation of the CS scaffold is significantly higher than that of the HT–CS scaffold, resulting in a relatively higher amount of Ca and Si ions released into the culture medium, which may contribute to the up-regulation of some gene expression at day 1. However, the increase in the amount of the released Ca ions in the medium resulted in high pH variations from the physiological level, possibly resulting in pH-dependent damage to the osteoblasts [30,31]. This may explain the lower levels of gene expression on the CS scaffold compared to that on the HT–CS scaffold. Taken together, the HT–CS scaffold was superior to the CS and the HT scaffolds in inducing invitro HOB differentiation. The gene expressions of BSP, OCN and
CaO–SiO2 based materials have been tested for their potential use in bone regeneration [37–40]. CaSiO3 ceramics are one of the most studied CaO–SiO2 based biomaterials [41,42]. Their ability to induce apatite formation in simulated body fluids has been well-documented, which is mainly due to the high reactivity of CaSiO3 [43]. The mechanism behind this ability can be summarized in the following steps: firstly, Ca and Si ions are released into the surrounding fluid by exchanging with H+ in the solution. The dissolution of Ca and Si is not incongruent, with Ca released preferentially relative to Si ions [44,45], thus leading to a leached layer which is rich in silanol (`Si\OH). In the second step, Ca 2 + ions in the SBF solution are electrostatically attracted to the newly formed layer which is negatively charged due to the formation of `Si\OH [25]. The pH value of the leach solution increases due to preferential dissolution of Ca 2 + ions, which increases the supersaturation with respect to apatite and thus contributing to the apatite precipitation [25]. In these processes, changes in weight loss of the CaO–SiO2 based materials and variation in the pH values and ion composition of the leach solution are tightly interrelated, largely depending on the reactivity of the materials. In this study, high dissolution rate of the CS-scaffold caused a large weight loss, and a wide-scale variation in the pH values in the leach solution (cell culture medium and buffer
Fig. 7. SEM micrographs of the cells cultured on the HT (A, B and C), CS (D, E, and F) and HT–CS (G, H, and I) scaffolds after 2, 5, and 24 h.
1824
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
Fig. 8. Expression levels of osteoblastic genes and alkaline phosphatase (ALP) activity indicating the differentiation of HOB cells cultured on HT–CS, HT and CS scaffolds, as determined by qRT-PCR. *Statistically significant difference between two groups.
solution). As seen in Table 2, the Ca/Si ratio at day 28 for the CS scaffold is nearly doubled compared to those for the HT and HT–CS scaffolds, which explains the higher pH values of the leach solution of the CS scaffold. Compared to the CS scaffold, the HT scaffold was more chemically stable, as indicated in the results of weight loss and ion releases. After the incorporation of the HT into the CS scaffold, the degradation rate of the resultant composite scaffold showed a moderate degradation rate which fell in between those of the HT and CS scaffolds. From Table 2, it can also be seen that the addition of HT did not result in large changes in Si release, but retarded Ca dissolution; this also contributes to the lower pH values of the leach solution of the HT–CS scaffold. Fig. 8 shows the surface morphology of the scaffolds after incubation in cell culture medium for 3 days to visually demonstrate the reactivity of these three types of scaffolds. The original surface of the CS scaffold has been replaced by a leached layer, composed of nano-scale fussy structures (Fig. 9A); this change was already discernable after 2 h of incubation in the cell culture medium, (Fig. 7D). In contrast, no significant changes in the surface morphology despite some discernable evidence of erosion (Fig. 9B) were observed on the HT scaffold, indicating the better chemical stability of the HT scaffold. Interestingly, there are many visible pits in the surface of the HT–CS scaffold after 3 days of incubation in the cell culture medium (Fig. 9C). However, no apparent erosion could be detected on the HT–CS scaffold within 24 h of cell culture
(Fig. 7G–I), indicating that the HT–CS scaffold had an initial stable phase, which might be related to its improved sintering behavior (Fig. 3). 4.2. Osteoblast responses to the scaffolds High reactivity resulted in a high degradation rate of the scaffolds in solution, rendering more changes in the pH values and ion composition/ concentration of the solution. Both pH value and ion composition/ concentration have significant influence on the osteoblast behaviors [4,7,30,46]. In the CaO–SiO2 system, the reactivity in the solution is tightly interrelated with the bioactivity (referred to as the ability to induce apatite formation) of the materials. Therefore, cell responses to the HT, CS and HT–CS scaffolds can be interpreted as the cell responses to scaffolds with various activities. As revealed by Xynos et al. [37], HOBs cultured on bioactive substrates had more active cell–material interaction, but their adhesion to the bioactive substrates was relatively slower compared to the bioinert substrates. Our results were in agreement with this: higher reactivity of the CS scaffold resulted in relatively slower adhesion of HOBs on its surface, while good chemical stability of the HT scaffold led to a relatively faster but less active HOB adhesion. The active and fast adhesion of HOBs on the HT–CS scaffolds may be ascribed to the intermediate reactivity of the HT–CS scaffold which endowed HOBs with
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
1825
trace element in the human body with significant effects on bone formation [6]. At the cellular level, Zn plays a significant role in enhancing osteoblast proliferation [49]. Biomaterials chemically modified with Si and Zn resulted in enhanced osteoblastic activity [12,14,15,22–24,33,50]. In this study, HT–CS scaffold released not only Ca and Si ions, but also Zn ions, which may contribute to the enhanced activity of HOBs cultured on the HT–CS scaffold. Although the HT scaffold released a certain amount of Zn ions, the effect of Zn on the activation of the HOBs is not sufficient. Compared to the HT–CS scaffold, the CS scaffold had a good ability to release Ca and Si ions, however, the big variation in the pH values of the culture medium should not be overlooked, which might be the reason for the inferior osteoblast activity on the CS scaffold to that on the HT–CS scaffold. In some studies [28,51], the effects of Ca and Si ions on the cell activity were investigated using a conditioned culture medium supplemented with dissolution products (mainly composed of Ca and Si) from CaO–SiO2 based materials. The final pH value of the conditioned culture medium was adjusted to physiological levels, which minimized the pH-dependent cell response. Bone remodeling is a pH-dependent process [48], in which the pre-mineralization activity of the osteoblasts is increased at a higher extracellular pH, whereas the pro-resorptive activity of the osteoclasts is increased under more acidic conditions [52]. It has been reported that the number of gap junctions between osteoblasts is increased at a higher pH value [52]. However, this does not imply that the higher extracellular pH values invariably lead to the higher osteoblast activity. Kaysinger et al. [53] reported that the activity of human osteoblasts increased with increasing pH (in the range of 7.0–7.6), but was markedly suppressed once the extracellular pH exceeded 7.8. Our present data demonstrated that HT–CS scaffolds led to a slight basic pH values (7.0 to 7.8) in the surrounding solution, providing more favorable pH microenvironments for bone cells compared to HT and CS scaffolds. Taken together, our results suggest that HT–CS scaffolds can provide a more suitable pH and ion microenvironment for the attachment, adhesion and differentiation of osteoblasts. 5. Conclusions In the present study, a chemically stable CaO–SiO2 based composite scaffold was produced by incorporating Zn-containing hardystonite (HT) into CaSiO3 (CS). Osteoblast responses to the composite scaffold (HT–CS) were studied in comparison with those of the scaffolds composed of a single component. The HT–CS scaffold had some glass phase formed at the grain boundaries and a higher compressive strength compared to the HT and CS scaffolds. It showed a retarded reaction with the cell culture medium and buffer solution rendering a lower degradation rate compared to the CS scaffold. HOBs showed more active responses to the HT–CS scaffold with respect to enhanced cell attachment and differentiation, compared to those on the HT and CS scaffolds, which was thought to be related to the more favorable ion and pH microenvironment provided by the composite HT–CS scaffolds. Acknowledgments Fig. 9. Surface morphology of the HT (A), CS (B), and HT–CS (C) scaffolds after 3 days of incubation in the culture medium.
