- Email: [email protected]
Positive regulation of the NADPH oxidase NOX4 promoter in vascular smooth muscle cells by E2F
Free Radical Biology & Medicine 45 (2008) 679–685
Contents lists available at ScienceDirect
Free Radical Biology & Medicine j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / f r e e r a d b i o m e d
Original Contribution
Positive regulation of the NADPH oxidase NOX4 promoter in vascular smooth muscle cells by E2F Li Zhang, Olivia R. Sheppard, Ajay M. Shah, Alison C. Brewer ⁎ Cardiovascular Division, King's College London British Heart Foundation Centre, James Black Centre, 125 Coldharbour Lane, London SE5 9NU, UK
a r t i c l e
i n f o
Article history: Received 21 April 2008 Revised 19 May 2008 Accepted 20 May 2008 Available online 29 May 2008 Keywords: NOX4 Transcriptional regulation Promoter Vascular smooth muscle E2F
a b s t r a c t The generation of reactive oxygen species (ROS) by the NOX family of NADPH oxidases is known to be involved in the regulation of many physiological cellular functions. Unlike other members of this family, NOX4 generates ROS constitutively without the need for a stimulus. The activity of NOX4 is known to be regulated, at least in part, at the level of mRNA expression. However, nothing is known of the molecular mechanisms which underlie its transcriptional regulation. We have therefore determined the transcriptional initiation site of NOX4 in vascular smooth muscle cells (VSMC) and identified NOX4 genomic sequences necessary to effect high levels of expression of a linked luciferase reporter gene in both rat and mouse VSMCs. A potential binding site for members of the E2F family of transcription factors was identified, and electrophoretic mobility-shift assays (EMSA) and chromatin immunoprecipitation (ChIP) assays confirmed that this site binds E2F1 both in vitro and in vivo. siRNA against E2F1 decreased NOX4 promoter activity, while site-specific mutation of the core-binding site both downregulated the NOX4 promoter and abolished transregulation by E2F1. These data therefore demonstrate that E2F factor(s) are positive regulators of NOX4 transcription in VSMCs. © 2008 Elsevier Inc. All rights reserved.
Introduction Reactive oxygen species (ROS) such as superoxide (O-2) and hydrogen peroxide (H2O2) are well known to act as critical intracellular signaling molecules which regulate both physiological and pathophysiological cellular processes [1–3]. Although ROS are generated as by-products of many intracellular enzymic reactions, the NOX family of NADPH oxidases represents the only known enzyme system whose primary biological function is to produce ROS [4]. In rodents the NOX family comprises four isoforms which display distinct patterns of tissue specificity. The prototype phagocytic oxidase, NOX2, is a membranebound enzyme that generates superoxide by the reduction of molecular oxygen using NADPH (or potentially NADH) as the electron donor [5]. Other family members are believed to act in a similar fashion [4,6]. However, different mechanisms of regulation and/or subcellular localisation appear to be associated with the different isoforms, which are often co-expressed within the same cell type. Many studies have now demonstrated the importance of NOXs in vascular cell biology [1]. Within rodent VSMCs, the two main NOX isoforms that are present, namely NOX1 and NOX4 [7], appear to direct distinct cellular functions. Thus NOX1 has been shown to correlate
Abbreviations: Cdks, cyclin-dependent kinases; ChIP, chromatin immunoprecipitation; mASMCs, mouse aortic smooth muscle cells; ROS, reactive oxygen species; VSMC, vascular smooth muscle cells. ⁎ Corresponding author. Fax: +1 44 207 5193. E-mail address: [email protected] (A.C. Brewer). 0891-5849/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.freeradbiomed.2008.05.019
with, and promote VSMC proliferation [8,9], while NOX4 has been demonstrated to be required for maintenance of the differentiated phenotype [8]. Unlike NOX1, which is known to require a stimulus for its activation, NOX4 generates ROS constitutively [10]. In addition, changes in NOX4 mRNA levels appear to drive changes in NOX4 activity [11]. Taken together, these data suggest that the regulation of the rate of transcription of NOX4 is an important determinant of its activity and therefore function. However, no information is currently available on the regulation of the NOX4 promoter. In the present paper, we report the mapping of the NOX4 transcriptional initiation site (CAP site) in rodent VSMCs, and identify a positively acting proximal genomic element which is conserved between rat and mouse species. We further demonstrate that E2F factor(s) bind directly to a canonical binding site within this region to effect, at least in part, this positive regulation. Materials and methods Materials Anti-human E2F1 polyclonal antibody was purchased from Santa Cruz (sc-193X). siRNAs were purchased from Ambion. Cell culture A7r5 VSMCs and HEK-293 cells were obtained from the ECACC and ATCC, respectively. Primary mouse aortic smooth muscle cells
680
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
Total RNA from cell cultures was isolated using the SV total RNA isolation kit (Promega) according to the manufacturer's specifications. The 5′ ends of the rat NOX4 transcripts were amplified using the SMART RACE cDNA amplification kit (Clontech) as described previously [12]. cDNA was prepared from total RNA isolated from A7r5 cells. Two gene-specific, nested “antisense” primers were designed to the rat NOX4 cDNA sequence (derived from the ensemble genome browser: www.ensembl.org) for sequential PCR amplification: (both 5′–3′) CAGGCCCGGAACAGTTGTGAAG, and AAATAGTTATGCCACAGG.
GAATTGGTACCAAGTCACTGAACACCGATTA; for -196 bp, GAATTGGTACCGCTTCCGATTCCATTCT; for -95 bp GAATTGGTACCAACCGCCGCCACAACAAC; for -73 bp, GAATTGGTACCTCGCGCGAGACAAAGGGGCT; for -51 bp, GAATTGGTACCCGCAGGGCGGCGCGCGGG; and for -22 bp GAATTGGTACCTGGGGAGGCAAGGGAGCA. The common reverse primer used was 5′-GGAATACGCGTGGAGTGCTGCGCCCTGCTCG-3′. After restriction with KpnI and MluI, fragments were subcloned into the KpnI–MluI cloning sites upstream of the luciferase gene in the reporter vector, pGL3 Basic (Promega). Site-specific mutants were generated by the splicing-overlap extension PCR technique as described previously [12,13]. Complementary pairs of primers, including mutations (marked in bold) were designed as follows (sense strands only indicated). For -196E2FMut and -196dMut, respectively, 5′-AACAACAGGCTCATAGGAGACAAAGGGGCTGGCGCAGGGCGGCGC-3′, and 5′-AACAACAGGCTCATAGGAGATTAGAGGGCTGGCGCAGGGCGGCGC-3′.
Generation of promoter-luciferase reporter clones
Transfections and luciferase assays
The Pac clone RP24-350GI, which comprises the mouse NOX4 locus, was obtained from the BACPAC Resources Center, CHORI. Using this as a template, genomic NOX4 promoter fragments were generated by PCR with Pfu DNA polymerase (Promega). All forward primers incorporated a KpnI restriction into their 5′ ends, while the common reverse primer incorporated a MluI restriction site. Forward primers were as follows (all 5′ to 3′): for -3332 bp, GAATTGGTACCATCCTTATGTGACTATTG; for -1896 bp, GGAATGGTACCATGGCTTTGGAAACAAACCT; for -798 bp,
Transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendations, essentially as described previously [12,14]. A7r5 and mASMCs were transfected in 24-well plates with a constant amount of 1 μg total DNA, including 200 ng reference plasmid (pRL-SV40, Promega). Cells were lysed after 24 h, and promoter activity was assayed as described previously [12,14]. For the siRNA experiments, each transfection reaction comprised 600 ng test plasmid, 200 ng reference plasmid and
(mASMCs) were a kind gift of Dr Richard Siow (King's College London); passages 8–12 were used for experiments reported here. All cells were maintained as described previously for A7r5 cells [12]. RNA isolation and 5′RACE
Fig. 1. Identification of rat NOX4 transcription initiation site (CAP site). (A) Gene-specific PCR product amplified by 5′RACE reaction is arrowed. M; molecular weight marker. (B) sequence homology of rat and mouse NOX4 proximal promoter regions, spanning the rat NOX4 CAP site. The most upstream CAP site detected is indicated as an arrow. Other putative CAP sites are marked with asterisks. Nucleotides marked by shaded boxes mark the 5′ boundaries of the rat and mouse NOX4 transcripts identified previously (www.ensembl.org). The bold line at −13 bp relative to the translation initiator codon (marked in bold), and +163 bp relative to the CAP site, represents the 3′ boundary of all the promoter constructs generated.
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
20pmol E2F1-specific (or control) siRNA. The sequences of the E2F1 siRNA duplex were as follows (both 5′ to 3′): sense AUAGCAUGAUUCAUACUCUtt; antisense AGAGUAUGAAUCAUGCUAUtc. Cells were lysed and assayed after 48 h. Electrophoretic mobility-shift assays Nuclear extracts were prepared from HEK-293 cells using the NEPER kit (Pierce), according to the manufacturer's specifications, and aliquots were stored at -80 °C. Sequences of the oligonucleotides are indicated in Fig. 4. Complementary oligonucleotides were annealed and radiolabeled, and EMSAs were performed as described previously [12,14]. In immunoinhibition assays, 2 μg of the E2F1 antibody was incubated with the protein extract for 30 min, prior to the addition of the DNA probe.
