Portal venous endothelium in developing human liver contains haematopoietic and epithelial progenitor cells

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 6 3 7– 1 64 7

available at www.sciencedirect.com

www.elsevier.com/locate/yexcr

Research Article

Portal venous endothelium in developing human liver contains haematopoietic and epithelial progenitor cells John D. Terrace a , David C. Hay a , Kay Samuel a , Richard A. Anderson b , Ian S. Currie a , Rowan W. Parks a , Stuart J. Forbes a , James A. Ross a,⁎ a

Centre for Regenerative Medicine, University of Edinburgh Medical School, Chancellor's Building, 49 Little France Crescent, EH16 4SB, Edinburgh, Scotland, UK b Medical Research Council Human Reproductive Sciences Unit, Centre for Reproductive Biology, The Queen's Medical Research Institute, 47 Little France Crescent, EH16 4TJ, Edinburgh, Scotland, UK

A R T I C L E I N F O R M A T I O N

AB S TR AC T

Article Chronology:

Future treatments for chronic liver disease are likely to involve manipulation of liver progenitor

Received 25 November 2009

cells (LPCs). In the human, data characterising the regenerative response is limited and the origin of

Revised version received

adult LPCs is unknown. However, these remain critical factors in the design of cell-based liver

22 February 2010

therapies. The developing human liver provides an ideal model to study cell lineage derivation from

Accepted 24 February 2010

progenitors and to understand how foetal haematopoiesis and liver development might explain the

Available online 6 March 2010

nature of the adult LPC population. In 1st trimester human liver, portal venous endothelium (PVE) expressed adult LPC markers and markers of haematopoietic progenitor cells (HPCs) shared with

Keywords:

haemogenic endothelium found in the embryonic dorsal aorta. Sorted PVE cells were able to

Progenitor Cell

generate hepatoblast-like cells co-expressing CK18 and CK19 in addition to Dlk/pref-1, E-cadherin,

Liver

albumin and fibrinogen in vitro. Furthermore, PVE cells could initiate haematopoiesis. These data

Development

suggest that PVE shares phenotypical and functional similarities both with adult LPCs and

Epithelium

embryonic haemogenic endothelium. This indicates that a temporal relationship might exist

Endothelium

between progenitor cells in foetal liver development and adult liver regeneration, which may

Human

involve progeny of PVE. © 2010 Elsevier Inc. All rights reserved.

Introduction Organ transplantation remains the only cure for chronic liver disease, a condition characterised by severe impairment of hepatocytic function coupled with progressive liver fibrosis. As a result of insufficient donor organ availability, research effort is ongoing to find alternatives to solid organ transplantation. Recently, there has been an increased understanding of the role played by liver progenitor cells (LPCs) in hepatic regeneration after injury [1–7]. Therefore, characterising the regenerative capacity of the liver and identifying progenitors capable of producing cells with mature hepatocytic ⁎ Corresponding author. Fax: +44 131 242 6520. E-mail address: [email protected] (J.A. Ross). 0014-4827/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2010.02.025

function may enable therapeutic manipulation of LPCs either through direct targeting in vivo or through cell therapy. Liver regeneration is normally provided by division of mature hepatocytes [4]. However, following chronic and/or severe hepatic insult, quiescent LPCs can become activated and contribute to organ regeneration [2,7,8]. LPCs, termed oval cells in the rat, are bi-potential and capable of generating progeny with either a hepatocytic or biliary fate [3,4,9–11]. In the human, LPCs have been identified in a number of liver diseases and are likely to originate from the terminal branches of the biliary tree—the Canals of Hering [5,6,12–17]. LPCs are small in number and most extensively characterised in the adult rodent,

1638

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 6 37 – 1 64 7

although phenotypic disparities exist between species [7] and liver injury models [18]. Whilst this has hindered comparative human studies, recent work has identified putative human LPC phenotypes suitable for analysis, although their precise relationship with rodent LPCs requires further clarification [19,20]. However, in contrast to the situation in adults, the developing human liver is abundant in progenitor cell populations allowing ready investigation [21–26]. During liver development, ventral endoderm-derived hepatoblasts express the liver epithelial-specific markers Dlk/pref-1, Ecadherin, albumin and α-fetoprotein, in addition to the hepatocytic and cholangiocytic markers cytokeratin CK18 and CK19, conferring an ability to adopt either a hepatocytic or biliary fate [21,23,27–31]. In this respect, hepatoblasts share several phenotypic and functional similarities with adult LPCs [2]. In response to as yet poorly defined signalling events, subsequent hepatoblast differentiation eventually populates the liver parenchyma with functional hepatocytes and bile duct epithelium [32,33]. As well as generating cells with functional hepatic maturity in an ordered architectural structure, the developing human liver also provides a niche for definitive haematopoiesis. Prior to liver migration and colonization by haematopoietic progenitor cells (HPCs), haematopoietic clusters arise in the embryonic yolk sac and dorsal aorta [34–36]. These cells originate immediately adjacent to vascular endothelial cells, resulting in the parallel development of haematopoiesis and the primitive foetal circulation. It is established that, whilst yolk sac haematopoiesis generates principally primitive erythroid cells, definitive foetal haematopoiesis is attributable to HPCs arising from haemogenic vascular endothelium in the region of the dorsal aorta [37]. Following transition of haematopoiesis to the developing liver, haematopoietic cells are clustered within portal and sinusoidal endothelial structures [30], indicating that a similar mechanism may contribute to foetal liver haematopoiesis. In addition to hepatoblast marker expression [2], human and rodent LPCs have been shown to share markers with HPCs including CD133, CD34, c-kit, Sca-1 and mRNA for flt3 [12,13,38–40]. Although these data led some authors to suggest that bone marrow-derived progenitor cells could differentiate into hepatocyte-like cells in vitro [41,42] and in vivo [43–47] more recent studies have refuted these findings [48–51]. Nevertheless, a possible explanation for haematopoietic and epithelial marker co-expression on LPCs might relate to an association between liver development and regeneration, where HPCs would contribute to the epithelial compartment during organogenesis and share phenotypic and functional similarities with their later LPC counterparts [52]. Indeed, in the developing liver, haematopoietic and epithelial lineages exist in immediate anatomical proximity [30]. We have previously investigated this haematopoietic–epithelial lineage relationship during liver development using CD34-expressing cells from 2nd trimester human foetal liver, demonstrating a bipotential progenitor capability with respect to the hepatocytic and cholangiocytic lineages [22]. Moreover, in later experiments with 1st trimester human liver, a population of CD34-positive cells coexpressing the haematopoietic marker Thy-1, the endothelial marker CD31 and mesenchymal marker vimentin, was localised to the developing portal venous endothelium (PVE) [30]. As a result of these findings, we sought to explore the possibility that PVE might possess an epithelial progenitor capacity during human liver organogenesis, whilst retaining a haematopoietic progenitor capability akin to dorsal aortic endothelium. This would support the notion that progeny of developing PVE might reside quiescently as the presumptive

facultative LPC population activated following appropriate injury in the adult liver. Therefore, since improved understanding of the functional capability of PVE might provide insight into the origin of LPCs, this study aimed to characterise PVE in 1st trimester human liver and investigate the potential of PVE cells for epithelial, haematopoietic and endothelial differentiation.