a beneficial growing environment. The initial ‘stability’ might also contribute to the good HOB adhesion on the HT–CS scaffold. Attachment and adhesion belong to the first phase of cell/material interactions and the quality of this phase will influence the capacity of the cells to differentiate and establish their phenotype on the scaffolds [47]. Osteoblast activity can be influenced by both ion composition/ concentration and the pH values of the local microenvironment [48]. Effects of Ca and Si on bone cell differentiation and bone formation have been well-documented [2,3,28,49]. Zn is also an important essential
The authors would like to acknowledge the Australia National Health, Medical Research Council and Rebecca Cooper Foundation for funding this research. We are grateful for the technical assistance provided by Ms. Barbara James. References [1] [2] [3] [4]
S.N. Nayab, F.H. Jones, I. Olsen, Biomaterials 26 (2005) 4717–4727. E.M. Carlisle, CIBA Found. Symp. 121 (1986) 123–139. E.M. Carlisle, Science 167 (1970) 279–280. M.Q. Arumugam, D.C. Ireland, R.A. Brooks, N. Rushton, W. Bonfield, Key Eng. Mater. 254–256 (2004) 869–872.
1826
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
[5] D.M. Reffitt, N. Ogston, R. Jugdaohsingh, H.F.J. Cheung, B.A.J. Evans, R.P.H. Thompson, J.J. Powell, G.N. Hampson, Bone 32 (2003) 127–135. [6] H.H. Sandstead, J. Trace Elem. Exp. Med. 13 (2000) 41–49. [7] R.S. MacDonald, J. Nutr. 130 (2000) 1500s–1508s. [8] M. Yamaguchi, H. Oishi, Y. Suketa, Biochem. Pharmacol. 36 (1987) 4007–4012. [9] M. Yamaguchi, H. Miwa, Pharmacology 42 (1991) 230–240. [10] S. Kishi, M. Yamaguchi, Biochem. Pharmacol. 48 (1994) 1225–1230. [11] A.E. Porter, N. Patel, J.N. Skepper, S.M. Best, W. Bonfield, Biomaterials 24 (2003) 4609–4620. [12] A.E. Porter, N. Patel, J.N. Skepper, S.M. Best, W. Bonfield, Biomaterials 25 (2004) 3303–3314. [13] S.R. Kim, J.H. Lee, Y.T. Kim, D.H. Riu, S.J. Jung, Y.J. Lee, S.C. Chung, Y.H. Kim, Biomaterials 24 (2003) 1389–1398. [14] E.S. Thian, J. Huang, S.M. Best, Z.H. Barber, W. Bonfield, Mater. Sci. Eng., C 27 (2007) 251–256. [15] M. Sayer, A.D. Stratilatov, J. Reid, L. Calderin, M.J. Stott, X. Yin, M. MacKenzie, T.J.N. Smith, J.A. Hendry, S.D. Langstaff, Biomaterials 24 (2003) 369–382. [16] A.M. Pietak, J.W. Reid, M.J. Stott, M. Sayer, Biomaterials 28 (2007) 4023–4032. [17] I.S. Byun, S.K. Sarkar, M. Anirban Jyoti, Y.K. Min, H.S. Seo, B.T. Lee, H.Y. Song, J. Mater. Sci. Mater. Med. 21 (2010) 1937–1947. [18] D. Jaroch, D. Clupper, J. Biomed. Mater. Res. A 82A (2007) 575–588. [19] R.L. Du, J. Chang, S.Y. Ni, W.Y. Zhai, J.Y. Wang, J. Biomater. Appl. 20 (2006) 341–360. [20] H. Zreiqat, Y. Ramaswamy, C. Wu, A. Paschalidis, Z. Lu, B. James, O. Birke, M. McDonald, D. Little, C.R. Dunstan, Biomaterials 31 (2010) 3175–3184. [21] M. Otsuka, S. Marunaka, Y. Matsuda, A. Ito, P. Layrolle, H. Naito, N. Ichinose, J. Biomed. Mater. Res. 52 (2000) 819–824. [22] H. Kawamura, A. Ito, T. Muramatsu, S. Miyakawa, N. Ochiai, T. Tateishi, J. Biomed. Mater. Res. A 65 (2003) 468–474. [23] A. Ito, K. Ojima, H. Naito, N. Ichinose, T. Tateishi, J. Biomed. Mater. Res. 50 (2000) 178–183. [24] S. Hesaraki, R. Nemati, H. Nazarian, J. Biomed. Mater. Res. Part B 91B (2009) 37–45. [25] X. Liu, C. Ding, P.K. Chu, Biomaterials 25 (2004) 1755–1761. [26] X. Liu, C. Ding, J. Biomed. Mater. Res. 59 (2002) 259–264. [27] L.L. Hench, H.A. Paschall, J. Biomed. Mater. Res. 8 (1974) 49–64. [28] J. Sun, L. Wei, X. Liu, J. Li, B. Li, G. Wang, F. Meng, Acta Biomater. 5 (2009) 1284–1293.