681
promoter were (forward and reverse, respectively): 5′-ATGTCTGCAGCTGGACAGG-3′ and 5′-CGAGGGTCAAAGGCTGTACT-3′, and for the TNF-α receptor I promoter, 5′-CTTGGCCCTCTCCTCACTCC-3′ and 5′GAGAAGCTGAAAGTCAGAGG-3′. “Hot Start” PCR conditions were as follows: 95 °C for 5 min, then 33 cycles 95 °C for 30 s, 55 °C (for NOX4) or 58 °C (TNF-α receptor I) for 30 s, and 72 °C for 30 s, followed by 72 °C for 7 min. In the NOX4 reaction, the buffer included 1 M Betaine (Sigma). Aliquots of chromatin were also analysed before immunoprecipitation and served as an input control. Statistics Data are expressed as means ± SE. Statistical analyses were performed by one-way ANOVA, and P b 0.05 using the Bonferroni post hoc test was considered significant.
Chromatin immunoprecipitation (ChIP) assays
Results
ChIP assays were performed using the EZ-ChIP kit (Upstate), essentially according to the manufacturer's instructions, and as described previously [15]. Immunoprecipitations were performed using 3 μg anti-E2F1 or (as a positive control) anti-acetyl histone H3 (provided in the kit). Negative controls with normal IgG and no antibody were also conducted. Primers used to amplify the NOX4
Identification of the rat NOX4 transcription initiation site (CAP site) in vascular smooth muscle cells We initially mapped the CAP site(s) of NOX4 in the rat aortic VSMC line, A7r5, by 5′RACE. We chose to map the CAP site in a cell line rather than in cells from primary cultures to avoid any possibility of
Fig. 2. Identification and deletion analysis of the mouse NOX4 promoter. (A and B) Transcriptional activity of a deletion series of mouse NOX4 promoter-luciferase reporter constructs from −3332 to −22 bp (relative to the identified CAP site) in A7r5 and mASMCs, respectively. (C and D) Transcriptional activity of a further deletion series from −196 to −22 bp in A7r5 and mASMCs, respectively. In each case the relative luciferase activity (RLA) is shown, compared to that resulting from the cotransfected reference plasmid, pRL-SV40, and represents the average of duplicate measurements on triplicate biological samples. The luciferase activity resulting from the control, promoterless vector, pGL3-Basic, was set to1.0 in all cases. (E) Rat and mouse genomic sequence, spanning the region shown to be functionally important in C and D. Arrows indicate potential E2F-binding sites; a potential SOX-binding motif is indicated as a shaded box.
682
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
contamination, since NOX4 is known to be expressed in other vascular cell types [16,17]. A discrete band corresponding to several closely clustered cDNA 5′ends was isolated and cloned (arrowed in Fig. 1A). The positions of the CAP sites were aligned to the rat genomic sequence (Fig. 1B), and were found to be contiguous with known rat NOX4 cDNA sequence (www.ensembl.org/Rattus_norvegicus/index. html), indicating a lack of any additional, more upstream 5′ exons. The most 5′ CAP site identified is marked, and corresponds to -175 bp relative to the start of translation. No core promoter elements such as a TATA box, TFIIB recognition element, or initiator sequence (reviewed in [18]) are apparent within the proximal sequences. However, the CAP sites are contained within a 500-bp region that is highly GC rich (approx 70%), and includes multiple CpG dinucleotides, characteristic of “CpG islands.” Such CpG islands are typically known to contain promoters in which transcription initiates from multiple weak start sites [19]. The genomic sequences of the rat and mouse NOX4 loci are highly homologous (approximately 80%) within the promoter region shown in Fig. 1. In addition, the position of the rat NOX4 CAP site, described here, is in good agreement with that identified in primary mouse cardiac microvascular cells (unpublished data). We therefore believe the position of the mouse NOX4 CAP site in VSMCs to be at, or very close to, the position mapped here within the rat gene. Characterisation of the proximal NOX4 promoter In order to identify the functional NOX4 promoter, we generated a panel of 5′ deletions of an approximately 3.5-kb mouse genomic fragment from the NOX4 locus, which spanned the identified CAP sites. The 3′ boundary of the genomic fragment was kept constant in each case, and corresponds to +163 bp, relative to the most upstream CAP site (and -13 bp relative to the translational start site, as indicated in Fig. 1B). All fragments were tested for their ability to drive expression of a linked luciferase reporter gene, in transient transfections into both A7r5 cells and primary mouse aortic smooth muscle
cells (mASMCs). As shown in Figs. 2A and B, maximal luciferase gene expression was directed by a promoter fragment comprising sequences to -196 bp relative to the most 5′ CAP site. Deletion to -22 bp resulted in a significant decrease in luciferase activity in both cases. More distal sequences between -196 and -798 bp had no effect in A7r5 cells, but had a significantly repressive effect in mASMCs. The significance of this result is not clear, but may reflect a species and/or stage-specific difference in the origin of the two cell types. In both cases more upstream genomic regions between -798 and -3332 bp did not significantly affect luciferase expression. To characterise the positively acting sequences downstream of -196 bp in more detail, we generated a further panel of deletion constructs, and again transfected these into both A7r5 and mASMCs. As shown in Figs. 2C and D, the sequences between -73 and -51 bp were found to cis-activate luciferase expression most significantly in both cases. To determine potential transcription factor-binding sites, we analysed this positively acting sequence using two different bioinformatic programmes: CONSITE (asp.ii.uib.no:8090/cgi-bin/ CONSITE/consite) and TFSEARCH (www.cbrc.jp/research/db/ TFSEARCH.html). Two potential binding sites were identified within this region, which were conserved between the two rodent species. The first is a putative binding site for the E2F family of transcription factors. This consensus motif is TTTG/G C /CCGC, where the core-binding element is the GC-rich G/G C /CCGC motif [20]. As indicated in Fig. 2E, the potential E2F-core-binding site identified here possesses a dyad symmetry, as is characteristic of many other characterised sites [21,22]; thus E2F could potentially bind in either orientation. The sequence in the antisense strand, however, better fits the full consensus motif. In addition, a putative binding site for members of the SRY-related high-mobility group (HMG) box (SOX) family of transcription factors is identified, which partially overlaps the E2F-like binding site. The defined consensus sequence in this case is A A /T /TCAAA/TG [23]. It should be noted therefore that neither the putative E2F nor SOX-binding sites fit their defined consensus sequences perfectly. Nonetheless, there are numerous examples in
Fig. 3. Effects of site-specific mutations in putative E2F- and SOX-binding sites on transcriptional activity. (A and B) Transcriptional activity of the “wild-type” −196-bp deletion construct, compared to that of −196E2FMut, in which the core “E2F”-binding site has been mutated and −196dMut in which both the core “E2F”- and “SOX”-binding sites have been mutated, in A7r5 cells and mASMCs, respectively. The RLAs shown are calculated as for Fig. 2. A schematic representation of the sequences mutated is indicated. The putative E2F and SOX-core-binding sites are marked as a bold line and a shaded box, respectively. The nucleotides targeted for mutation in the “E2F”-binding site are marked with asterisks, and those mutated in the “SOX”-binding site are underlined. The nucleotides to which they are mutated are shown in italics.
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
683
Fig. 4. E2F1 can bind to the NOX4 promoter in vitro. (A and B) EMSAs using a radiolabeled double-stranded (ds) oligonucleotide probe, comprising NOX4 promoter sequence (−81 to −51 relative to CAP site); wtE2F(−81/−51), and nuclear extracts isolated from HEK 293 cells, with no competitor (A and B lane 2), or with a 100-fold excess of unlabeled wtE2F(−81/ −51) probe (A and B, lane 3), mutE2F(−81/−51) (A, lane 4), a ds oligonucleotide comprising an Sp1-binding site (A, lane 5) or wtE2F(−81/−63) (B, lane 4). (A) Lane 6; immunoinhibition assay using an E2F1-specific antibody. Lane 1 is free probe, not incubated with extract in A and B. The position of the E2F-shifted band is arrowed in A and B. The sequences of all oligonucleotides are indicated and the putative E2F-binding site is underlined.
the literature of functional binding sites for these factors which similarly do not match the canonical binding site completely [24,25]. The functional significance of the potential E2F and SOX-binding sites in the activation of NOX4 expression was investigated by sitespecific mutagenesis of the “core” sites in the context of the -196-bp promoter construct which was shown to direct maximal expression in both A7r5 and mVSMCs. As shown in Fig. 3, mutation of the core E2Fbinding site from (in the sense strand) CGCGC to CATAG significantly reduced expression in both A7r5 and mASMCs. By contrast, mutation of the SOX-core-binding site from CAAAG to TTAGA did not decrease promoter (data not shown). In addition mutations within both core sites acted to reduce only slightly further the levels of luciferase expression, compared to mutation of the E2F core site alone (compare lanes 3 and 4 in both panels). These data therefore suggest that the E2F canonical binding site acts to cis-activate NOX4 transcription but that the putative SOX-binding site does not act as a positive transcriptional regulator in VSMCs.