Materials and methods Liver collection, sectioning and culture Ethical approval for this project was obtained from Lothian Research Ethics Committee (LREC). Following informed patient consent, whole 1st trimester human foetal livers were freshly harvested from therapeutic terminations of pregnancy. Freshly isolated 1st (weeks 8–9) trimester livers were collected in ice-cold Williams E Medium (WME; all culture media, additives, and solutions were obtained from GIBCO Invitrogen Corporation, UK, unless otherwise stated). For sectioning, livers were either snap-frozen in liquid nitrogen or paraffin-embedded and prepared as described previously [22]. Single cell suspensions of liver cells for either immediate analysis or culture, as required, were generated through disaggregation by gentle pipetting and washing in WME. Where necessary, cells for culture were re-suspended in culture medium (WME+; WME supplemented with 10% FCS, 50 U/ml penicillin, 50 μg/ml streptomycin, 2 mM glutamine and Insulin-Transferrin-SeleniumX). Cell number and viability were determined using a Neubauer haemocytometer and 0.2% trypan blue. Cells were cultured at 37 °C in air–5% CO2 in 6-well polystyrene plates (Corning, Corning, NY).

Immunohistochemistry of liver sections Thy-1 immunohistochemistry was performed using frozen sections, prepared as described previously [22]. Paraffin-embedded sections were used for all other immunohistochemistry, with section preparation and optimized concentrations of primary antibody used as previously described (see Table 1) [22,30]. Controls for all staining included isotype-matched control antibodies, conjugated where appropriate for immunofluorescence with corresponding Zenon Alexa Fluor fluorochromes. After graded alcohol dehydration, immunohistochemistry sections were mounted using pertex mounting medium (CellPath, Powys, Wales, UK) and data captured using Leica FW4000 imaging

Table 1 – Antibodies used for Immunohistochemistry. Antibody

Concentration

Species

Manufacturer

Thy-1 CD34 CD31 CD45 Glycophorin-A CK18 CK19 Albumin E-cadherin Dlk/pref-1

1/100 1/100 1/50 1/100 1/200 1/100 1/100 1/100 1/100 1/50

Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse

BD Dako Dako Dako Dako Dako Dako Sigma Dako R and D

1639

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 6 3 7– 1 64 7

software using a Leica DC300F camera (Leica Microsystems UK Ltd., Milton Keynes, UK) on an Olympus BH2 microscope (Olympus UK Ltd., Hertfordshire, UK).

Preparation of liver cells for sorting Adherent cultured cells were recovered using 2.5 g/L trypsin (GIBCO Invitrogen) with 0.2 g/L EDTA (all chemicals from SigmaAldrich, St Louis, MO, unless otherwise stated). Trypsin activity was inhibited by the addition of pre-warmed 37 °C sterile phosphate-buffered saline (PBS) supplemented with 10% FCS. Freshly prepared or recovered cultured cells were washed and cells resuspended and incubated for 30 min at room temperature in the dark with optimum antibody concentration, determined by titration (Table 2). Sorted populations were collected into 100% FCS using a FACS Vantage SE cell sorter (Becton Dickinson & Co., Mountain View, CA) equipped with a dual output 351 nm/488 nm laser and a 633 nm laser, using FACSDiva software (Becton Dickinson). Controls included unstained cells and cell samples stained appropriately with an isotype-matched fluorochromeconjugated control antibody.

Magnetic-activated cell sorting of liver tissue Initial experiments revealed that fresh liver preparations contained large numbers of nucleated erythroid lineage cells resistant to cell lysis treatments. In contrast, erythroid cells in cultured preparations were non-adherent and therefore easily removed by gentle aspiration and washing of culture plates prior to preparing cultured cells for FACS. Therefore, in later experiments, prior to antibody staining and sorting, freshly prepared liver cell suspensions were subjected to erythroid cell depletion using MACS (Miltenyi Biotec Inc. Auburn, CA, USA) according to manufacturer's instructions. Briefly, freshly prepared liver cells were stained with PE-conjugated glycophorin-A antibody (Caltag Medsystems Ltd., Buckingham, UK) and labelled with MACS antiPE microbeads (Miltenyi Biotec). Cell preparations were run through MACS LS columns and the depleted fraction collected. Flow cytometry analysis of depleted and glycophorin-A enriched fractions was performed to assess purity.

RNA isolation and reverse transcriptase polymerase chain reaction (RT-PCR) of sorted liver cells Total RNA was isolated from sorted PVE and non-portal venous endothelial (non-PVE) cells using an RNeasy mini kit (Qiagen, Crawley, UK) according to manufacturer's instructions and DNA removed by treatment with DNase (Qiagen). cDNA was synthesized using 2 μg total RNA with reverse transcriptase (Roche, Basel, Switzerland) in a 20–25 μl volume. PCR was carried out as previously described [53] using the primers described (Table 3) after optimisation of conditions.