[29] I.D. Xynos, A.J. Edgar, L.D.K. Buttery, L.L. Hench, J.M. Polak, J. Biomed. Mater. Res. 55 (2001) 151–157. [30] D.H. Kohn, M. Sarmadi, J.I. Helman, P.H. Krebsbach, J. Biomed. Mater. Res. 60 (2002) 292–299. [31] W.K. Ramp, L.G. Lenz, K.K. Kaysinger, Bone Miner. 24 (1994) 59–73. [32] C. Wu, Y. Ramaswamy, J. Chang, J. Woods, Y. Chen, H. Zreiqat, J. Biomed. Mater. Res. Part B 87B (2008) 346–353. [33] Y. Ramaswamy, C. Wu, H. Zhou, H. Zreiqat, Acta Biomater. 4 (2008) 1487–1497. [34] C. Wu, Y. Ramaswamy, P. Boughton, H. Zreiqat, Acta Biomater. 4 (2008) 343–353. [35] J.B. Wyckoff, L. Insel, K. Khazaie, R.B. Lichtner, J.S. Condeelis, J.E. Segall, Exp. Cell Res. 242 (1998) 100–109. [36] E. Kärner, C.-M. Bäckesjö, J. Cedervall, R.V. Sugars, L. Ährlund-Richter, M. Wendel, Biochim. Biophys. Acta, Gen. Subj. 1790 (2009) 110–118. [37] I.D. Xynos, M.V.J. Hukkanen, J.J. Batten, L.D. Buttery, L.L. Hench, J.M. Polak, Calcif. Tissue Int. 67 (2000) 321–329. [38] S. Hattar, S. Loty, D. Gaisser, A. Berdal, J.M. Sautier, J. Biomed. Mater. Res. A 76A (2006) 811–819. [39] C. Wu, H. Zreiqat, Acta Biomater. 6 (2010) 820–829. [40] N. Zhang, J.A. Molenda, J.H. Fournelle, W.L. Murphy, N. Sahai, Biomaterials 31 (2010) 7653–7665. [41] S. Xu, K. Lin, Z. Wang, J. Chang, L. Wang, J. Lu, C. Ning, Biomaterials 29 (2008) 2588–2596. [42] S.Y. Ni, J. Chang, L. Chou, J. Biomed. Mater. Res. A 76A (2006) 196–205. [43] J. Chang, L. Chen, in: T. Tateishi (Ed.), Biomaterials in Asia: in Commemoration of the 1st Asian Biomaterials, World Scientific Publishing, Singapore, 2009. [44] S.C. Peters, J.D. Blum, C.T. Driscoll, G.E. Likens, Biogeochemistry 67 (2004) 309–329. [45] E. Green, A. Luttge, Am. Mineral. 91 (2006) 430–434. [46] S. Maeno, Y. Niki, H. Matsumoto, H. Morioka, T. Yatabe, A. Funayama, Y. Toyama, T. Taguchi, J. Tanaka, Biomaterials 26 (2005) 4847–4855. [47] K. Anselme, Biomaterials 21 (2000) 667–681. [48] H. Pan, X. Zhao, B.W. Darvell, W.W. Lu, Acta Biomater. 6 (2010) 4181–4188. [49] H. Storrie, S.I. Stupp, Biomaterials 26 (2005) 5492–5499. [50] H. Kawamura, A. Ito, S. Miyakawa, P. Layrolle, K. Ojima, N. Ichinose, T. Tateishi, J. Biomed. Mater. Res. 50 (2000) 184–190. [51] P. Valerio, M.M. Pereira, A.M. Goes, M.F. Leite, Biomaterials 25 (2004) 2941–2948. [52] J.D. Kaunitz, D.T. Yamaguchi, J. Cell. Biochem. 105 (2008) 655–662. [53] K.K. Kaysinger, W.K. Ramp, J. Cell. Biochem. 68 (1998) 83–89.
Contents lists available at SciVerse ScienceDirect
Materials Science and Engineering C journal homepage: www.elsevier.com/locate/msec
Porous scaffolds with tailored reactivity modulate in-vitro osteoblast responses Guocheng Wang a, Zufu Lu a, Dennis Dwarte b, Hala Zreiqat a,⁎ a b
Biomaterials and Tissue Engineering Research Unit, School of AMME, The University of Sydney, Australia Australian Centre for Microscopy & Microanalysis, The University of Sydney, Australia
a r t i c l e
i n f o
Article history: Received 22 July 2011 Received in revised form 24 February 2012 Accepted 28 April 2012 Available online 5 May 2012 Keywords: Calcium silicate Hardystonite Primary human osteoblasts Zinc Reactivity
a b s t r a c t CaSiO3 (CS) ceramic has been extensively studied for biomedical applications. The main advantages are its ability to induce bone-like apatite formation and the beneficial effects of the dissolution products on the bone cells, resulting from high reactivity of CS in liquid solutions. However, the high reactivity also results in a rapid degradation rate and accordingly leads to a high pH value in the body fluid, adversely affecting bone cell responses, especially when CS is used as a highly porous scaffold. In this study, we provide an approach to minimize this pH-dependent cell damage and maximize the beneficial effects of the dissolution products of the CS scaffold by adding chemically stable and biocompatible Zn-containing hardystonite (Ca2ZnSi2O7, HT) into the CS scaffold, the resultant composite scaffold is referred to as HT–CS. We investigated the responses of primary human osteoblasts (HOBs) to the CS, HT and the HT–CS scaffolds. HOBs on HT and HT–CS scaffolds attached better than on the CS scaffold. HOBs cultured on the HT–CS scaffolds expressed higher gene expression levels for Runx-2, osteopontin (OPN), osteocalcin (OCN), bone sialoprotein (BSP), and collagen type I (Col-I) and enhanced alkaline phosphatase (ALP) activity compared to those on the CS and HT scaffolds. The higher activity of the HOBs cultured on the HT–CS scaffold was ascribed to the moderate pH variation and the dissolution products containing Ca, Si and Zn. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Choosing an appropriate chemical composition is of great importance in designing scaffolds for bone tissue engineering. The significant effects of calcium (Ca) on bone formation are well-known [1]. Trace elements, such as silicon (Si) and zinc (Zn), also play important roles in bone remodeling and bone regeneration. Si is an essential trace element for metabolic processes associated with the development of bone and connective tissues [2]. It plays important roles during the early stage of bone formation and the calcified process [2,3], by increasing the mRNA expression of osteoblastic genes, such as type I collagen [4,5]. Zn is another important essential trace element in the human body with significant effects on bone formation [6]. At the cellular level, Zn plays a significant role in enhancing osteoblast proliferation [7], increasing the alkaline phosphatase activity and DNA content in bone tissues [8,9], as well as selectively inhibiting osteoclast functions [10]. Inspired by the beneficial effects of these elements, attempts have been made to incorporate these elements into scaffolds for bone tissue regeneration. Both Si substituted-hydroxyapatite (Si-HAp) and α-tricalcium phosphate (Si-α-TCP) exhibited enhanced bone apposition, bone in-growth and cell-mediated degradation compared to stoichiometric HAp controls [11–17]. Encouraging results have also ⁎ Corresponding author at: Biomaterials and Tissue Engineering Research Unit, School of AMME, The University of Sydney, Sydney 2006, Australia. Tel.: + 61 2 93512392; fax: + 61 2 93517060. E-mail address: [email protected] (H. Zreiqat). 0928-4931/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.msec.2012.04.068
been obtained with Zn modified bioglass [18], glass-ceramics [19,20], calcium phosphate [21–23] and calcium sulfate [24]. Collectively, these results suggest that chemical modification with these trace elements has the potential to improve the quality of the current existing biomaterials. In recent years, calcium silicate ceramics (CaSiO3, referred to as CS in this study) have been widely studied as a potential biomaterial for bone tissue engineering due to their ability to induce bone-like apatite formation in simulated body fluid (SBF) and the beneficial effects of their dissolution effects on osteogenesis [25–27]. The apatite formation ability of CaSiO3 ceramics is largely due to their high reactivity which can cause preferential release of Ca ions from the ceramics and an increase in the pH value of the SBF solution. Studies into the effect of dissolution products of Ca–Si based ceramics or coatings showed that Ca and Si ions support osteoblast adhesion and enhance cell proliferation and differentiation in cell culture medium with physiological pH level [28,29]. However, when used as tissue engineering scaffolds, the CS degrades at a much higher rate as the specific surface area of a porous scaffold is significantly higher than ceramic coatings or disks. This high degradation rate is likely to cause the collapse of the scaffold's structure prior to the formation of sufficient bone extracellular matrix. Additionally, the big deviation in pH values from the physiological level caused by excessive dissolution products of CS scaffolds may cause damage to surrounding cells [30,31]. Hardystonite (Ca2ZnSi2O7, HT) is a more chemically stable material, which can be synthesized by the addition of Zn into CS. Its ability to release a certain amount of Zn ions is supposed to contribute to the good
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