excess of the unlabeled oligonucleotide (compare lanes 2 and 3), but not by a consensus Sp1-binding site (lane 5). That this binding activity includes an E2F factor is suggested since “self-competition” for binding was inhibited where the “E2F-core” sequences were mutated as indicated (lane 4; “mutE2F(-81/-51)”). In addition, preincubation with a specific E2F1 antibody significantly inhibited the formation of this large complex (lane 6), indicating that E2F1 (at least) is able to bind to this region. Although the E2F consensus binding site is necessary for binding, it alone is not sufficient to form this high molecular weight complex. Thus incubation of nuclear extract with an oligonucleotide comprising just the “E2F” core site, but not the adjacent 3′ sequences did not generate this slow migrating band (data not shown). In addition unlabeled competition with this truncated
E2F1 can bind the NOX4 promoter in vitro We investigated the ability of this region to bind E2F family members in vitro using nuclear extracts isolated from HEK-293 cells (human embryonic kidney cells). The E2F family of transcription factors comprises eight family member genes (E2F1–8) [26], which are widely expressed in most cell types including HEK-293 cells [27], and all of which recognise the consensus described above. To determine whether the E2F consensus motif identified in the NOX4 promoter could indeed bind to E2F factor(s) we performed EMSAs using a double-stranded oligonucleotide comprising the E2F-like core site (“wtE2F(-81/-51)”). As shown in Fig. 4A, we typically detected a complicated pattern of binding to this region, including a very high molecular weight complex (arrowed). The specificity of this binding complex is demonstrated in that it could be largely competed by an
Fig. 5. ChIP analysis to detect in vivo association of E2F1 to the mouse NOX4 promoter. Formaldehyde cross-linked chromatin prepared from mASMCs was incubated with no antibody (No Ab), normal rabbit IgG (negative control), anti acetyl-histone H3 (positive control), or anti-E2F1 as indicated. Aliquots of chromatin before immunoprecipitation served as an input control (A and B lanes 1 and 2). Purified DNA was analysed using primers specific for either the NOX4 promoter region or the TNF-αreceptor I promoter region. The results presented are representative of multiple experiments.
684
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
Fig. 6. Site-specific mutation of the E2F-core-binding site blocks transregulation by E2F1 in A7r5 cells. (A) Transcriptional activity of the wild-type −196-bp construct (lanes 1 and 2), or the −196-bp construct in which E2F-core-binding site has been mutated, as indicated in Fig. 3 (lanes 3 and 4), cotransfected with control, scrambled siRNA (lanes 1 and 3), or E2F1specific siRNA (lanes 2 and 4). The RLAs are calculated as for Figs. 2 and 3, and are each expressed as a percentage of the activity of −196 bp under control conditions. (B) Percentage reduction of activity, resultant on E2F1-specific siRNA, on −196 bp and −196E2F Mut. Regression analyses demonstrated this change to be statistically significant.
oligonucleotide (“wt E2F(-81/-63)” in Fig. 4B, lane 4) did not inhibit the formation of the large complex. These data therefore suggest that E2F protein(s) can bind to this putative cognate site within the NOX4 promoter. E2F1 binds to the NOX4 promoter in vivo We next sought to determine whether E2F does bind to the NOX4 promoter under physiological conditions, in VSMCs in vivo. We confirmed the expression of E2F family members, including E2F1 in both A7r5 cells and mASMCs by qPCR (data not shown). We then performed ChIP assays, using the same antibody to E2F1 as used in the EMSAs. As shown in Fig. 5, we demonstrated specific binding of E2F1 to the NOX4 promoter, but not to a region of the TNF-α receptor I promoter, which acted as a negative control. As expected, both genomic regions were shown to bind acetylated histone, H3. The specificity of the binding of E2F1 was further demonstrated, as neither immunoprecipitation using normal rabbit IgG nor an absence of antisera resulted in an enrichment of the NOX4 promoter. Effect of altered E2F1 expression on NOX4 promoter activity We finally investigated the effects of altered expression of E2F1 on the activity of the NOX4 promoter using siRNAs specifically designed to rat E2F1. We showed by qPCR that we could reduce E2F1 mRNA levels in A7r5 cells using the specific siRNAs by N60% (data not shown). We therefore cotransfected the -196-bp wild-type promoter construct into A7r5 cells together with E2F1-targetted (or control) siRNAs. As shown in Fig. 6, inhibition of E2F1 expression significantly reduced the activity of the -196-bp wild-type Nox4 promoter (panel A compare lanes 1 and 2). Moreover mutation of the E2F1-binding site abolished the effect of E2F1 inhibition (panel A, lanes 3 and 4). The percentage reduction effected by the E2F1-siRNA in both cases is displayed in panel B. Thus E2F1 acts through its identified cognate site to regulate positively NOX4 transcription. Discussion We describe here the first identification and characterisation of the NOX4 promoter in any cell type or species. We found all the 5′untranslated mRNA sequence to be contained within one exon that included the translational start site. An additional, more 5′ exon has been identified in the mouse NOX4 gene and is described on the Ensemble genome browser (http://www.ensembl.org/Mus_musculus/ index.html). However, the only reported source of a transcript
containing this exon is a mouse kidney cDNA library (Clone No. AI956716), and we did not detect such a transcript in these VSMCs. We demonstrate that, as we recently found to be the case for NOX1, the positively acting promoter element(s) in the NOX4 gene are found very proximal to the CAP site [12]. In particular we identified a small 22-bp sequence which was necessary for strong promoter activity in VSMCs that included a consensus binding site for E2F which we show acts to regulate NOX4 transcription positively. The E2F family of transcription factors comprises eight family members, all of which are widely expressed and recognise the same consensus binding site [26]. They have been demonstrated to be pivotal regulators of transcription which mediate many critical cellular functions including cell cycle progression, mitosis, apoptosis, and differentiation (for review, see [26]). The eight gene family members give rise to (at least) nine proteins (as E2F3 encodes two proteins through the use of alternative promoters), which can be divided into two groups, based on whether they dimerise with one of three DP proteins. Thus, E2F1-6 function as heterodimers with a DP family member, while E2F7 and E2F8 bind as homodimers to the consensus site [26,28]. In addition, the transcriptional activities of E2F1-5 (but not E2F6–8) are modulated by association with the retinoblastoma protein (Rb) or other related “pocket” proteins: p107 and p130 [26]. These members of the Rb family are known to be key regulators of E2F activity during the cell cycle (reviewed in [29]). In their hypophosphorylated form, Rb proteins can bind E2F factors and hence prevent their interaction with gene promoter regions. The phosphorylation of Rb proteins, however, acts to release the E2F proteins and allows them to act as transcription factors. The phosphorylation status and hence activity of the Rb proteins can in turn be regulated by cyclin-dependent kinases (Cdks). Most notably, phosphorylation of Rb proteins by Cdks which function at the G1/S transition (Cdk4/6 and Cdk2) is required to drive the ordered transition into S phase (reviewed in [30]). Several mechanisms are known to regulate the activity of Cdks, including expression of the genes themselves, posttranslational modification by phosphorylation/ dephosphorylation cascades, interactions with protein inhibitors, and degredation by the ubiquitin/proteasome pathway (reviewed in [31]). Thus the function of E2Fs can be regulated by the cell at many levels. The E2F family members have been further categorised into several subclasses based on both their structural properties and their transcriptional regulatory properties on model target gene promoters. Thus, of E2F factors known to be regulated by pocket proteins, E2F1, E2F2, and E2F3a are often referred to as transcriptional “activators,” while E2F3b, 4, and 5 are considered to be transcriptional “repressors.” However, the overexpression of, for instance, E2F1 has been shown by
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