Table 2 – Antibodies used for FACS. Antibody Concentration Species Manufacturer Fluorochrome Thy-1 CD34 CD31

1/200 1/200 1/50

Mouse Mouse Mouse

BD BD BD

PE FITC Alexa Fluor 647

Table 3 – Primers used for RT-PCR. Name

Manufacturer Sequence (f—forward and r—reverse)

CK18

VHbio

CK19

VHbio

VEGFR2

MWG Operon

β-actin

VHbio

f GCATCCAGAACGAGAAGGAG r ACTTTGCCATCCACTATCCG f TTGTCCTGCAGATCGACAAC r TCTTCCAAGGCAGCTTTCAT f ACCAGACGGACAGTGGTATGG r AGTGATATCCGGACTGGTAGCC F ACTGACTACCTCATGAAGAT R CGTCATACTCCTGCTTGCTGAT

Haematopoietic colony forming unit assay The haematopoietic colony forming unit (CFU) potential of PVE, non-PVE cells and unsorted liver cells was assessed using a methylcellulose-based CFU assay specific for human haematopoietic progenitor cell culture (MethoCult Complete, Stem Cell Technologies, Vancouver, Canada). Sorted PVE, non-PVE and unsorted cells were washed in sterile PBS, resuspended in 200 µl X-Vivo10 (Bio-Whittaker, Walkersville, MD) before the addition of 400 µl methylcellulose. A 300-µl aliquot was dispensed into one well of a 24 well plate (Corning) and the remaining 300 µl diluted 1:1 by the addition of 300 µl of 1:2 X-Vivo10:methylcellulose. This process was repeated to give 5 doubling-dilutions of cell number for each sample tested. Cells were cultured at 37 °C in air–5% CO2, colony formation assessed after 5 days and colonies counted at 14 days and classified into non-red cell containing colonies (CFUGM and occasional CFU-M) and red cell containing colonies (CFUGEMM and occasional BFU-E).

Endothelial colony forming unit assay The endothelial colony forming unit (CFU) potential of PVE, nonPVE and unsorted liver cells was assessed using a methylcellulosebased CFU assay specific for human endothelial progenitor cell culture (Endocult Complete, Stem Cell Technologies, Vancouver, Canada). The method was a modification of that by Hill et. al. recommended for non-adherent peripheral blood mononuclear cells separated by density gradient centrifugation. Sorted PVE, non-PVE and unsorted cells were washed in sterile PBS and resuspended in 600 µl aliquots of Endocult Complete (Stem Cell Technologies) supplemented with 50 U/ml penicillin and 50 μg/ ml streptomycin. A 300-µl aliquot was dispensed into one well of a 24 well plate (Corning), coated previously with 50 μg/ml cellular fibronectin (Sigma) and the remaining 300 µl diluted 1:1 with Endocult Complete. This process was repeated to give 5 doublingdilutions of cell number for each sample tested. Cells were cultured at 37 °C in air–5% CO2 and colony formation assessed after 5 days.

Epithelial differentiation of PVE cells Epithelial differentiation of PVE cells was assessed using culture conditions specific for hepatocytic differentiation. Sorted PVE cells were seeded onto 8 well chambered culture slides (Nunc A/S, Roskilde, Denmark) previously coated with Matrigel (BD Biosciences, Bedford, MA), according to manufacturer's instructions. Cells were cultured in WME+ supplemented with 20 ng/ml oncostatin-M (OSM, R and D systems, Minneapolis, MN) and

1640

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 6 37 – 1 64 7

Table 4 – Antibodies used for Immunofluorescence. Antibody

Concentration

Species

Manufacturer

Zenon Alexa Fluor

CK18 CK19 Ecadherin Dlk/pref-1 Albumin Fibrinogen

1/50 1/50 1/50

Mouse Mouse Mouse

Dako Dako Dako

488 594 488

1/20 1/50 1/50

Mouse Mouse Mouse

R and D Abcam Sigma

488 488 594

10 ng/ml hepatocyte growth factor (HGF, Peprotech, Rocky Hill, HJ) and maintained at 37 °C in air–5% CO2 until cell confluence reached over 2–4 weeks, depending in initial plating density.

Immunofluorescence of cultured PVE cells Culture cells were evaluated for epithelial differentiation by immunofluorescent labelling for epithelial-specific protein (Table 4). Chambered culture wells were rinsed twice in prewarmed 37 °C sterile PBS and cells fixed in 300 μl per well of icecold 90%acetone/10% methanol for 10 min on ice. After washing cells 3 times in TBS, non-specific antibody binding was blocked with serum-free protein blocking solution (DAKO) for 30 min and cells washed as before. Following this, antibodies conjugated using Zenon Alexa Fluor 488 or Zenon Alexa Fluor 594 IgG1 (IgG2b for Dlk/pref-1) labelling kits, according to manufacturer's instructions and at concentrations optimized previously (52), were incubated with cells for 1 h in the dark at room temperature. After washing 3 times in TBS, chambers were removed and slides mounted using Prolong Gold Anti-fade with DAPI (Invitrogen Molecular Probes) and data captured with Openlab imaging software (Improvision, Coventry, UK). Controls used included staining as described with Zenon Alexa Fluor 488- or 594-conjugated isotype-matched negative control antibody.

Results Characterisation of PVE PVE was characterised by immunohistochemistry to identify surface markers suitable for cell sorting and to establish cellular differentiation potential in terms of the haematopoietic, endothelial and epithelial lineages (Fig. 1). The haematopoietic progenitor cell marker CD34 was expressed by sinusoidal endothelium and occasional presumptive HPCs within sinusoids. Thy-1 expression

was less widespread and although not present on sinusoidal endothelium, was expressed by intra-sinusoidal haematopoietic cells and, where present, portal tract mesenchyme. Importantly, CD34 and Thy-1 were both strongly localised on PVE. Since these markers were expressed on endothelial structures, the expression pattern of the endothelial marker CD31 was evaluated. Similar to CD34, expression of CD31 by haematopoietic parenchymal cells and developing sinusoidal endothelium was evident, with pronounced expression on PVE. Therefore, because co-localisation of Thy-1, CD34 and CD31 appeared restricted to PVE, this triple-positive phenotype was selected for later PVE isolation by FACS. Since PVE co-expression of Thy-1 and CD34 was indicative of an HPC phenotype, the expression of committed erythroid and lymphoid haematopoietic lineage markers was assessed. Expression of the leukocyte common antigen CD45 and the erythroid lineage marker glycophorin-A was widespread in the haematopoietic compartment within developing sinusoids and, in the case of glycophorin-A, developing portal structures in portal vessels. However, neither lineage marker was evident on PVE. In order to evaluate whether PVE might possess an epithelial differentiation capacity, expression of acknowledged epithelial makers, including hepatoblast, hepatocyte and cholangiocytespecific proteins, were examined. Although PVE expression of the hepatoblast and cholangiocyte-specific marker CK19 was not observed, some PVE cells did express the hepatoblast and hepatocyte-specific marker CK18. However, PVE did not express the hepatoblast-specific marker dlk/pref-1 or epithelial lineage marker E-cadherin. Taken together, these characterisation data suggested that whilst PVE may possess a haematopoietic and/or endothelial progenitor function, a subset of PVE cells might harbour a capacity for epithelial differentiation.