biocompatibility of HT ceramics [20,32,33]. However, the degradation rate of the HT ceramics is slow, making this material unsuitable for use as a scaffold [32]. The ideal scaffold should have a mediate degradation rate to enable the controlled release of ions such as Ca, Si and Zn, without resulting in a big variance in the pH value of the surrounding fluid from the physiological level. To address the high degradation rate of the CS scaffolds, we incorporated HT into the CS scaffold to develop a composite scaffold with enhanced biocompatibility. HOBs were cultured on HT, CS, and HT–CS scaffolds and their attachment and differentiation were determined. 2. Materials and methods 2.1. Powder fabrication Composite powders were made by a combined method of high temperature solid reaction and sol–gel. Briefly, HT powders were first fabricated by sintering well-mixed CaCO3, ZnO and SiO2 powders (2:1:2 in mole percent) at 1200 °C for 2 h, followed by milling and sieving. All reagents used in this study were from Sigma-Aldrich, with a purity > 99.9%. Powders with particle size below 75 μm were put into a milling bottle with zirconia milling balls and a certain amount of absolute ethanol was used as the milling medium. After 24 h of milling, the suspension was added dropwise into the CS sol prepared in advance. The preparation of CS sol was according to the procedure used in our previous work [32]. The weight percentage of HT used in this study was 23%. The CS sol containing HT powders was aged at 60 °C, dried at 100 °C, and then sintered in air at 1200 °C for 2 h. 2.2. Scaffold fabrication The scaffolds were fabricated using fully reticulated polyurethane foam (40 ppi, Foambooth AU) as a sacrificial template. Before use, the foam was washed with absolute ethanol and ultrapure water, followed by drying at 37 °C. In a typical process, 0.5 g of polyvinyl alcohol (PVA, Sigma Aldrich, USA) was first dissolved in 8 ml of ultrapure water and 6 g of composite powders was added into the PVA solution under stirring to make a slurry. Polyurethane sponges with dimensions of 7 mm × 7 mm × 7 mm were immersed in the prepared slurry, alternately compressed and released to allow the slurry to penetrate into the sponges. After several recycles, the excessive slurry was removed by squeezing the fully impregnated sponges. The coated sponges were recoated by the slurry after 15 min of drying at room temperature, dried at 37 °C for 1 day, and finally sintered at 1250 °C for 3 h with a temperature rise rate of 1 °C/min from the room temperature to 550 °C and 4 °C/min from 550 °C to 1250 °C. For comparison, CS and HT scaffolds were also fabricated using the same procedure as that used for composite scaffolds (HT–CS). 2.3. Scaffold characterization The surface morphology of the scaffold was examined by field emission scanning electron microscopy (SEM, Zeiss EVO 50). The structure and architecture of the scaffolds were analyzed using the Skyscan 1172 high resolution micro-CT (Skyscan NV, Kontich, Belgium), equipped with a 100 kV/100 μA X-ray source and a Hamamatsu 10 megapixel X-ray sensitive CCD camera. The specimens were individually scanned at 360° with a rotation step of 0.22° using an accelerating voltage of 100 kV and a beam current of 100 μA. The image pixel size was 9.47 μm. The porosity (P) was calculated according to the equation: P = [(Vtotal pore) / (Vscaffold)] · 100%, where Vtotal pore is the total pore volume and Vscaffold is the scaffold volume. The phase composition of the coatings was analyzed using X-ray diffraction (XRD, Siemens D6000, Germany) using Cu Kα radiation with a scanning step size
1819
of 0.02°. Data was obtained from 15 to 75° 2theta at a scanning rate of 4° min − 1. 2.4. Degradation and pH variation Scaffolds were immersed for 7, 14, 21 and 28 days in a 15 ml sodium chloride solution (pH 7.4) buffered with tris(hydroxymethyl) aminomethane (Amresco, Ohio, USA) and hydrochloric acid (SigmaAldrich) (HCl–Tris buffered solution) to measure their degradation rate. After soaking, the solution was transferred to new tubes to measure their pH values. The ion concentration in the buffer solution was measured using inductively coupled plasma atomic emission spectroscopy (ICP-OES, Optima 3000 DV, USA). The soaked scaffolds were filtrated and rinsed with ultrapure water, dried at 40 °C until no further weight loss, and weighed using an analytical balance. The weight loss of the scaffolds was expressed as a percentage of the initial mass. Four samples for each type of scaffold were tested and results are presented as the mean± standard deviation (SD). The pH variation in the cell culture medium caused by the scaffolds was also tested at days 1, 3 and 7 to determine the pH microenvironment surrounding the osteoblasts seeded on the scaffolds. Three samples of each type of scaffold were tested per time point for statistic analysis. 2.5. Mechanical test of the scaffolds The compressive strength of the scaffolds was determined using a computer-controlled universal testing machine (Endura TEC, ELE 3400, Bose, USA) with a ramp rate of 0.5 mm min − 1. Five identical specimens with dimensions of 7 mm× 7 mm× 7 mm for each type of scaffold were tested and the results were presented as the mean ± standard deviation (SD). 2.6. Isolation and culture of primary human osteoblasts (HOBs) Permission to use discarded human tissue was granted by the Human Ethics Committee of the University of Sydney and informed consent was obtained. Primary human osteoblasts (HOBs) were isolated from normal human trabecular bone as previously described [30]. Briefly, bone was divided into 1 mm 3 pieces, washed several times in PBS, and digested with 0.02% (w/v) trypsin (Sigma-Aldrich, USA) in PBS, pH 7.2, for 90 min at 37 °C. Cells were then cultured in complete media containing α-minimal essential medium (α-MEM, Gibco Laboratories, USA), supplemented with 10% (v/v) heat-inactivated fetal calf serum (FCS, Gibco Laboratories, USA), 2 mM L-glutamine (Gibco Laboratories, USA), 25 mM Hepes Buffer (Gibco Laboratories, USA), 2 mM sodium pyruvate, 30 mg/ml penicillin, 100 mg/ml streptomycin (Gibco Laboratories, USA) and 0.1 mM L-ascorbic acid phosphate magnesium salt (Wako Pure Chemicals, Osaka, Japan). Cells were cultured at 37 °C in an atmosphere of 5% CO2 and media was refreshed every 3 days. Upon confluence, cells were passaged and those at passage 3 were used in the experiments. 2.7. Cell attachment and morphological observation After the cells reached 80–90% confluence, they were trypsinized using TrypLE™ Express (Invitrogen, Carlsbad, AU), subsequently centrifuged and suspended in complete media to produce cell suspension. Then, a 100 cell suspension containing 11 × 104 cells was added into each scaffold placed in 24-well cell culture plate. After 1 h of incubation in a 37 °C incubator, l ml cell culture medium was added into each well. For SEM observation, cells at each time point were fixed in a 4% paraformaldehyde (BDH Laboratory supplies, UK) solution, post-fixed in 1% osmium tetroxide (Sigma-Aldrich, USA) in PBS for 1 h, then dehydrated in a serial of graded ethanol solution (30, 50, 70, 90, 95, and 100%), and finally dried in hexamethyldisilizane (HMDS, Sigma-Aldrich, AU) for
1820
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
3 min. The dried coating samples were gold-sputtered prior to scanning electron microscopy (SEM) observation. 2.8. HOBs differentiation on scaffolds: quantitative real time polymerase chain reaction (qRT-PCR) and alkaline phosphatase (ALP) activity HOBs were seeded into the scaffold with a cell number of 15 × 10 4 and cultured for 1 and 7 days. After each time point, total RNA was isolated from HOBs cultured on the scaffolds by using Trizol (Sigma) following the manufacturer's instructions. First-strand cDNA was synthesized from 0.7 μg total RNA using the Omniscript RT Kit (Qiagen, USA) according to the manufacturer's instructions. The cDNA was then analyzed by real-time PCR (Rotor-Gene 6000, Corbett Life Science, AU) for the osteoblast-related genes: Runx-2, collagen type I (Col-I), osteocalcin (OCN), osteopontin (OPN) and bone sialoprotein (BSP) and their relative gene expression levels were obtained by normalizing to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers used for the selected genes are listed in Table 1. For ALP activity, cell layer was washed gently, lysed in Tris buffer containing 0.2% NP-40 solution, sonicated, and centrifuged. Two microliters of the lysate was added to 100 μl of 16.3 mM/l p-nitrophenol phosphate (ThermoFisher, USA) in 96-well plate and incubated for 30 min at 37 °C. The reaction was stopped using 100 μl of 0.1 N NaOH and the absorbance was read at 405 nm using a microplate reader (PathTech, Australia). ALP activity was calculated from a standard curve after normalizing the total protein content, which was measured using BCA protein assay kit (Pierce, Thermo Scientific, Rockford, USA). Results were expressed in millimoles of p-nitrophenol produced per hour per milligram of protein.