microarray analysis to result in the downregulation of almost as many genes as are upregulated, while E2F4 and E2F5 have been shown to transcriptionally activate some target gene promoters (reviewed in [26]). Thus, this classification is overly simplistic, and the function of any E2F factor on any target gene promoter is likely to be cell- and gene-context dependent. The E2F site identified here in the NOX4 promoter was shown to cis-regulate NOX4 expression in a positive fashion. The involvement of E2F1 in the regulation of NOX4 through this site was demonstrated in that E2F1 siRNA was shown to decrease promoter activity only when this site was intact. We cannot, however, rule out the possibility that other E2F factors are also involved, potentially at different stages in the cell cycle and/or different states of cellular differentiation. In a recent study of mASMCs it was shown that the both the levels of the different E2F protein isoforms and their association with the pocket proteins are dependent on the proliferative status of the cells [32]. In addition, the so-called activator E2Fs, E2F1, and E2F3 acted as growthpromoting factors and induced increased proliferation leading to intimal hyperplasia in a mouse model of venous bypass grafting. By contrast the repressors E2F and E2F4 acted as a growth-suppressing factor to inhibit intimal hyperplasia. It has been shown by ChIP studies that different E2F factors can be recruited to the same promoter at different stages of the cell cycle to elicit different transcriptional effects [33]. The E2F-binding site in the NOX4 promoter may therefore, at least in part, mediate changes in NOX4 expression which have been shown to be dependent on the differentiation/proliferation status of VSMCs [8,34,35]. This is now the topic of further studies in our laboratory. The positively acting element described here also included a potential binding site for members of the SOX family of transcription factors. Although mutation of this site did not act to down-regulate the NOX4 promoter activity in these experiments, we do not rule out the possibility that this site may be involved in the cell-type-specific and/or differentiation-state-specific regulation of NOX4 expression. In summary, this study identifies proximal genomic sequences within the NOX4 promoter which act to regulate positively NOX4 expression in VSMCs and demonstrate the involvement of E2F in this promoter activation. Since changes in NOX4 mRNA levels appear to effect changes in NOX4 enzymic activity, targeting transcriptional regulators of this gene may be a useful approach for manipulating NOX4 activity and hence the intracellular oxidation state. Acknowledgments We thank Dr. Richard Siow for mASMCs. This research was supported by British Heart Foundation Grants PG/06/013/20291 and CVH/99001, and by a KC Wong Scholarship to L.Z. References [1] Clempus, R. E.; Griendling, K. K. Reactive oxygen species signaling in vascular smooth muscle cells. Cardiovasc. Res. 71:216–225; 2006. [2] Su, B.; Mitra, S.; Gregg, H.; Flavahan, S.; Chotani, M. A.; Clark, K. R.; GoldschmidtClermont, P. J.; Flavahan, N. A. Redox regulation of vascular smooth muscle cell differentiation. Circ. Res. 89:39–46; 2001. [3] Touyz, R. M. Reactive oxygen species and angiotensin II signaling in vascular cells — implications in cardiovascular disease. Braz. J. Med. Biol. Res. 37: 1263–1273; 2004. [4] Bedard, K.; Krause, K. H. The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol. Rev. 87:245–313; 2007. [5] Cross, A. R.; Segal, A. W. The NADPH oxidase of professional phagocytes— prototype of the NOX electron transport chain systems. Biochim. Biophys. Acta 1657:1–22; 2004. [6] Lambeth, J. D. NOX enzymes and the biology of reactive oxygen. Nat. Rev. Immunol. 4:181–189; 2004. [7] Lassegue, B.; Clempus, R. E. Vascular NAD(P)H oxidases: specific features, expression, and regulation. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285: R277–R297; 2003. [8] Clempus, R. E.; Sorescu, D.; Dikalova, A. E.; Pounkova, L.; Jo, P.; Sorescu, G. P.; Schmidt, H. H.; Lassegue, B.; Griendling, K. K. Nox4 is required for maintenance of the differentiated vascular smooth muscle cell phenotype. Arterioscler. Thromb. Vasc. Biol. 27:42–48; 2007.
685
[9] Lassegue, B.; Sorescu, D.; Szocs, K.; Yin, Q.; Akers, M.; Zhang, Y.; Grant, S. L.; Lambeth, J. D.; Griendling, K. K. Novel gp91phox homologues in vascular smooth muscle cells : nox1 mediates angiotensin II-induced superoxide formation and redox-sensitive signaling pathways. Circ. Res. 88:888–894; 2001. [10] Ambasta, R. K.; Kumar, P.; Griendling, K. K.; Schmidt, H. H.; Busse, R.; Brandes, R. P. Direct interaction of the novel Nox proteins with p22phox is required for the formation of a functionally active NADPH oxidase. J. Biol. Chem. 279:45935–45941; 2004. [11] Serrander, L.; Cartier, L.; Bedard, K.; Banfi, B.; Lardy, B.; Plastre, O.; Sienkiewicz, A.; Forro, L.; Schlegel, W.; Krause, K. H. NOX4 activity is determined by mRNA levels and reveals a unique pattern of ROS generation. Biochem. J. 406:105–114; 2007. [12] Brewer, A. C.; Sparks, E. C.; Shah, A. M. Transcriptional regulation of the NADPH oxidase isoform, Nox1, in colon epithelial cells:Role of GATA binding factor(s). Free Radic. Biol. Med. 40:260–274; 2005. [13] Horton, R. M.; Cai, Z. L.; Ho, S. N.; Pease, L. R. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. BioTechniques 8:528–535; 1990. [14] Alexandrovich, A.; Arno, M.; Patient, R. K.; Shah, A. M.; Pizzey, J. A.; Brewer, A. C. Wnt2 is a direct downstream target of GATA6 during early cardiogenesis. Mech. Dev. 123:297–311; 2006. [15] Zampetaki, A.; Zeng, L.; Xiao, Q.; Margariti, A.; Hu, Y.; Xu, Q. Lacking cytokine production in ES cells and ES-cell-derived vascular cells stimulated by TNF-alpha is rescued by HDAC inhibitor trichostatin A. Am. J. Physiol. Cell Physiol. 293: C1226–C1238; 2007. [16] Ago, T.; Kitazono, T.; Kuroda, J.; Kumai, Y.; Kamouchi, M.; Ooboshi, H.; Wakisaka, M.; Kawahara, T.; Rokutan, K.; Ibayashi, S.; Iida, M. NAD(P)H oxidases in rat basilar arterial endothelial cells. Stroke 36:1040–1046; 2005. [17] Haurani, M. J.; Pagano, P. J. Adventitial fibroblast reactive oxygen species as autacrine and paracrine mediators of remodeling: bellwether for vascular disease? Cardiovasc. Res. 75:679–689; 2007. [18] Butler, J. E.; Kadonaga, J. T. The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev. 16:2583–2592; 2002. [19] Suzuki, Y.; Tsunoda, T.; Sese, J.; Taira, H.; Mizushima-Sugano, J.; Hata, H.; Ota, T.; Isogai, T.; Tanaka, T.; Nakamura, Y.; Suyama, A.; Sakaki, Y.; Morishita, S.; Okubo, K.; Sugano, S. Identification and characterization of the potential promoter regions of 1031 kinds of human genes. Genome Res. 11:677–684; 2001. [20] Zheng, N.; Fraenkel, E.; Pabo, C. O.; Pavletich, N. P. Structural basis of DNA recognition by the heterodimeric cell cycle transcription factor E2F-DP. Genes Dev. 13:666–674; 1999. [21] Blake, M. C.; Azizkhan, J. C. Transcription factor E2F is required for efficient expression of the hamster dihydrofolate reductase gene in vitro and in vivo. Mol. Cell. Biol. 9:4994–5002; 1989. [22] Lam, E. W.; Watson, R. J. An E2F-binding site mediates cell-cycle regulated repression of mouse B-myb transcription. EMBO J. 12:2705–2713; 1993. [23] Wilson, M.; Koopman, P. Matching SOX: partner proteins and co-factors of the SOX family of transcriptional regulators. Curr. Opin. Genet. Dev. 12:441–446; 2002. [24] Bieda, M.; Xu, X.; Singer, M. A.; Green, R.; Farnham, P. J. Unbiased location analysis of E2F1-binding sites suggests a widespread role for E2F1 in the human genome. Genome Res. 16:595–605; 2006. [25] Jin, V. X.; O'Geen, H.; Iyengar, S.; Green, R.; Farnham, P. J. Identification of an OCT4 and SRY regulatory module using integrated computational and experimental genomics approaches. Genome Res. 17:807–817; 2007. [26] DeGregori, J.; Johnson, D. G. Distinct and overlapping roles for E2F family members in transcription, proliferation and apoptosis. Curr. Mol. Med. 6:739–748; 2006. [27] Woods, K.; Thomson, J. M.; Hammond, S. M. Direct regulation of an oncogenic micro-RNA cluster by E2F transcription factors. J. Biol. Chem. 282:2130–2134; 2007. [28] Xu, X.; Bieda, M.; Jin, V. X.; Rabinovich, A.; Oberley, M. J.; Green, R.; Farnham, P. J. A comprehensive ChIP-chip analysis of E2F1, E2F4, and E2F6 in normal and tumor cells reveals interchangeable roles of E2F family members. Genome Res. 17:1550–1561; 2007. [29] Sun, A.; Bagella, L.; Tutton, S.; Romano, G.; Giordano, A. From G0 to S phase: a view of the roles played by the retinoblastoma (Rb) family members in the Rb-E2F pathway. J. Cell. Biochem. 102:1400–1404; 2007. [30] Rothstein, E. C.; Lucchesi, P. A. Redox control of the cell cycle: a radical encounter. Antioxid. Redox Signal. 7:701–703; 2005. [31] Obaya, A. J.; Sedivy, J. M. Regulation of cyclin-Cdk activity in mammalian cells. Cell. Mol. Life Sci. 59:126–142; 2002. [32] Giangrande, P. H.; Zhang, J.; Tanner, A.; Eckhart, A. D.; Rempel, R. E.; Andrechek, E. R.; Layzer, J. M.; Keys, J. R.; Hagen, P. O.; Nevins, J. R.; Koch, W. J.; Sullenger, B. A. Distinct roles of E2F proteins in vascular smooth muscle cell proliferation and intimal hyperplasia. Proc. Natl. Acad. Sci. USA 104:12988–12993; 2007. [33] Takahashi, Y.; Rayman, J. B.; Dynlacht, B. D. Analysis of promoter binding by the E2F and pRB families in vivo: distinct E2F proteins mediate activation and repression. Genes Dev. 14:804–816; 2000. [34] Sturrock, A.; Cahill, B.; Norman, K.; Huecksteadt, T. P.; Hill, K.; Sanders, K.; Karwande, S. V.; Stringham, J. C.; Bull, D. A.; Gleich, M.; Kennedy, T. P.; Hoidal, J. R. Transforming growth factor-beta1 induces Nox4 NAD(P)H oxidase and reactive oxygen species-dependent proliferation in human pulmonary artery smooth muscle cells. Am. J. Physiol. Lung Cell Mol. Physiol. 290:L661–L673; 2006. [35] Sturrock, A.; Huecksteadt, T. P.; Norman, K.; Sanders, K.; Murphy, T. M.; Chitano, P.; Wilson, K.; Hoidal, J. R.; Kennedy, T. P. Nox4 mediates TGF-beta1-induced retinoblastoma protein phosphorylation, proliferation, and hypertrophy in human airway smooth muscle cells. Am. J. Physiol. Lung Cell Mol. Physiol. 292: L1543–L1555; 2007.