Fluorescence-activated cell sorting and RT-PCR analysis of PVE In order to isolate PVE cells, FACS of liver tissue was performed and gene expression of sorted PVE cells analysed (Fig. 2). Although freshly isolated 1st trimester human liver (gestation 60.1 ± 3.6 days, n = 39) was used where possible, this was rare and limitations on tissue availability meant liver cell culture was typically necessary (culture time 3.6 ± 2.5 days). Very occasionally, cultured preparations required to be pooled to generate sufficient cell numbers for sorting (2.3 ± 0.5 livers, n = 7). Of those liver cells expressing Thy-1 (9.4± 7.3%, n = 32), only a small fraction co-expressed CD34 and CD31, indicating a PVE phenotype (0.7 ± 0.6%, n = 32). Furthermore, fewer Thy-1-positive cells co-expressed CD34 than did not (Table 5). However, a greater number of Thy-1/CD34 dual-positive cells expressed CD31 (the PVE

Fig. 1 – Immunohistochemistry of portal venous structures in 1st trimester human liver for haematopoietic progenitor (Thy-1, CD34), endothelial (CD31), committed lymphoid (CD45) or erythroid (Glycophorin-A (Glyc-A)) and epithelial-specific (CK19, CK18, Dlk/pref-1, E-cadherin) markers. The haematopoietic progenitor markers Thy-1 (shown in frozen section) and CD34 are strongly expressed by PVE (red arrows). Occasional Thy-1-positive or CD34-positive presumptive HPCs are visible within sinusoids (black arrows). Developing sinusoidal endothelium expresses CD34 (yellow arrows). The endothelial marker CD31 is strongly expressed by PVE (red arrows), occasional haematopoietic cells within sinusoids (black arrows) and developing sinusoidal endothelium (yellow arrows). Whilst haematopoietic CD45 expression was less abundant than Glycophorin-A (black arrows), PVE did not express either marker (green arrows). Hepatoblasts (blue arrows in CK19, CK18, Dlk/pref-1 and E-cadherin images), with large pale-staining nuclei, abundant cytoplasm and squared morphology, express the hepatoblast markers CK19, CK18, Dlk/pref-1 and E-cadherin. Whilst PVE does not express CK19, Dlk/pref-1 or E-cadherin (green arrows), CK18 is expressed by many PVE cells (red arrows).

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 6 3 7– 1 64 7

1641

1642

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 6 37 – 1 64 7

Fig. 2 – (A–C) FACS of PVE involved identifying live Thy-1/CD34/CD31 triple-positive cells based on forward and side-scatter characteristics in foetal liver (A) with positive gating of cells expressing PE-conjugated Thy-1 (B). Gated Thy-1-positive cells expressing FITC-conjugated CD34 and/or Alexa Fluor 647-conjugated CD31 were then gated accordingly (C). Only those PVE cells forming a distinct population (white box in C labelled CD34+ CD31+) were collected for in vitro analysis. Non-PVE cells were Thy-1-positive cells not expressing CD34 or CD31 (blue box in C). (D) Overall, the proportion of cells expressing Thy-1 was less than 10% of the total liver cell population, whereas PVE cells comprised less than 1%. Error bars indicate standard deviation. Comparisons between values in the text are given as fold-change differences between corresponding means. (E) Sorted PVE cells were evaluated for expression of mRNA for the epithelial-specific markers CK18 and CK19 and the endothelial specific marker VEGFR2, compared with sorted non-PVE cells and unsorted 1st (T1) and 2nd (T2) trimester liver. PVE expressed mRNA for CK18 but not CK19. VEGFR2 mRNA was abundantly expressed in PVE compared with non-PVE cells. –RT signifies control reaction without addition of reverse transcriptase.

phenotype) than Thy-1-positive/CD34-negative cells (9.6-fold increase), whereas this pattern was reversed for CD34 expression on Thy-1-positive/CD31-negative cells (6.5-fold increase). To evaluate PVE mRNA expression, sorted PVE cells were compared with sorted cells expressing Thy-1 but not CD34 or CD31 (non-PVE cells). In keeping with immunohistochemistry findings, PVE expressed mRNA for CK18 but not CK19. Of interest, non-PVE cells in 1st and 2nd trimester foetal liver expressed both

Table 5 CD34+ (%) Total CD31+ CD31-

41.0 (± 19.0 n = 29) 21.1 (± 10.8 n = 29) 9.2 (± 8.3 n = 29)

CD34− (%) Total CD31+ CD31-

66.5 (± 19.0 n = 29) 2.2 (± 1.8 n = 29) 59.8 (± 22.5 n = 29)

Table showing CD34 and/or CD31 expression in Thy-1-positive cells expressed as a percentage of overall Thy-1 expression. Values are given as an average with standard deviation (±) and number of livers analysed (n=) indicated in brackets. Comparisons between values in the text are given as fold-change differences between corresponding means.

CK18 and CK19. Messenger RNA expression for the vascular endothelial marker VEGFR2 was also investigated, showing this to be enriched in sorted PVE cells when compared with non-PVE cells.

PVE haematopoietic and endothelial progenitor capacity In order to assess whether the PVE phenotype conferred a capacity for haematopoietic or endothelial progenitor activity, sorted PVE cells were evaluated for haematopoietic and endothelial colonyforming unit (CFU) ability, compared with non-PVE and unsorted liver cells (Fig. 3). PVE cells were highly enriched for haematopoietic progenitor activity when compared with non-PVE cells (12.0-fold increase) including non-red and red cell forming colonies (10.8-fold and 87.8-fold increase, respectively). However, PVE was not enriched overall for haematopoietic CFU ability compared with unsorted liver cells (4.0-fold increase) and had a comparatively lesser capacity for red cell colony formation than unsorted populations (proportional 2.0-fold increase). In comparison to the overall haematopoietic progenitor capability of unsorted cells, liver endothelial progenitor function was greatly reduced (47.4-fold reduction). Surprisingly, PVE cells