Fig. 1. XRD patterns of the HT–CS, CS and HT scaffolds.
Micro-CT 2D slices and 3D architectures (insets) of the HT–CS, HT and CS scaffolds are shown in Fig. 2. All pores within the porous structure of the scaffolds maintained their open porosity in all the
2.9. Statistical analysis The data were obtained from four independent experiments and expressed as mean ± standard deviation (SD). For statistical analysis, SPSS 17.0 program was used. Levene's test was performed to determine the homogeneity of variance for all the data, and then Tukey HSD post hoc tests were used for the data with homogeneous variance, otherwise Tamhane's T2 post hoc was employed. A p value of less than 0.05 was considered significant. 3. Results 3.1. Characterization of the scaffolds XRD patterns of the HT–CS, HT and CS scaffolds are shown in Fig. 1. The CS scaffold was composed of CaSiO3 (PDF No. 31‐0300) and the HT scaffold was composed of Ca2ZnSi2O7 (PDF No. 35‐0745). Diffraction peaks of both CS and HT appeared in the XRD patterns of the HT–CS scaffolds, confirming that the HT–CS scaffold consisted of both CS and HT. Table 1 Primers used for the qRT-PCR. Gene
Sequence (5′–3′)
Melting temperature (°C)
GAPDH
F ACCCAGAAGACTGTGGATGG R CAGTGAGCTTCCCGTTCAG F ATGCTTCATTCGCCTCAC R ACTGCTTGCAGCCTTAAAT F TTCCAAGTAAGTCCAACGAAAG R GTGACCAGTTCATCAGATTCAT F AGGGTCCCAACGAGATCGAGATCCG R ACAGGAAGCAGACAGGGCCAACGTCG F ATGGCCTGTGCTTTCTCAATG R GGATAAAAGTAGGCATGCTTG F ATGAGAGCCCTCACACTCCTCG R GTCAGCCAACTCGTCACAGTCC
60
Runx-2 Osteopontin Collagen I Bone sialoprotein Osteocalcin
60 60 60 60 60
Fig. 2. Micro-computed 3D tomography (insets) and 2D slices of the HT–CS (A), HT (B) and CS (C) scaffolds.
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
slices for all the three types of scaffolds. SEM micrographs of the three types of scaffolds are shown in Fig. 3, further demonstrating the high porosity (~ 90%) of the scaffolds (Fig. 3A, C and E) with a pore size of about 900 μm as shown in Table 2. The strut thickness and other structural parameters of the scaffolds which were analyzed by a CTAn program can also be found in Table 2. Fig. 3B, D and F shows the high magnification view of the grains in the scaffolds reflecting their sintering behaviors. Well-crystallized grains and obvious grain boundaries are evident in HT and CS scaffolds (Fig. 3D and F). Glass phase was formed at the grain boundary of the HT– CS scaffold, (Fig. 3B, arrows), indicating its improved sintering behavior.
3.2. Compressive strength The CS scaffold has a compressive strength of 0.03 ± 0.007 MPa at a porosity of ~ 90% (Fig. 4), which is lower than that of previously reported values for CS scaffolds at a porosity of ~ 80% [34]. The compressive strength for the HT scaffold (0.06 ± 0.008 MPa) was higher than that of the CS scaffold. The composite HT–CS scaffold had a compressive strength of 0.12 ± 0.02 MPa (Fig. 4); four times stronger than that of the CS scaffold and doubles that of the HT scaffold, indicating that the addition of the 23 wt.% HT enhances the compressive strength of the CS scaffold.
1821
Table 2 Average pore sizes, porosity and structural parameters of the HT–CS, HT and CS scaffolds. Average strut Porosity (%) Scaffolds Surface to volume ratio thickness (μm) (1/μm) HT CS HT–CS
0.037 0.044 0.043
106.8 94.0 99.7
Degree of Pore size anisotropy (μm)
86.94 ± 1. 63 2.28±0.56 919.6 ± 66.72 89.22 ± 0.89 2.99±0.67 929.4 ± 85.91 88.92 ± 1.17 1.36±0.27 923.3 ± 95.08
3.3. Weight loss, ion releases and pH variation HT scaffold exhibited the slowest degradation rate while the CS scaffold showed the fastest, as reflected in the weight loss data presented in Fig. 5. As expected, the degradation rate of the HT–CS composite scaffold fell in between those for the HT and CS scaffolds. In other words, the addition of HT into CS controlled the degradation rate of the CS scaffolds. Ion concentrations in the buffer solution after the immersion of scaffolds are listed in Table 3. CS scaffolds released much higher levels of Ca ions into the buffer solution compared to the HT and HT–CS scaffolds, which was directly related to their degradation rates. Compared to the CS scaffolds, the level of Ca ions released from HT–CS scaffolds was apparently lower, but the difference in the Si ion level was relatively smaller. Besides Ca and Si ions, HT and HT–CS scaffolds
Fig. 3. SEM micrographs of the HT–CS (A, B), HT (C, D) and CS (E, F) scaffolds, and micrographs on the right show the sintering behaviors of the scaffolds (B, D and F).
1822
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
3.4. HOB attachment and adhesion on the scaffolds The typical morphology of the HOBs cultured on the HT, CS and HT–CS scaffolds for 2 h is displayed in Fig. 7. HOBs attached and adhered to all the three types of scaffolds in 24 h of culture (Fig. 7C, F and I). However, their behaviors on the different types of scaffolds were slightly different. After 2 h of culture, HOBs on the HT and the HT–CS scaffolds commenced the spreading process (Fig. 7A and G). However, HOBs on the CS scaffold still exhibited a round shape (Fig. 7D), with obvious microvilli and filopodia interacting with underlying scaffold surface. This indicates that osteoblast adhesion on the CS scaffold was relatively slower, in comparison with those on the HT and HT–CS scaffolds. After 5 h of culture, HOBs cultured on the HT scaffold grew larger exhibiting an elongated morphology (Fig. 7B), while HOBs on the CS scaffold exhibited a less pronounced spreading (Fig. 7E). At this time point, HOBs on the HT–CS scaffold extended more cellular protrusions that interact with the underlying scaffold surface (Fig. 7H), suggesting better cell–material interaction [35], compared to HOBs cultured on the HT and CS scaffolds.