Contents lists available at ScienceDirect
Free Radical Biology & Medicine j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / f r e e r a d b i o m e d
Original Contribution
Positive regulation of the NADPH oxidase NOX4 promoter in vascular smooth muscle cells by E2F Li Zhang, Olivia R. Sheppard, Ajay M. Shah, Alison C. Brewer ⁎ Cardiovascular Division, King's College London British Heart Foundation Centre, James Black Centre, 125 Coldharbour Lane, London SE5 9NU, UK
a r t i c l e
i n f o
Article history: Received 21 April 2008 Revised 19 May 2008 Accepted 20 May 2008 Available online 29 May 2008 Keywords: NOX4 Transcriptional regulation Promoter Vascular smooth muscle E2F
a b s t r a c t The generation of reactive oxygen species (ROS) by the NOX family of NADPH oxidases is known to be involved in the regulation of many physiological cellular functions. Unlike other members of this family, NOX4 generates ROS constitutively without the need for a stimulus. The activity of NOX4 is known to be regulated, at least in part, at the level of mRNA expression. However, nothing is known of the molecular mechanisms which underlie its transcriptional regulation. We have therefore determined the transcriptional initiation site of NOX4 in vascular smooth muscle cells (VSMC) and identified NOX4 genomic sequences necessary to effect high levels of expression of a linked luciferase reporter gene in both rat and mouse VSMCs. A potential binding site for members of the E2F family of transcription factors was identified, and electrophoretic mobility-shift assays (EMSA) and chromatin immunoprecipitation (ChIP) assays confirmed that this site binds E2F1 both in vitro and in vivo. siRNA against E2F1 decreased NOX4 promoter activity, while site-specific mutation of the core-binding site both downregulated the NOX4 promoter and abolished transregulation by E2F1. These data therefore demonstrate that E2F factor(s) are positive regulators of NOX4 transcription in VSMCs. © 2008 Elsevier Inc. All rights reserved.
Introduction Reactive oxygen species (ROS) such as superoxide (O-2) and hydrogen peroxide (H2O2) are well known to act as critical intracellular signaling molecules which regulate both physiological and pathophysiological cellular processes [1–3]. Although ROS are generated as by-products of many intracellular enzymic reactions, the NOX family of NADPH oxidases represents the only known enzyme system whose primary biological function is to produce ROS [4]. In rodents the NOX family comprises four isoforms which display distinct patterns of tissue specificity. The prototype phagocytic oxidase, NOX2, is a membranebound enzyme that generates superoxide by the reduction of molecular oxygen using NADPH (or potentially NADH) as the electron donor [5]. Other family members are believed to act in a similar fashion [4,6]. However, different mechanisms of regulation and/or subcellular localisation appear to be associated with the different isoforms, which are often co-expressed within the same cell type. Many studies have now demonstrated the importance of NOXs in vascular cell biology [1]. Within rodent VSMCs, the two main NOX isoforms that are present, namely NOX1 and NOX4 [7], appear to direct distinct cellular functions. Thus NOX1 has been shown to correlate
Abbreviations: Cdks, cyclin-dependent kinases; ChIP, chromatin immunoprecipitation; mASMCs, mouse aortic smooth muscle cells; ROS, reactive oxygen species; VSMC, vascular smooth muscle cells. ⁎ Corresponding author. Fax: +1 44 207 5193. E-mail address: [email protected] (A.C. Brewer). 0891-5849/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.freeradbiomed.2008.05.019
with, and promote VSMC proliferation [8,9], while NOX4 has been demonstrated to be required for maintenance of the differentiated phenotype [8]. Unlike NOX1, which is known to require a stimulus for its activation, NOX4 generates ROS constitutively [10]. In addition, changes in NOX4 mRNA levels appear to drive changes in NOX4 activity [11]. Taken together, these data suggest that the regulation of the rate of transcription of NOX4 is an important determinant of its activity and therefore function. However, no information is currently available on the regulation of the NOX4 promoter. In the present paper, we report the mapping of the NOX4 transcriptional initiation site (CAP site) in rodent VSMCs, and identify a positively acting proximal genomic element which is conserved between rat and mouse species. We further demonstrate that E2F factor(s) bind directly to a canonical binding site within this region to effect, at least in part, this positive regulation. Materials and methods Materials Anti-human E2F1 polyclonal antibody was purchased from Santa Cruz (sc-193X). siRNAs were purchased from Ambion. Cell culture A7r5 VSMCs and HEK-293 cells were obtained from the ECACC and ATCC, respectively. Primary mouse aortic smooth muscle cells
680
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
Total RNA from cell cultures was isolated using the SV total RNA isolation kit (Promega) according to the manufacturer's specifications. The 5′ ends of the rat NOX4 transcripts were amplified using the SMART RACE cDNA amplification kit (Clontech) as described previously [12]. cDNA was prepared from total RNA isolated from A7r5 cells. Two gene-specific, nested “antisense” primers were designed to the rat NOX4 cDNA sequence (derived from the ensemble genome browser: www.ensembl.org) for sequential PCR amplification: (both 5′–3′) CAGGCCCGGAACAGTTGTGAAG, and AAATAGTTATGCCACAGG.
GAATTGGTACCAAGTCACTGAACACCGATTA; for -196 bp, GAATTGGTACCGCTTCCGATTCCATTCT; for -95 bp GAATTGGTACCAACCGCCGCCACAACAAC; for -73 bp, GAATTGGTACCTCGCGCGAGACAAAGGGGCT; for -51 bp, GAATTGGTACCCGCAGGGCGGCGCGCGGG; and for -22 bp GAATTGGTACCTGGGGAGGCAAGGGAGCA. The common reverse primer used was 5′-GGAATACGCGTGGAGTGCTGCGCCCTGCTCG-3′. After restriction with KpnI and MluI, fragments were subcloned into the KpnI–MluI cloning sites upstream of the luciferase gene in the reporter vector, pGL3 Basic (Promega). Site-specific mutants were generated by the splicing-overlap extension PCR technique as described previously [12,13]. Complementary pairs of primers, including mutations (marked in bold) were designed as follows (sense strands only indicated). For -196E2FMut and -196dMut, respectively, 5′-AACAACAGGCTCATAGGAGACAAAGGGGCTGGCGCAGGGCGGCGC-3′, and 5′-AACAACAGGCTCATAGGAGATTAGAGGGCTGGCGCAGGGCGGCGC-3′.