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 6 3 7– 1 64 7

1643

Fig. 3 – (A) Sorted PVE cells were evaluated for haematopoietic colony forming ability for non-red and red colonies. Although PVE possessed a greater capacity for haematopoietic colony formation than non-PVE cells, PVE was not enriched overall for haematopoietic progenitor activity, including non-red (yellow bars) and red (red bars) cell containing colonies. (B–E) Examples (×10 magnification) of sorted PVE cells initially suspended singly in methylcellulose haematopoietic colony forming assays (B), generating colonies containing red (erythroid) cells (C) and non-red cells (D–E). Red cell colonies were principally CFU-GEMM (C) with occasional BFU-E (not shown), whilst non-red colonies were mainly CFU-GM (D) with less frequent CFU-M (E). (F) The endothelial progenitor capacity of liver predominated in the unsorted cell population and sorted PVE cells had virtually no endothelial progenitor capability. Error bars indicate standard deviation. Comparisons between values in the text are given as fold-change differences between corresponding means. exhibited no endothelial progenitor capability. Overall, endothelial progenitor activity appeared to be enriched in the unsorted, rather than the non-PVE population (3.3-fold increase).

PVE epithelial progenitor capacity PVE mRNA and protein expression of CK18, but not CK19, indicated a potential for epithelial differentiation. Therefore, the capacity of PVE

to express hepatoblast, hepatocyte and cholangiocyte protein under conditions favouring epithelial differentiation was investigated. Initially, after placement in culture, cells were small and round with scant cytoplasm (Fig. 4). However, after 48 h cells became adherent and following 7 days in culture some cells developed a hepatoblastic appearance, with a squared morphology, enlarged nucleus and abundant, intensely granular cytoplasm. Additionally, some cells exhibited a spindled morphology and appearance similar to

Fig. 4 – Light microscopic analysis of PVE epithelial culture during the first 7 days revealed that sorted PVE cells were initially small and round with scant cytoplasm (Day 0). Following adherence after 48 h, cells generated 2 principal morphological types in the first week (Day 2 and Day 7 images). Some cells developed a hepatoblastic appearance, with a squared morphology, large nucleus and abundant, granular cytoplasm (white arrows). Others displayed a spindled, mesenchymal-like morphology (black arrows).

1644

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 6 37 – 1 64 7

Fig. 5 – PVE cells were cultured in conditions specific for epithelial differentiation. (A) Cultured cells all co-expressed CK18 and CK19, indicating a hepatoblast phenotype. Values given in ×60 images represent mean ± standard deviation percentage of cells expressing the corresponding marker(s). Values in parentheses represent mean ± standard deviation percentage of CK18+ CK19- (CK18 image) or CK19+ CK18- (CK19 image) cells, respectively. (B) Cultured cells all expressed the hepatoblast marker Dlk/pref-1 and displayed intermittent surface expression of E-cadherin. Albumin and fibrinogen generation, indicating epithelial differentiation, was also evident. Occasional cells were polynuclear in keeping with normal hepatocytic morphology (white arrow—albumin images). Green—Zenon Alexa Fluor 488. Red—Zenon Alexa Fluor 594. All nuclei stained with DAPI. Values given in X60 images represent mean ± standard deviation percentage of cells expressing the corresponding marker.

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 6 3 7– 1 64 7

mesenchymal cells. Depending on initial plating density, cells were allowed to reach confluence over 2–4 weeks and epithelial protein expression then assessed by immunofluorescence. All cultured cells continued to express CK18, but co-expressed this marker with CK19, indicating a bi-potential hepatoblast phenotype (Fig. 5). Furthermore, cells expressed the hepatoblast-specific marker Dlk/pref-1. The epithelial lineage marker E-cadherin was expressed only intermittently on the surface and in the cytoplasm of adjacent cells, perhaps in response to limited cell–cell contact. Albumin and fibrinogen, liver-specific proteins produced by hepatoblasts and differentiated hepatocytes, were abundantly expressed.

Discussion This study provides the first evidence that, in the developing human liver, a proportion of PVE cells express epithelial-specific protein which, under suitable conditions, confers a capacity for epithelial differentiation generating cells with a hepatoblast-like phenotype. The findings described also demonstrate that PVE cells can initiate haematopoiesis by virtue of their haematopoietic progenitor phenotype. Therefore, PVE cells share phenotypic and functional similarities with adult LPCs, whilst recapitulating the behaviour of dorsal aortic haemogenic endothelium. Recent work has improved understanding of the foundation of haematopoiesis in the avian, rodent and human embryo [34–37]. The observation that primitive HPCs appear to be derived from haemogenic endothelial cells of the dorsal aorta highlights a crucial developmental relationship between these populations. The current study sought to explore this important association following transition of the haematopoietic niche to the developing liver. Dorsal aortic endothelium and PVE appeared to share phenotypic similarities, in that both express CD31, CD34 and VEGFR2, but not CD45 [36]. Therefore, the capacity for haematopoietic and endothelial progenitor function by PVE was assessed. PVE cells had the capability to initiate haematopoiesis, although this was not enriched in comparison to unsorted liver cells, suggesting that PVE is a potential rather than the primary source of HPCs in developing human liver. Indeed, this principal role is likely served by migrated dorsal aortic haematopoietic progenitors. Nonetheless, the ability of foetal hepatic endothelial cells expressing CD34 and CD31 to generate haematopoietic colonies is corroborated elsewhere, although no subset analysis was performed and their anatomical location in developing liver was not determined [37]. Perhaps surprisingly, PVE cells exhibited no endothelial progenitor activity, which was conserved in non-PVE and unsorted populations. Preliminary human data from later weeks 11–12 aortic tissue suggest that an endothelial population expressing CD133, CD34 and VEGFR2 can generate endothelial cells in vitro [54]. In that study, however, cells expressing CD31 were excluded in an attempt to discard more mature, non-progenitor endothelium and inclusion of this marker in the current study might in part explain the observed absence of any PVE endothelial progenitor capability. Furthermore, it remains possible that the endothelial progenitor assay employed was not specific for PVE and appeared to act instead on alternative liver endothelial progenitor populations. Indeed, a less stringently sorted heterogeneous endothelial cell population, isolated from developing liver on the basis of CD34 but not CD45 expression, was able to establish endothelial cultures under different conditions, although this study did not characterise any progenitor fraction or