Fig. 4. Compressive strength of the HT, CS and HT & CS scaffolds.
3.5. HOB differentiation on the scaffolds: gene expression levels and ALP activity The differentiation of HOBs cultured on CS, HT and HT–CS scaffolds was determined by qRT-PCR. The expression levels of early (Col-I, Runx-2 and OPN) and late (ALP, OCN and BSP) osteogenic marker by HOBs cultured on the HT–CS, HT and CS scaffolds are displayed in Fig. 8. At day 1, there was no significant difference in the levels of Runx-2 expression between groups; however, significant difference was evident after 7 days of culture. Runx-2 mRNA expression levels were higher on the HT–CS scaffold, compared to those on HT and CS scaffolds; higher levels of OPN mRNA expression can be observed on the CS and HT–CS scaffolds compared to that on the HT scaffold at day 1. After 7 days of culture, the differences between groups become more evident and the advantages of the HT–CS scaffold in promoting OPN expression become more prominent. BSP expression levels on the CS scaffold was lower than those on the HT and HT–CS scaffolds at days 1 and 7, although the differences between the CS and HT–CS scaffolds were not significant. HOBs cultured on the CS and HT–CS scaffolds showed higher levels of the OCN expression compared to the HT scaffold at day 1. After 7 days of culture, the level of OCN expression in HOBs cultured on the HT and CS scaffolds was both lower than those on the HT–CS scaffold. The expression of Col I by HOBs cultured on the HT–CS scaffold was superior to that for HT and CS scaffolds. At day 1, ALP activity on the CS scaffold was higher than that for HT–CS scaffold; both were significantly higher compared to the HT scaffold. At day 7, ALP activity on the HT–CS scaffold was higher than that for the CS and HT scaffolds, although the difference between the former two was not significant. In summary, the combination of HT and CS significantly enhanced all osteoblastic genes tested. An exception is the BSP upregulation on the HT scaffold at day 1. In contrast, OCN and ALP gene expression levels at day 1 were higher on the CS scaffold, compared to the HT–CS scaffold; and by day 7, the expression levels of almost all the genes tested were
Fig. 5. Weight losses of the HT–CS, HT and CS scaffolds versus the immersion time.
also released a certain amount of Zn ion. Fig. 6 shows the pH variation of the buffer solution and of the cell culture medium in relation to the immersion time of the scaffolds. The pH values of the buffer solution after soaking the CS scaffolds were significantly higher than those for the HT scaffolds. As the immersion time increased, the pH values of the buffer solution with CS scaffolds significantly increased, reaching up to about 8.6 after 28 days of immersion. By contrast, the pH values of the buffer solution with HT scaffolds did not significantly change and were maintained below 7.6 throughout the immersion process. The buffer solution with HT–CS scaffolds showed lower pH values compared to that with CS scaffolds throughout the whole soaking period, which was ascribed to the retardation of the degradation. The pH variation of the cell culture medium within 7 days is depicted in the dashed dot line frame in Fig. 6. The trend of the pH variation in the culture medium between different types of scaffolds was similar to that in the buffer solution, but the pH values of the culture medium after scaffold soaking were higher than those of the buffer solution after soaking with the same type of scaffolds.
Table 3 Ion concentrations of the released Ca, Si and Zn into the buffer solution from the scaffolds. Ion concentration (ppm)
HT–CS
HT
CS
7 days
28 days
7 days
28 days
7 days
28 days
Ca Si Zn Ca/Si (mole ratio)
99.0 ± 2.95 22.5 ± 1.58 0.17 ± 0.09 3.08
153.5 ± 3.16 32.3 ± 1.42 0.40 ± 0.05 3.33
21.9 ± 1.03 4.8 ± .37 1.03 ± 0.11 3.19
24.2 ± 1.28 6.3 ± 0.13 1.69 ± 0.08 2.68
143.5 ± 2.82 18.7 ± 1.11 NA 5.39
222.0 ± 5.42 25.4 ± 0.92 NA 6.13
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
1823
ALP activity at day 7 were lower than those at day 1 on all tested scaffolds. The possible reason for this discrepancy might lie in the fact that most of the osteogenesis-related genes display fluctuating expression patterns depending on the stages of the osteogenic differentiation [36]. HOBs tested in our study might be at stages characterized by the down-regulation of these three genes at day 7. All together, these results demonstrated that the HT–CS scaffold was superior to the CS and the HT scaffolds in inducing the in-vitro HOB differentiation. 4. Discussion 4.1. Degradation rate, ion releases, and reactivity
Fig. 6. pH variations of the Tris–HCl buffered solution (in dash frame) and cell culture medium (in dash dot frame) after the immersion of HT–CS, HT and CS scaffolds for various times.
higher on the HT–CS scaffold compared to that for the CS scaffold. As indicated in Fig. 5, the degradation of the CS scaffold is significantly higher than that of the HT–CS scaffold, resulting in a relatively higher amount of Ca and Si ions released into the culture medium, which may contribute to the up-regulation of some gene expression at day 1. However, the increase in the amount of the released Ca ions in the medium resulted in high pH variations from the physiological level, possibly resulting in pH-dependent damage to the osteoblasts [30,31]. This may explain the lower levels of gene expression on the CS scaffold compared to that on the HT–CS scaffold. Taken together, the HT–CS scaffold was superior to the CS and the HT scaffolds in inducing invitro HOB differentiation. The gene expressions of BSP, OCN and
CaO–SiO2 based materials have been tested for their potential use in bone regeneration [37–40]. CaSiO3 ceramics are one of the most studied CaO–SiO2 based biomaterials [41,42]. Their ability to induce apatite formation in simulated body fluids has been well-documented, which is mainly due to the high reactivity of CaSiO3 [43]. The mechanism behind this ability can be summarized in the following steps: firstly, Ca and Si ions are released into the surrounding fluid by exchanging with H+ in the solution. The dissolution of Ca and Si is not incongruent, with Ca released preferentially relative to Si ions [44,45], thus leading to a leached layer which is rich in silanol (`Si\OH). In the second step, Ca 2 + ions in the SBF solution are electrostatically attracted to the newly formed layer which is negatively charged due to the formation of `Si\OH [25]. The pH value of the leach solution increases due to preferential dissolution of Ca 2 + ions, which increases the supersaturation with respect to apatite and thus contributing to the apatite precipitation [25]. In these processes, changes in weight loss of the CaO–SiO2 based materials and variation in the pH values and ion composition of the leach solution are tightly interrelated, largely depending on the reactivity of the materials. In this study, high dissolution rate of the CS-scaffold caused a large weight loss, and a wide-scale variation in the pH values in the leach solution (cell culture medium and buffer
Fig. 7. SEM micrographs of the cells cultured on the HT (A, B and C), CS (D, E, and F) and HT–CS (G, H, and I) scaffolds after 2, 5, and 24 h.