Generation of promoter-luciferase reporter clones
Transfections and luciferase assays
The Pac clone RP24-350GI, which comprises the mouse NOX4 locus, was obtained from the BACPAC Resources Center, CHORI. Using this as a template, genomic NOX4 promoter fragments were generated by PCR with Pfu DNA polymerase (Promega). All forward primers incorporated a KpnI restriction into their 5′ ends, while the common reverse primer incorporated a MluI restriction site. Forward primers were as follows (all 5′ to 3′): for -3332 bp, GAATTGGTACCATCCTTATGTGACTATTG; for -1896 bp, GGAATGGTACCATGGCTTTGGAAACAAACCT; for -798 bp,
Transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendations, essentially as described previously [12,14]. A7r5 and mASMCs were transfected in 24-well plates with a constant amount of 1 μg total DNA, including 200 ng reference plasmid (pRL-SV40, Promega). Cells were lysed after 24 h, and promoter activity was assayed as described previously [12,14]. For the siRNA experiments, each transfection reaction comprised 600 ng test plasmid, 200 ng reference plasmid and
(mASMCs) were a kind gift of Dr Richard Siow (King's College London); passages 8–12 were used for experiments reported here. All cells were maintained as described previously for A7r5 cells [12]. RNA isolation and 5′RACE
Fig. 1. Identification of rat NOX4 transcription initiation site (CAP site). (A) Gene-specific PCR product amplified by 5′RACE reaction is arrowed. M; molecular weight marker. (B) sequence homology of rat and mouse NOX4 proximal promoter regions, spanning the rat NOX4 CAP site. The most upstream CAP site detected is indicated as an arrow. Other putative CAP sites are marked with asterisks. Nucleotides marked by shaded boxes mark the 5′ boundaries of the rat and mouse NOX4 transcripts identified previously (www.ensembl.org). The bold line at −13 bp relative to the translation initiator codon (marked in bold), and +163 bp relative to the CAP site, represents the 3′ boundary of all the promoter constructs generated.
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
20pmol E2F1-specific (or control) siRNA. The sequences of the E2F1 siRNA duplex were as follows (both 5′ to 3′): sense AUAGCAUGAUUCAUACUCUtt; antisense AGAGUAUGAAUCAUGCUAUtc. Cells were lysed and assayed after 48 h. Electrophoretic mobility-shift assays Nuclear extracts were prepared from HEK-293 cells using the NEPER kit (Pierce), according to the manufacturer's specifications, and aliquots were stored at -80 °C. Sequences of the oligonucleotides are indicated in Fig. 4. Complementary oligonucleotides were annealed and radiolabeled, and EMSAs were performed as described previously [12,14]. In immunoinhibition assays, 2 μg of the E2F1 antibody was incubated with the protein extract for 30 min, prior to the addition of the DNA probe.
681
promoter were (forward and reverse, respectively): 5′-ATGTCTGCAGCTGGACAGG-3′ and 5′-CGAGGGTCAAAGGCTGTACT-3′, and for the TNF-α receptor I promoter, 5′-CTTGGCCCTCTCCTCACTCC-3′ and 5′GAGAAGCTGAAAGTCAGAGG-3′. “Hot Start” PCR conditions were as follows: 95 °C for 5 min, then 33 cycles 95 °C for 30 s, 55 °C (for NOX4) or 58 °C (TNF-α receptor I) for 30 s, and 72 °C for 30 s, followed by 72 °C for 7 min. In the NOX4 reaction, the buffer included 1 M Betaine (Sigma). Aliquots of chromatin were also analysed before immunoprecipitation and served as an input control. Statistics Data are expressed as means ± SE. Statistical analyses were performed by one-way ANOVA, and P b 0.05 using the Bonferroni post hoc test was considered significant.
Chromatin immunoprecipitation (ChIP) assays
Results
ChIP assays were performed using the EZ-ChIP kit (Upstate), essentially according to the manufacturer's instructions, and as described previously [15]. Immunoprecipitations were performed using 3 μg anti-E2F1 or (as a positive control) anti-acetyl histone H3 (provided in the kit). Negative controls with normal IgG and no antibody were also conducted. Primers used to amplify the NOX4
Identification of the rat NOX4 transcription initiation site (CAP site) in vascular smooth muscle cells We initially mapped the CAP site(s) of NOX4 in the rat aortic VSMC line, A7r5, by 5′RACE. We chose to map the CAP site in a cell line rather than in cells from primary cultures to avoid any possibility of
Fig. 2. Identification and deletion analysis of the mouse NOX4 promoter. (A and B) Transcriptional activity of a deletion series of mouse NOX4 promoter-luciferase reporter constructs from −3332 to −22 bp (relative to the identified CAP site) in A7r5 and mASMCs, respectively. (C and D) Transcriptional activity of a further deletion series from −196 to −22 bp in A7r5 and mASMCs, respectively. In each case the relative luciferase activity (RLA) is shown, compared to that resulting from the cotransfected reference plasmid, pRL-SV40, and represents the average of duplicate measurements on triplicate biological samples. The luciferase activity resulting from the control, promoterless vector, pGL3-Basic, was set to1.0 in all cases. (E) Rat and mouse genomic sequence, spanning the region shown to be functionally important in C and D. Arrows indicate potential E2F-binding sites; a potential SOX-binding motif is indicated as a shaded box.
682
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
contamination, since NOX4 is known to be expressed in other vascular cell types [16,17]. A discrete band corresponding to several closely clustered cDNA 5′ends was isolated and cloned (arrowed in Fig. 1A). The positions of the CAP sites were aligned to the rat genomic sequence (Fig. 1B), and were found to be contiguous with known rat NOX4 cDNA sequence (www.ensembl.org/Rattus_norvegicus/index. html), indicating a lack of any additional, more upstream 5′ exons. The most 5′ CAP site identified is marked, and corresponds to -175 bp relative to the start of translation. No core promoter elements such as a TATA box, TFIIB recognition element, or initiator sequence (reviewed in [18]) are apparent within the proximal sequences. However, the CAP sites are contained within a 500-bp region that is highly GC rich (approx 70%), and includes multiple CpG dinucleotides, characteristic of “CpG islands.” Such CpG islands are typically known to contain promoters in which transcription initiates from multiple weak start sites [19]. The genomic sequences of the rat and mouse NOX4 loci are highly homologous (approximately 80%) within the promoter region shown in Fig. 1. In addition, the position of the rat NOX4 CAP site, described here, is in good agreement with that identified in primary mouse cardiac microvascular cells (unpublished data). We therefore believe the position of the mouse NOX4 CAP site in VSMCs to be at, or very close to, the position mapped here within the rat gene. Characterisation of the proximal NOX4 promoter In order to identify the functional NOX4 promoter, we generated a panel of 5′ deletions of an approximately 3.5-kb mouse genomic fragment from the NOX4 locus, which spanned the identified CAP sites. The 3′ boundary of the genomic fragment was kept constant in each case, and corresponds to +163 bp, relative to the most upstream CAP site (and -13 bp relative to the translational start site, as indicated in Fig. 1B). All fragments were tested for their ability to drive expression of a linked luciferase reporter gene, in transient transfections into both A7r5 cells and primary mouse aortic smooth muscle
cells (mASMCs). As shown in Figs. 2A and B, maximal luciferase gene expression was directed by a promoter fragment comprising sequences to -196 bp relative to the most 5′ CAP site. Deletion to -22 bp resulted in a significant decrease in luciferase activity in both cases. More distal sequences between -196 and -798 bp had no effect in A7r5 cells, but had a significantly repressive effect in mASMCs. The significance of this result is not clear, but may reflect a species and/or stage-specific difference in the origin of the two cell types. In both cases more upstream genomic regions between -798 and -3332 bp did not significantly affect luciferase expression. To characterise the positively acting sequences downstream of -196 bp in more detail, we generated a further panel of deletion constructs, and again transfected these into both A7r5 and mASMCs. As shown in Figs. 2C and D, the sequences between -73 and -51 bp were found to cis-activate luciferase expression most significantly in both cases. To determine potential transcription factor-binding sites, we analysed this positively acting sequence using two different bioinformatic programmes: CONSITE (asp.ii.uib.no:8090/cgi-bin/ CONSITE/consite) and TFSEARCH (www.cbrc.jp/research/db/ TFSEARCH.html). Two potential binding sites were identified within this region, which were conserved between the two rodent species. The first is a putative binding site for the E2F family of transcription factors. This consensus motif is TTTG/G C /CCGC, where the core-binding element is the GC-rich G/G C /CCGC motif [20]. As indicated in Fig. 2E, the potential E2F-core-binding site identified here possesses a dyad symmetry, as is characteristic of many other characterised sites [21,22]; thus E2F could potentially bind in either orientation. The sequence in the antisense strand, however, better fits the full consensus motif. In addition, a putative binding site for members of the SRY-related high-mobility group (HMG) box (SOX) family of transcription factors is identified, which partially overlaps the E2F-like binding site. The defined consensus sequence in this case is A A /T /TCAAA/TG [23]. It should be noted therefore that neither the putative E2F nor SOX-binding sites fit their defined consensus sequences perfectly. Nonetheless, there are numerous examples in
Fig. 3. Effects of site-specific mutations in putative E2F- and SOX-binding sites on transcriptional activity. (A and B) Transcriptional activity of the “wild-type” −196-bp deletion construct, compared to that of −196E2FMut, in which the core “E2F”-binding site has been mutated and −196dMut in which both the core “E2F”- and “SOX”-binding sites have been mutated, in A7r5 cells and mASMCs, respectively. The RLAs shown are calculated as for Fig. 2. A schematic representation of the sequences mutated is indicated. The putative E2F and SOX-core-binding sites are marked as a bold line and a shaded box, respectively. The nucleotides targeted for mutation in the “E2F”-binding site are marked with asterisks, and those mutated in the “SOX”-binding site are underlined. The nucleotides to which they are mutated are shown in italics.