1645

quantify endothelial progenitor frequency [37]. In contrast, it was the endothelial progenitor capacity of PVE which was assessed in the present study, rather than the ability of PVE to simply establish endothelial cultures. Therefore, whilst endothelial progenitor cells exist in developing liver, their characterisation and the conditions required for in vitro activity remain poorly understood. In summary, it would appear that PVE is a mature, established endothelial population with the capacity to supplement haematopoiesis where necessary. Taken together, these findings suggest that haemogenic attributes are conserved between aortic and portal endothelium, although any contribution of PVE to haematopoiesis in the developing human liver appears restricted and remains of uncertain importance in vivo. The intermediate filament proteins CK18 and CK19 are constitutively expressed by hepatoblasts. During hepatoblast differentiation, CK18 is retained by hepatocytes whilst CK19 expression becomes restricted to ductal plate cholangiocytes [21,30,31,55]. In the current study, many in situ PVE cells expressed CK18 and sorted PVE contained CK18 mRNA. However, no CK19 protein or mRNA expression by PVE cells was identified. Therefore, selective PVE CK18 expression suggested that while some PVE cells might harbour an epithelial differentiation capacity, they lacked the epithelial bilineage potential of hepatoblasts. Nevertheless, following culture under in vitro conditions favouring epithelial differentiation, virtually all sorted PVE cells coexpressed CK18 and CK19, indicating a hepatoblast-like phenotype. In combination with this, a vast majority of cells also expressed the hepatoblast markers Dlk/Pref-1, E-cadherin, albumin and fibrinogen. Conversely, almost no cultured PVE cells exhibited CK19 expression in the absence of other hepatoblast or hepatocyte markers, indicating that conditions in vitro favoured hepatoblast/hepatocyte rather than cholangiocyte survival. While these findings suggest that PVE cells have the capacity for epithelial differentiation, PVE progeny consisted of cells with varying morphology, rather than typical hepatoblasts or hepatocytes. Indeed, the pattern of E-cadherin expression in cultured PVE cells was intermittent and not cell-surface restricted, in contrast to that observed on hepatoblasts in situ in this and previous work [30]. Improving epithelial maturation in this regard will require an understanding of the cellular differentiation signals governing epithelial fate decisions by PVE cells. It is unclear what, if any, contribution PVE might make to the epithelial lineage during liver development in vivo. Indeed, it is accepted that the ventral endoderm is principally responsible for the first epithelial cells in developing liver [32,33]. On the other hand, findings contained herein might provide some explanation as to the origin and phenotype of hepatic progenitor cells in adult liver. For example, the expression of haematopoietic markers on adult hepatic progenitor cells has previously led some authors to speculate that, following appropriate hepatic insult, HPCs are recruited from bone marrow and trans-differentiate into biliary epithelium and hepatocytes [41–47]. However, any such relationship has been extensively challenged and is now not thought to have functional significance in liver regeneration after injury [48–51]. Instead, in light of the observations described, any haematopoietic origin for adult LPCs might extend from haematopoiesis in the developing liver, where HPC progeny would reside quiescently from liver organogenesis until required for adult liver regeneration. Indeed, previous work has shown that CD34 is co-expressed with an epithelial pancytokeratin marker on cells in the region of the ductal plate in developing liver—the future location of the Canals of

1646

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 6 37 – 1 64 7

Hering [56,57]. Furthermore, in investigating the behaviour of cells of the side population in developing human liver, the authors of the current study demonstrated a lineage relationship between haematopoietic and epithelial cells [58]. In summary, with respect to the epithelial lineage, the shared phenotypic and functional attributes of PVE and adult LPCs highlight the possibility of a temporal relationship between these populations, originating from foetal liver haematopoiesis. Whilst this concept requires a more extensive analysis, including PVE clonogenic studies for epithelial progeny, the persistence of foetal liver-derived progenitors in adult liver might explain the parallels observed in regenerative and developmental liver events [52]. Further exploration of the relationship between endothelial, haematopoietic and epithelial lineage generation in developing liver will provide key information regarding the derivation of hepatic progenitor cells in humans and may assist in the generation of novel, cellular therapies for liver disease.

Conflict of interest statement The authors declare that no competing financial interests exist.

Acknowledgments The authors would like to thank Professor John Iredale, Professor of Medicine, University of Edinburgh, for critical review of the data, Joan Crieger and Anne Saunderson for patient recruiting and consent, Dr Andrew Childs for assistance with tissue harvest and Shonna McCall for provision of FACS support. This work was generously funded through fellowship award by Medical Research Scotland and The Royal College of Surgeons of Edinburgh to JDT and an RCUK fellowship to DCH. REFERENCES

[1] M. Alison, Liver stem cells: a two compartment system, Curr. Opin. Cell Biol. 10 (6) (1998) 710–715. [2] T.G. Bird, S. Lorenzini, S.J. Forbes, Activation of stem cells in hepatic diseases, Cell Tissue Res. 331 (1) (2008) 283–300. [3] R.P. Evarts, P. Nagy, E. Marsden, S.S. Thorgeirsson, A precursor-product relationship exists between oval cells and hepatocytes in rat liver, Carcinogenesis 8 (11) (1987) 1737–1740. [4] N. Fausto, J.S. Campbell, K.J. Riehle, Liver regeneration, Hepatology 43 (2 Suppl 1) (2006) S45–S53. [5] N.D. Theise, R. Saxena, B.C. Portmann, S.N. Thung, H. Yee, L. Chiriboga, A. Kumar, J.M. Crawford, The canals of Hering and hepatic stem cells in humans, Hepatology 30 (6) (1999) 1425–1433. [6] A.N. De, G. Hudson, A.D. Burt, C.P. Day, P.F. Chinnery, Human liver stem cells originate from the canals of Hering, Hepatology 50 (3) (2009) 992–993. [7] A.W. Duncan, C. Dorrell, M. Grompe, Stem cells and liver regeneration, Gastroenterology 137 (2) (2009) 466–481. [8] M. Oertel, D.A. Shafritz, Stem cells, cell transplantation and liver repopulation, Biochim. Biophys. Acta 1782 (2) (2008) 61–74. [9] S. Paku, J. Schnur, P. Nagy, S.S. Thorgeirsson, Origin and structural evolution of the early proliferating oval cells in rat liver, Am. J. Pathol. 158 (4) (2001) 1313–1323. [10] S. Sell, Electron microscopic identification of putative liver stem cells and intermediate hepatocytes following periportal necrosis induced in rats by allyl alcohol, Stem Cells 15 (5) (1997) 378–385.