1824
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
Fig. 8. Expression levels of osteoblastic genes and alkaline phosphatase (ALP) activity indicating the differentiation of HOB cells cultured on HT–CS, HT and CS scaffolds, as determined by qRT-PCR. *Statistically significant difference between two groups.
solution). As seen in Table 2, the Ca/Si ratio at day 28 for the CS scaffold is nearly doubled compared to those for the HT and HT–CS scaffolds, which explains the higher pH values of the leach solution of the CS scaffold. Compared to the CS scaffold, the HT scaffold was more chemically stable, as indicated in the results of weight loss and ion releases. After the incorporation of the HT into the CS scaffold, the degradation rate of the resultant composite scaffold showed a moderate degradation rate which fell in between those of the HT and CS scaffolds. From Table 2, it can also be seen that the addition of HT did not result in large changes in Si release, but retarded Ca dissolution; this also contributes to the lower pH values of the leach solution of the HT–CS scaffold. Fig. 8 shows the surface morphology of the scaffolds after incubation in cell culture medium for 3 days to visually demonstrate the reactivity of these three types of scaffolds. The original surface of the CS scaffold has been replaced by a leached layer, composed of nano-scale fussy structures (Fig. 9A); this change was already discernable after 2 h of incubation in the cell culture medium, (Fig. 7D). In contrast, no significant changes in the surface morphology despite some discernable evidence of erosion (Fig. 9B) were observed on the HT scaffold, indicating the better chemical stability of the HT scaffold. Interestingly, there are many visible pits in the surface of the HT–CS scaffold after 3 days of incubation in the cell culture medium (Fig. 9C). However, no apparent erosion could be detected on the HT–CS scaffold within 24 h of cell culture
(Fig. 7G–I), indicating that the HT–CS scaffold had an initial stable phase, which might be related to its improved sintering behavior (Fig. 3). 4.2. Osteoblast responses to the scaffolds High reactivity resulted in a high degradation rate of the scaffolds in solution, rendering more changes in the pH values and ion composition/ concentration of the solution. Both pH value and ion composition/ concentration have significant influence on the osteoblast behaviors [4,7,30,46]. In the CaO–SiO2 system, the reactivity in the solution is tightly interrelated with the bioactivity (referred to as the ability to induce apatite formation) of the materials. Therefore, cell responses to the HT, CS and HT–CS scaffolds can be interpreted as the cell responses to scaffolds with various activities. As revealed by Xynos et al. [37], HOBs cultured on bioactive substrates had more active cell–material interaction, but their adhesion to the bioactive substrates was relatively slower compared to the bioinert substrates. Our results were in agreement with this: higher reactivity of the CS scaffold resulted in relatively slower adhesion of HOBs on its surface, while good chemical stability of the HT scaffold led to a relatively faster but less active HOB adhesion. The active and fast adhesion of HOBs on the HT–CS scaffolds may be ascribed to the intermediate reactivity of the HT–CS scaffold which endowed HOBs with
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
1825
trace element in the human body with significant effects on bone formation [6]. At the cellular level, Zn plays a significant role in enhancing osteoblast proliferation [49]. Biomaterials chemically modified with Si and Zn resulted in enhanced osteoblastic activity [12,14,15,22–24,33,50]. In this study, HT–CS scaffold released not only Ca and Si ions, but also Zn ions, which may contribute to the enhanced activity of HOBs cultured on the HT–CS scaffold. Although the HT scaffold released a certain amount of Zn ions, the effect of Zn on the activation of the HOBs is not sufficient. Compared to the HT–CS scaffold, the CS scaffold had a good ability to release Ca and Si ions, however, the big variation in the pH values of the culture medium should not be overlooked, which might be the reason for the inferior osteoblast activity on the CS scaffold to that on the HT–CS scaffold. In some studies [28,51], the effects of Ca and Si ions on the cell activity were investigated using a conditioned culture medium supplemented with dissolution products (mainly composed of Ca and Si) from CaO–SiO2 based materials. The final pH value of the conditioned culture medium was adjusted to physiological levels, which minimized the pH-dependent cell response. Bone remodeling is a pH-dependent process [48], in which the pre-mineralization activity of the osteoblasts is increased at a higher extracellular pH, whereas the pro-resorptive activity of the osteoclasts is increased under more acidic conditions [52]. It has been reported that the number of gap junctions between osteoblasts is increased at a higher pH value [52]. However, this does not imply that the higher extracellular pH values invariably lead to the higher osteoblast activity. Kaysinger et al. [53] reported that the activity of human osteoblasts increased with increasing pH (in the range of 7.0–7.6), but was markedly suppressed once the extracellular pH exceeded 7.8. Our present data demonstrated that HT–CS scaffolds led to a slight basic pH values (7.0 to 7.8) in the surrounding solution, providing more favorable pH microenvironments for bone cells compared to HT and CS scaffolds. Taken together, our results suggest that HT–CS scaffolds can provide a more suitable pH and ion microenvironment for the attachment, adhesion and differentiation of osteoblasts. 5. Conclusions In the present study, a chemically stable CaO–SiO2 based composite scaffold was produced by incorporating Zn-containing hardystonite (HT) into CaSiO3 (CS). Osteoblast responses to the composite scaffold (HT–CS) were studied in comparison with those of the scaffolds composed of a single component. The HT–CS scaffold had some glass phase formed at the grain boundaries and a higher compressive strength compared to the HT and CS scaffolds. It showed a retarded reaction with the cell culture medium and buffer solution rendering a lower degradation rate compared to the CS scaffold. HOBs showed more active responses to the HT–CS scaffold with respect to enhanced cell attachment and differentiation, compared to those on the HT and CS scaffolds, which was thought to be related to the more favorable ion and pH microenvironment provided by the composite HT–CS scaffolds. Acknowledgments Fig. 9. Surface morphology of the HT (A), CS (B), and HT–CS (C) scaffolds after 3 days of incubation in the culture medium.
a beneficial growing environment. The initial ‘stability’ might also contribute to the good HOB adhesion on the HT–CS scaffold. Attachment and adhesion belong to the first phase of cell/material interactions and the quality of this phase will influence the capacity of the cells to differentiate and establish their phenotype on the scaffolds [47]. Osteoblast activity can be influenced by both ion composition/ concentration and the pH values of the local microenvironment [48]. Effects of Ca and Si on bone cell differentiation and bone formation have been well-documented [2,3,28,49]. Zn is also an important essential
The authors would like to acknowledge the Australia National Health, Medical Research Council and Rebecca Cooper Foundation for funding this research. We are grateful for the technical assistance provided by Ms. Barbara James. References [1] [2] [3] [4]
S.N. Nayab, F.H. Jones, I. Olsen, Biomaterials 26 (2005) 4717–4727. E.M. Carlisle, CIBA Found. Symp. 121 (1986) 123–139. E.M. Carlisle, Science 167 (1970) 279–280. M.Q. Arumugam, D.C. Ireland, R.A. Brooks, N. Rushton, W. Bonfield, Key Eng. Mater. 254–256 (2004) 869–872.