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
683
Fig. 4. E2F1 can bind to the NOX4 promoter in vitro. (A and B) EMSAs using a radiolabeled double-stranded (ds) oligonucleotide probe, comprising NOX4 promoter sequence (−81 to −51 relative to CAP site); wtE2F(−81/−51), and nuclear extracts isolated from HEK 293 cells, with no competitor (A and B lane 2), or with a 100-fold excess of unlabeled wtE2F(−81/ −51) probe (A and B, lane 3), mutE2F(−81/−51) (A, lane 4), a ds oligonucleotide comprising an Sp1-binding site (A, lane 5) or wtE2F(−81/−63) (B, lane 4). (A) Lane 6; immunoinhibition assay using an E2F1-specific antibody. Lane 1 is free probe, not incubated with extract in A and B. The position of the E2F-shifted band is arrowed in A and B. The sequences of all oligonucleotides are indicated and the putative E2F-binding site is underlined.
the literature of functional binding sites for these factors which similarly do not match the canonical binding site completely [24,25]. The functional significance of the potential E2F and SOX-binding sites in the activation of NOX4 expression was investigated by sitespecific mutagenesis of the “core” sites in the context of the -196-bp promoter construct which was shown to direct maximal expression in both A7r5 and mVSMCs. As shown in Fig. 3, mutation of the core E2Fbinding site from (in the sense strand) CGCGC to CATAG significantly reduced expression in both A7r5 and mASMCs. By contrast, mutation of the SOX-core-binding site from CAAAG to TTAGA did not decrease promoter (data not shown). In addition mutations within both core sites acted to reduce only slightly further the levels of luciferase expression, compared to mutation of the E2F core site alone (compare lanes 3 and 4 in both panels). These data therefore suggest that the E2F canonical binding site acts to cis-activate NOX4 transcription but that the putative SOX-binding site does not act as a positive transcriptional regulator in VSMCs.
excess of the unlabeled oligonucleotide (compare lanes 2 and 3), but not by a consensus Sp1-binding site (lane 5). That this binding activity includes an E2F factor is suggested since “self-competition” for binding was inhibited where the “E2F-core” sequences were mutated as indicated (lane 4; “mutE2F(-81/-51)”). In addition, preincubation with a specific E2F1 antibody significantly inhibited the formation of this large complex (lane 6), indicating that E2F1 (at least) is able to bind to this region. Although the E2F consensus binding site is necessary for binding, it alone is not sufficient to form this high molecular weight complex. Thus incubation of nuclear extract with an oligonucleotide comprising just the “E2F” core site, but not the adjacent 3′ sequences did not generate this slow migrating band (data not shown). In addition unlabeled competition with this truncated
E2F1 can bind the NOX4 promoter in vitro We investigated the ability of this region to bind E2F family members in vitro using nuclear extracts isolated from HEK-293 cells (human embryonic kidney cells). The E2F family of transcription factors comprises eight family member genes (E2F1–8) [26], which are widely expressed in most cell types including HEK-293 cells [27], and all of which recognise the consensus described above. To determine whether the E2F consensus motif identified in the NOX4 promoter could indeed bind to E2F factor(s) we performed EMSAs using a double-stranded oligonucleotide comprising the E2F-like core site (“wtE2F(-81/-51)”). As shown in Fig. 4A, we typically detected a complicated pattern of binding to this region, including a very high molecular weight complex (arrowed). The specificity of this binding complex is demonstrated in that it could be largely competed by an
Fig. 5. ChIP analysis to detect in vivo association of E2F1 to the mouse NOX4 promoter. Formaldehyde cross-linked chromatin prepared from mASMCs was incubated with no antibody (No Ab), normal rabbit IgG (negative control), anti acetyl-histone H3 (positive control), or anti-E2F1 as indicated. Aliquots of chromatin before immunoprecipitation served as an input control (A and B lanes 1 and 2). Purified DNA was analysed using primers specific for either the NOX4 promoter region or the TNF-αreceptor I promoter region. The results presented are representative of multiple experiments.
684
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
Fig. 6. Site-specific mutation of the E2F-core-binding site blocks transregulation by E2F1 in A7r5 cells. (A) Transcriptional activity of the wild-type −196-bp construct (lanes 1 and 2), or the −196-bp construct in which E2F-core-binding site has been mutated, as indicated in Fig. 3 (lanes 3 and 4), cotransfected with control, scrambled siRNA (lanes 1 and 3), or E2F1specific siRNA (lanes 2 and 4). The RLAs are calculated as for Figs. 2 and 3, and are each expressed as a percentage of the activity of −196 bp under control conditions. (B) Percentage reduction of activity, resultant on E2F1-specific siRNA, on −196 bp and −196E2F Mut. Regression analyses demonstrated this change to be statistically significant.
oligonucleotide (“wt E2F(-81/-63)” in Fig. 4B, lane 4) did not inhibit the formation of the large complex. These data therefore suggest that E2F protein(s) can bind to this putative cognate site within the NOX4 promoter. E2F1 binds to the NOX4 promoter in vivo We next sought to determine whether E2F does bind to the NOX4 promoter under physiological conditions, in VSMCs in vivo. We confirmed the expression of E2F family members, including E2F1 in both A7r5 cells and mASMCs by qPCR (data not shown). We then performed ChIP assays, using the same antibody to E2F1 as used in the EMSAs. As shown in Fig. 5, we demonstrated specific binding of E2F1 to the NOX4 promoter, but not to a region of the TNF-α receptor I promoter, which acted as a negative control. As expected, both genomic regions were shown to bind acetylated histone, H3. The specificity of the binding of E2F1 was further demonstrated, as neither immunoprecipitation using normal rabbit IgG nor an absence of antisera resulted in an enrichment of the NOX4 promoter. Effect of altered E2F1 expression on NOX4 promoter activity We finally investigated the effects of altered expression of E2F1 on the activity of the NOX4 promoter using siRNAs specifically designed to rat E2F1. We showed by qPCR that we could reduce E2F1 mRNA levels in A7r5 cells using the specific siRNAs by N60% (data not shown). We therefore cotransfected the -196-bp wild-type promoter construct into A7r5 cells together with E2F1-targetted (or control) siRNAs. As shown in Fig. 6, inhibition of E2F1 expression significantly reduced the activity of the -196-bp wild-type Nox4 promoter (panel A compare lanes 1 and 2). Moreover mutation of the E2F1-binding site abolished the effect of E2F1 inhibition (panel A, lanes 3 and 4). The percentage reduction effected by the E2F1-siRNA in both cases is displayed in panel B. Thus E2F1 acts through its identified cognate site to regulate positively NOX4 transcription. Discussion We describe here the first identification and characterisation of the NOX4 promoter in any cell type or species. We found all the 5′untranslated mRNA sequence to be contained within one exon that included the translational start site. An additional, more 5′ exon has been identified in the mouse NOX4 gene and is described on the Ensemble genome browser (http://www.ensembl.org/Mus_musculus/ index.html). However, the only reported source of a transcript
containing this exon is a mouse kidney cDNA library (Clone No. AI956716), and we did not detect such a transcript in these VSMCs. We demonstrate that, as we recently found to be the case for NOX1, the positively acting promoter element(s) in the NOX4 gene are found very proximal to the CAP site [12]. In particular we identified a small 22-bp sequence which was necessary for strong promoter activity in VSMCs that included a consensus binding site for E2F which we show acts to regulate NOX4 transcription positively. The E2F family of transcription factors comprises eight family members, all of which are widely expressed and recognise the same consensus binding site [26]. They have been demonstrated to be pivotal regulators of transcription which mediate many critical cellular functions including cell cycle progression, mitosis, apoptosis, and differentiation (for review, see [26]). The eight gene family members give rise to (at least) nine proteins (as E2F3 encodes two proteins through the use of alternative promoters), which can be divided into two groups, based on whether they dimerise with one of three DP proteins. Thus, E2F1-6 function as heterodimers with a DP family member, while E2F7 and E2F8 bind as homodimers to the consensus site [26,28]. In addition, the transcriptional activities of E2F1-5 (but not E2F6–8) are modulated by association with the retinoblastoma protein (Rb) or other related “pocket” proteins: p107 and p130 [26]. These members of the