[11] S.D. Sackett, Z. Li, R. Hurtt, Y. Gao, R.G. Wells, K. Brondell, K.H. Kaestner, L.E. Greenbaum, Foxl1 is a marker of bipotential hepatic progenitor cells in mice, Hepatology 49 (3) (2009) 920–929. [12] U. Baumann, H.A. Crosby, P. Ramani, D.A. Kelly, A.J. Strain, Expression of the stem cell factor receptor c-kit in normal and diseased pediatric liver: identification of a human hepatic progenitor cell? Hepatology 30 (1) (1999) 112–117. [13] H.A. Crosby, D.A. Kelly, A.J. Strain, Human hepatic stem-like cells isolated using c-kit or CD34 can differentiate into biliary epithelium, Gastroenterology 120 (2) (2001) 534–544. [14] R. Devos, V. Desmet, Ultrastructural characteristics of novel epithelial-cell types identified in human pathological liver specimens with chronic ductular reaction, Am. J. Pathol. 140 (6) (1992) 1441–1450. [15] O. Falkowski, H.J. An, I.A. Ianus, L. Chiriboga, H. Yee, A.B. West, N.D. Theise, Regeneration of hepatocyte 'buds' in cirrhosis from intrabiliary stem cells, J. Hepatol. 39 (3) (2003) 357–364. [16] L. Libbrecht, T. Roskams, Hepatic progenitor cells in human liver diseases, Semin. Cell Dev. Biol. 13 (6) (2002) 389–396. [17] T. Roskams, Progenitor cell involvement in cirrhotic human liver diseases: from controversy to consensus, J. Hepatol. 39 (3) (2003) 431–434. [18] P. Jelnes, E. Santoni-Rugiu, M. Rasmussen, S.L. Friis, J.H. Nielsen, N. Tygstrup, H.C. Bisgaard, Remarkable heterogeneity displayed by oval cells in rat and mouse models of stem cell-mediated liver regeneration, Hepatology 45 (6) (2007) 1462–1470. [19] H.C. Bisgaard, U. Holmskov, E. Santoni-Rugiu, P. Nagy, O. Nielsen, P. Ott, E. Hage, K. Dalhoff, L.J. Rasmussen, N. Tygstrup, Heterogeneity of ductular reactions in adult rat and human liver revealed by novel expression of deleted in malignant brain tumor 1, Am. J. Pathol. 161 (4) (2002) 1187–1198. [20] M.B. Herrera, S. Bruno, S. Buttiglieri, C. Tetta, S. Gatti, M.C. Deregibus, B. Bussolati, G. Camussi, Isolation and characterization of a stem cell population from adult human liver, Stem Cells 24 (12) (2006) 2840–2850. [21] Y. Haruna, K. Saito, S. Spaulding, M.A. Nalesnik, M.A. Gerber, Identification of bipotential progenitor cells in human liver development, Hepatology 23 (3) (1996) 476–481. [22] N.M. Masson, I.S. Currie, J.D. Terrace, O.J. Garden, R.W. Parks, J.A. Ross, Hepatic progenitor cells in human fetal liver express the oval cell marker Thy-1, Am. J. Physiol. Gastrointest. Liver Physiol. 291 (1) (2006) G45–G54. [23] S. Nava, M. Westgren, M. Jaksch, A. Tibell, U. Broome, B.G. Ericzon, S. Sumitran-Holgersson, Characterization of cells in the developing human liver, Differentiation 73 (5) (2005) 249–260. [24] P. Nyamath, A. Alvi, A. Habeeb, S. Khosla, A.A. Khan, C.M. Habibullah, Characterization of hepatic progenitors from human fetal liver using CD34 as a hepatic progenitor marker, World J. Gastroenterol. 13 (16) (2007) 2319–2323. [25] E. Schmelzer, L. Zhang, A. Bruce, E. Wauthier, J. Ludlow, H.L. Yao, N. Moss, A. Melhem, R. McClelland, W. Turner, M. Kulik, S. Sherwood, T. Tallheden, N. Cheng, M.E. Furth, L.M. Reid, Human hepatic stem cells from fetal and postnatal donors, J. Exp. Med. 204 (8) (2007) 1973–1987. [26] E. Schmelzer, E. Wauthier, L.M. Reid, The phenotypes of pluripotent human hepatic progenitors, Stem Cells 24 (8) (2006) 1852–1858. [27] H.C. Fiegel, J.J. Park, M.V. Lioznov, A. Martin, S. Jaeschke-Melli, P.M. Kaufmann, B. Fehse, A.R. Zander, D. Kluth, Characterization of cell types during rat liver development, Hepatology 37 (1) (2003) 148–154. [28] D. Nierhoff, A. Ogawa, M. Oertel, Y.Q. Chen, D.A. Shafritz, Purification and characterization of mouse fetal liver epithelial cells with high in vivo repopulation capacity, Hepatology 42 (1) (2005) 130–139. [29] N. Tanimizu, M. Nishikawa, H. Saito, T. Tsujimura, A. Miyajima, Isolation of hepatoblasts based on the expression of Dlk/Pref-1, J. Cell Sci. 116 (Pt 9) (2003) 1775–1786. [30] J.D. Terrace, I.S. Currie, D.C. Hay, N.M. Masson, R.A. Anderson, S.J. Forbes, R.W. Parks, J.A. Ross, Progenitor cell characterization and

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 6 3 7– 1 64 7

[31]

[32]