1826
G. Wang et al. / Materials Science and Engineering C 32 (2012) 1818–1826
[5] D.M. Reffitt, N. Ogston, R. Jugdaohsingh, H.F.J. Cheung, B.A.J. Evans, R.P.H. Thompson, J.J. Powell, G.N. Hampson, Bone 32 (2003) 127–135. [6] H.H. Sandstead, J. Trace Elem. Exp. Med. 13 (2000) 41–49. [7] R.S. MacDonald, J. Nutr. 130 (2000) 1500s–1508s. [8] M. Yamaguchi, H. Oishi, Y. Suketa, Biochem. Pharmacol. 36 (1987) 4007–4012. [9] M. Yamaguchi, H. Miwa, Pharmacology 42 (1991) 230–240. [10] S. Kishi, M. Yamaguchi, Biochem. Pharmacol. 48 (1994) 1225–1230. [11] A.E. Porter, N. Patel, J.N. Skepper, S.M. Best, W. Bonfield, Biomaterials 24 (2003) 4609–4620. [12] A.E. Porter, N. Patel, J.N. Skepper, S.M. Best, W. Bonfield, Biomaterials 25 (2004) 3303–3314. [13] S.R. Kim, J.H. Lee, Y.T. Kim, D.H. Riu, S.J. Jung, Y.J. Lee, S.C. Chung, Y.H. Kim, Biomaterials 24 (2003) 1389–1398. [14] E.S. Thian, J. Huang, S.M. Best, Z.H. Barber, W. Bonfield, Mater. Sci. Eng., C 27 (2007) 251–256. [15] M. Sayer, A.D. Stratilatov, J. Reid, L. Calderin, M.J. Stott, X. Yin, M. MacKenzie, T.J.N. Smith, J.A. Hendry, S.D. Langstaff, Biomaterials 24 (2003) 369–382. [16] A.M. Pietak, J.W. Reid, M.J. Stott, M. Sayer, Biomaterials 28 (2007) 4023–4032. [17] I.S. Byun, S.K. Sarkar, M. Anirban Jyoti, Y.K. Min, H.S. Seo, B.T. Lee, H.Y. Song, J. Mater. Sci. Mater. Med. 21 (2010) 1937–1947. [18] D. Jaroch, D. Clupper, J. Biomed. Mater. Res. A 82A (2007) 575–588. [19] R.L. Du, J. Chang, S.Y. Ni, W.Y. Zhai, J.Y. Wang, J. Biomater. Appl. 20 (2006) 341–360. [20] H. Zreiqat, Y. Ramaswamy, C. Wu, A. Paschalidis, Z. Lu, B. James, O. Birke, M. McDonald, D. Little, C.R. Dunstan, Biomaterials 31 (2010) 3175–3184. [21] M. Otsuka, S. Marunaka, Y. Matsuda, A. Ito, P. Layrolle, H. Naito, N. Ichinose, J. Biomed. Mater. Res. 52 (2000) 819–824. [22] H. Kawamura, A. Ito, T. Muramatsu, S. Miyakawa, N. Ochiai, T. Tateishi, J. Biomed. Mater. Res. A 65 (2003) 468–474. [23] A. Ito, K. Ojima, H. Naito, N. Ichinose, T. Tateishi, J. Biomed. Mater. Res. 50 (2000) 178–183. [24] S. Hesaraki, R. Nemati, H. Nazarian, J. Biomed. Mater. Res. Part B 91B (2009) 37–45. [25] X. Liu, C. Ding, P.K. Chu, Biomaterials 25 (2004) 1755–1761. [26] X. Liu, C. Ding, J. Biomed. Mater. Res. 59 (2002) 259–264. [27] L.L. Hench, H.A. Paschall, J. Biomed. Mater. Res. 8 (1974) 49–64. [28] J. Sun, L. Wei, X. Liu, J. Li, B. Li, G. Wang, F. Meng, Acta Biomater. 5 (2009) 1284–1293.
[29] I.D. Xynos, A.J. Edgar, L.D.K. Buttery, L.L. Hench, J.M. Polak, J. Biomed. Mater. Res. 55 (2001) 151–157. [30] D.H. Kohn, M. Sarmadi, J.I. Helman, P.H. Krebsbach, J. Biomed. Mater. Res. 60 (2002) 292–299. [31] W.K. Ramp, L.G. Lenz, K.K. Kaysinger, Bone Miner. 24 (1994) 59–73. [32] C. Wu, Y. Ramaswamy, J. Chang, J. Woods, Y. Chen, H. Zreiqat, J. Biomed. Mater. Res. Part B 87B (2008) 346–353. [33] Y. Ramaswamy, C. Wu, H. Zhou, H. Zreiqat, Acta Biomater. 4 (2008) 1487–1497. [34] C. Wu, Y. Ramaswamy, P. Boughton, H. Zreiqat, Acta Biomater. 4 (2008) 343–353. [35] J.B. Wyckoff, L. Insel, K. Khazaie, R.B. Lichtner, J.S. Condeelis, J.E. Segall, Exp. Cell Res. 242 (1998) 100–109. [36] E. Kärner, C.-M. Bäckesjö, J. Cedervall, R.V. Sugars, L. Ährlund-Richter, M. Wendel, Biochim. Biophys. Acta, Gen. Subj. 1790 (2009) 110–118. [37] I.D. Xynos, M.V.J. Hukkanen, J.J. Batten, L.D. Buttery, L.L. Hench, J.M. Polak, Calcif. Tissue Int. 67 (2000) 321–329. [38] S. Hattar, S. Loty, D. Gaisser, A. Berdal, J.M. Sautier, J. Biomed. Mater. Res. A 76A (2006) 811–819. [39] C. Wu, H. Zreiqat, Acta Biomater. 6 (2010) 820–829. [40] N. Zhang, J.A. Molenda, J.H. Fournelle, W.L. Murphy, N. Sahai, Biomaterials 31 (2010) 7653–7665. [41] S. Xu, K. Lin, Z. Wang, J. Chang, L. Wang, J. Lu, C. Ning, Biomaterials 29 (2008) 2588–2596. [42] S.Y. Ni, J. Chang, L. Chou, J. Biomed. Mater. Res. A 76A (2006) 196–205. [43] J. Chang, L. Chen, in: T. Tateishi (Ed.), Biomaterials in Asia: in Commemoration of the 1st Asian Biomaterials, World Scientific Publishing, Singapore, 2009. [44] S.C. Peters, J.D. Blum, C.T. Driscoll, G.E. Likens, Biogeochemistry 67 (2004) 309–329. [45] E. Green, A. Luttge, Am. Mineral. 91 (2006) 430–434. [46] S. Maeno, Y. Niki, H. Matsumoto, H. Morioka, T. Yatabe, A. Funayama, Y. Toyama, T. Taguchi, J. Tanaka, Biomaterials 26 (2005) 4847–4855. [47] K. Anselme, Biomaterials 21 (2000) 667–681. [48] H. Pan, X. Zhao, B.W. Darvell, W.W. Lu, Acta Biomater. 6 (2010) 4181–4188. [49] H. Storrie, S.I. Stupp, Biomaterials 26 (2005) 5492–5499. [50] H. Kawamura, A. Ito, S. Miyakawa, P. Layrolle, K. Ojima, N. Ichinose, T. Tateishi, J. Biomed. Mater. Res. 50 (2000) 184–190. [51] P. Valerio, M.M. Pereira, A.M. Goes, M.F. Leite, Biomaterials 25 (2004) 2941–2948. [52] J.D. Kaunitz, D.T. Yamaguchi, J. Cell. Biochem. 105 (2008) 655–662. [53] K.K. Kaysinger, W.K. Ramp, J. Cell. Biochem. 68 (1998) 83–89.