[33] [34] [35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

location in the developing human liver, Stem Cells Dev. 16 (5) (2007) 771–778. P. Van Eyken, R. Sciot, F. Callea, S.K. van der, P. Moerman, V.J. Desmet, The development of the intrahepatic bile ducts in man: a keratin-immunohistochemical study, Hepatology 8 (6) (1988) 1586–1595. F.P. Lemaigre, Mechanisms of liver development: concepts for understanding liver disorders and design of novel therapies, Gastroenterology 137 (1) (2009) 62–79. K.S. Zaret, Hepatocyte differentiation: from the endoderm and beyond, Curr. Opin. Genet. Dev. 11 (5) (2001) 568–574. C. Durand, E. Dzierzak, Embryonic beginnings of adult hematopoietic stem cells, Haematologica 90 (1) (2005) 100–108. E.T. Zambidis, E. Oberlin, M. Tavian, B. Peault, Blood-forming endothelium in human ontogeny: lessons from in utero development and embryonic stem cell culture, Trends Cardiovasc. Med. 16 (3) (2006) 95–101. M. Tavian, B. Peault, The changing cellular environments of hematopoiesis in human development in utero, Exp. Hematol. 33 (9) (2005) 1062–1069. E. Oberlin, M. Tavian, I. Blazsek, B. Peault, Blood-forming potential of vascular endothelium in the human embryo, Development 129 (17) (2002) 4147–4157. M. Omori, N. Omori, R.P. Evarts, T. Teramoto, S.S. Thorgeirsson, Coexpression of flt-3 ligand flt-3 and SCF/c-kit signal transduction systems in bile-duct-ligated sl and w mice, Am. J. Pathol. 150 (4) (1997) 1179–1187. B.E. Petersen, B. Grossbard, H. Hatch, L.Y. Pi, J. Deng, E.W. Scott, Mouse A6-positive hepatic oval cells also express several hematopoietic stem cell markers, Hepatology 37 (3) (2003) 632–640. C.B. Rountree, L. Barsky, S. Ge, J. Zhu, S. Senadheera, G.M. Crooks, A CD133-expressing murine liver oval cell population with bilineage potential, Stem Cells 25 (10) (2007) 2419–2429. Y. Yamada, E. Nishimoto, H. Mitsuya, Y. Yonemura, In vitro transdifferentiation of adult bone marrow Sca-1+ cKit- cells cocultured with fetal liver cells into hepatic-like cells without fusion, Exp. Hematol. 34 (1) (2006) 97–106. S. Yamazaki, K. Miki, K. Hasegawa, M. Sata, T. Takayama, M. Makuuchi, Sera from liver failure patients and a demethylating agent stimulate transdifferentiation of murine bone marrow cells into hepatocytes in coculture with nonparenchymal liver cells, J. Hepatol. 39 (1) (2003) 17–23. M.R. Alison, R. Poulsom, R. Jeffery, A.P. Dhillon, A. Quaglia, J. Jacob, M. Novelli, G. Prentice, J. Williamson, N.A. Wright, Cell differentiation—hepatocytes from nonhepatic adult stem cells, Nature 406 (6793) (2000) 257. B.E. Petersen, W.C. Bowen, K.D. Patrene, W.M. Mars, A.K. Sullivan, N. Murase, S.S. Boggs, J.S. Greenberger, J.P. Goff, Bone marrow as a potential source of hepatic oval cells, Science 284 (5417) (1999) 1168–1170. E. Lagasse, H. Connors, M. Al Dhalimy, M. Reitsma, M. Dohse, L. Osborne, X. Wang, M. Finegold, I.L. Weissman, M. Grompe,

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

[55] [56]

[57]

[58]

1647

Purified hematopoietic stem cells can differentiate into hepatocytes in vivo, Nat. Med. 6 (11) (2000) 1229–1234. S.H. Oh, R.P. Witek, S.H. Bae, D. Zheng, Y. Jung, A.C. Piscaglia, B.E. Petersen, Bone marrow-derived hepatic oval cells differentiate into hepatocytes in 2-acetylaminofluorene/partial hepatectomy-induced liver regeneration, Gastroenterology 132 (3) (2007) 1077–1087. N.D. Theise, M. Nimmakayalu, R. Gardner, P.B. Illei, G. Morgan, L. Teperman, O. Henegariu, D.S. Kruse, Liver from bone marrow in humans, Hepatology 32 (1) (2000) 11–16. A. Menthena, N. Deb, M. Oertel, P.N. Grozdanov, J. Sandhu, S. Shah, C. Guha, D.A. Shafritz, M.D. Dabeva, Bone marrow progenitors are not the source of expanding oval cells in injured liver, Stem Cells 22 (6) (2004) 1049–1061. C.B. Rountree, X. Wang, S. Ge, L. Barsky, J. Zhu, I. Gonzales, G.M. Crooks, Bone marrow fails to differentiate into liver epithelium during murine development and regeneration, Hepatology 45 (5) (2007) 1250–1260. S.S. Thorgeirsson, J.W. Grisham, Hematopoietic cells as hepatocyte stem cells: a critical review of the evidence, Hepatology 43 (1) (2006) 2–8. X. Wang, H. Willenbring, Y. Akkari, Y. Torimaru, M. Foster, M. Al-Dhalimy, E. Lagasse, M. Finegold, S. Olson, M. Grompe, Cell fusion is the principal source of bone-marrow-derived hepatocytes, Nature 422 (6934) (2003) 897–901. L. Zhang, N. Theise, M. Chua, L.M. Reid, The stem cell niche of human livers: symmetry between development and regeneration, Hepatology 48 (5) (2008) 1598–1607. L. Gerrard, L. Rodgers, W. Cui, Differentiation of human embryonic stem cells to neural lineages in adherent culture by blocking bone morphogenetic protein signaling, Stem Cells 23 (9) (2005) 1234–1241. G. Invernici, C. Emanueli, P. Madeddu, S. Cristini, S. Gadau, A. Benetti, E. Ciusani, G. Stassi, M. Siragusa, R. Nicosia, C. Peschle, U. Fascio, A. Colombo, T. Rizzuti, E. Parati, G. Alessandri, Human fetal aorta contains vascular progenitor cells capable of inducing vasculogenesis, angiogenesis, and myogenesis in vitro and in a murine model of peripheral ischemia, Am. J. Pathol. 170 (6) (2007) 1879–1892. T. Roskams, V. Desmet, Embryology of extra- and intrahepatic bile ducts, the ductal plate, Anat. Rec. (Hoboken) 291 (6) (2008) 628–635. K. Blakolmer, K. Jaskiewicz, H.A. Dunsford, S.C. Robson, Hematopoietic stem cell markers are expressed by ductal plate and bile duct cells in developing human liver, Hepatology 21 (6) (1995) 1510–1516. E.R. Lemmer, E.G. Shepard, K. Blakolmer, R.E. Kirsch, S.C. Robson, Isolation from human fetal liver of cells co-expressing CD34 haematopoietic stem cell and CAM 5.2 pancytokeratin markers, J. Hepatol. 29 (3) (1998) 450–454. J.D. Terrace, D.C. Hay, K. Samuel, C. Payne, R.A. Anderson, I.S. Currie, R.W. Parks, S.J. Forbes, J.A. Ross, Side population cells in developing human liver are primarily haematopoietic progenitor cells, Exp. Cell Res. 315 (13) (2009) 2141–2153.