Rb family are known to be key regulators of E2F activity during the cell cycle (reviewed in [29]). In their hypophosphorylated form, Rb proteins can bind E2F factors and hence prevent their interaction with gene promoter regions. The phosphorylation of Rb proteins, however, acts to release the E2F proteins and allows them to act as transcription factors. The phosphorylation status and hence activity of the Rb proteins can in turn be regulated by cyclin-dependent kinases (Cdks). Most notably, phosphorylation of Rb proteins by Cdks which function at the G1/S transition (Cdk4/6 and Cdk2) is required to drive the ordered transition into S phase (reviewed in [30]). Several mechanisms are known to regulate the activity of Cdks, including expression of the genes themselves, posttranslational modification by phosphorylation/ dephosphorylation cascades, interactions with protein inhibitors, and degredation by the ubiquitin/proteasome pathway (reviewed in [31]). Thus the function of E2Fs can be regulated by the cell at many levels. The E2F family members have been further categorised into several subclasses based on both their structural properties and their transcriptional regulatory properties on model target gene promoters. Thus, of E2F factors known to be regulated by pocket proteins, E2F1, E2F2, and E2F3a are often referred to as transcriptional “activators,” while E2F3b, 4, and 5 are considered to be transcriptional “repressors.” However, the overexpression of, for instance, E2F1 has been shown by
L. Zhang et al. / Free Radical Biology & Medicine 45 (2008) 679–685
microarray analysis to result in the downregulation of almost as many genes as are upregulated, while E2F4 and E2F5 have been shown to transcriptionally activate some target gene promoters (reviewed in [26]). Thus, this classification is overly simplistic, and the function of any E2F factor on any target gene promoter is likely to be cell- and gene-context dependent. The E2F site identified here in the NOX4 promoter was shown to cis-regulate NOX4 expression in a positive fashion. The involvement of E2F1 in the regulation of NOX4 through this site was demonstrated in that E2F1 siRNA was shown to decrease promoter activity only when this site was intact. We cannot, however, rule out the possibility that other E2F factors are also involved, potentially at different stages in the cell cycle and/or different states of cellular differentiation. In a recent study of mASMCs it was shown that the both the levels of the different E2F protein isoforms and their association with the pocket proteins are dependent on the proliferative status of the cells [32]. In addition, the so-called activator E2Fs, E2F1, and E2F3 acted as growthpromoting factors and induced increased proliferation leading to intimal hyperplasia in a mouse model of venous bypass grafting. By contrast the repressors E2F and E2F4 acted as a growth-suppressing factor to inhibit intimal hyperplasia. It has been shown by ChIP studies that different E2F factors can be recruited to the same promoter at different stages of the cell cycle to elicit different transcriptional effects [33]. The E2F-binding site in the NOX4 promoter may therefore, at least in part, mediate changes in NOX4 expression which have been shown to be dependent on the differentiation/proliferation status of VSMCs [8,34,35]. This is now the topic of further studies in our laboratory. The positively acting element described here also included a potential binding site for members of the SOX family of transcription factors. Although mutation of this site did not act to down-regulate the NOX4 promoter activity in these experiments, we do not rule out the possibility that this site may be involved in the cell-type-specific and/or differentiation-state-specific regulation of NOX4 expression. In summary, this study identifies proximal genomic sequences within the NOX4 promoter which act to regulate positively NOX4 expression in VSMCs and demonstrate the involvement of E2F in this promoter activation. Since changes in NOX4 mRNA levels appear to effect changes in NOX4 enzymic activity, targeting transcriptional regulators of this gene may be a useful approach for manipulating NOX4 activity and hence the intracellular oxidation state. Acknowledgments We thank Dr. Richard Siow for mASMCs. This research was supported by British Heart Foundation Grants PG/06/013/20291 and CVH/99001, and by a KC Wong Scholarship to L.Z. References [1] Clempus, R. E.; Griendling, K. K. Reactive oxygen species signaling in vascular smooth muscle cells. Cardiovasc. Res. 71:216–225; 2006. [2] Su, B.; Mitra, S.; Gregg, H.; Flavahan, S.; Chotani, M. A.; Clark, K. R.; GoldschmidtClermont, P. J.; Flavahan, N. A. Redox regulation of vascular smooth muscle cell differentiation. Circ. Res. 89:39–46; 2001. [3] Touyz, R. M. Reactive oxygen species and angiotensin II signaling in vascular cells — implications in cardiovascular disease. Braz. J. Med. Biol. Res. 37: 1263–1273; 2004. [4] Bedard, K.; Krause, K. H. The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol. Rev. 87:245–313; 2007. [5] Cross, A. R.; Segal, A. W. The NADPH oxidase of professional phagocytes— prototype of the NOX electron transport chain systems. Biochim. Biophys. Acta 1657:1–22; 2004. [6] Lambeth, J. D. NOX enzymes and the biology of reactive oxygen. Nat. Rev. Immunol. 4:181–189; 2004. [7] Lassegue, B.; Clempus, R. E. Vascular NAD(P)H oxidases: specific features, expression, and regulation. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285: R277–R297; 2003. [8] Clempus, R. E.; Sorescu, D.; Dikalova, A. E.; Pounkova, L.; Jo, P.; Sorescu, G. P.; Schmidt, H. H.; Lassegue, B.; Griendling, K. K. Nox4 is required for maintenance of the differentiated vascular smooth muscle cell phenotype. Arterioscler. Thromb. Vasc. Biol. 27:42–48; 2007.
685
[9] Lassegue, B.; Sorescu, D.; Szocs, K.; Yin, Q.; Akers, M.; Zhang, Y.; Grant, S. L.; Lambeth, J. D.; Griendling, K. K. Novel gp91phox homologues in vascular smooth muscle cells : nox1 mediates angiotensin II-induced superoxide formation and redox-sensitive signaling pathways. Circ. Res. 88:888–894; 2001. [10] Ambasta, R. K.; Kumar, P.; Griendling, K. K.; Schmidt, H. H.; Busse, R.; Brandes, R. P. Direct interaction of the novel Nox proteins with p22phox is required for the formation of a functionally active NADPH oxidase. J. Biol. Chem. 279:45935–45941; 2004. [11] Serrander, L.; Cartier, L.; Bedard, K.; Banfi, B.; Lardy, B.; Plastre, O.; Sienkiewicz, A.; Forro, L.; Schlegel, W.; Krause, K. H. NOX4 activity is determined by mRNA levels and reveals a unique pattern of ROS generation. Biochem. J. 406:105–114; 2007. [12] Brewer, A. C.; Sparks, E. C.; Shah, A. M. Transcriptional regulation of the NADPH oxidase isoform, Nox1, in colon epithelial cells:Role of GATA binding factor(s). Free Radic. Biol. Med. 40:260–274; 2005. [13] Horton, R. M.; Cai, Z. L.; Ho, S. N.; Pease, L. R. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. BioTechniques 8:528–535; 1990. [14] Alexandrovich, A.; Arno, M.; Patient, R. K.; Shah, A. M.; Pizzey, J. A.; Brewer, A. C. Wnt2 is a direct downstream target of GATA6 during early cardiogenesis. Mech. Dev. 123:297–311; 2006. [15] Zampetaki, A.; Zeng, L.; Xiao, Q.; Margariti, A.; Hu, Y.; Xu, Q. Lacking cytokine production in ES cells and ES-cell-derived vascular cells stimulated by TNF-alpha is rescued by HDAC inhibitor trichostatin A. Am. J. Physiol. Cell Physiol. 293: C1226–C1238; 2007. [16] Ago, T.; Kitazono, T.; Kuroda, J.; Kumai, Y.; Kamouchi, M.; Ooboshi, H.; Wakisaka, M.; Kawahara, T.; Rokutan, K.; Ibayashi, S.; Iida, M. NAD(P)H oxidases in rat basilar arterial endothelial cells. Stroke 36:1040–1046; 2005. [17] Haurani, M. J.; Pagano, P. J. Adventitial fibroblast reactive oxygen species as autacrine and paracrine mediators of remodeling: bellwether for vascular disease? Cardiovasc. Res. 75:679–689; 2007. [18] Butler, J. E.; Kadonaga, J. T. The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev. 16:2583–2592; 2002. [19] Suzuki, Y.; Tsunoda, T.; Sese, J.; Taira, H.; Mizushima-Sugano, J.; Hata, H.; Ota, T.; Isogai, T.; Tanaka, T.; Nakamura, Y.; Suyama, A.; Sakaki, Y.; Morishita, S.; Okubo, K.; Sugano, S. Identification and characterization of the potential promoter regions of 1031 kinds of human genes. Genome Res. 11:677–684; 2001. [20] Zheng, N.; Fraenkel, E.; Pabo, C. O.; Pavletich, N. P. Structural basis of DNA recognition by the heterodimeric cell cycle transcription factor E2F-DP. Genes Dev. 13:666–674; 1999. [21] Blake, M. C.; Azizkhan, J. C. Transcription factor E2F is required for efficient expression of the hamster dihydrofolate reductase gene in vitro and in vivo. Mol. Cell. Biol. 9:4994–5002; 1989. [22] Lam, E. W.; Watson, R. J. An E2F-binding site mediates cell-cycle regulated repression of mouse B-myb transcription. EMBO J. 12:2705–2713; 1993. [23] Wilson, M.; Koopman, P. Matching SOX: partner proteins and co-factors of the SOX family of transcriptional regulators. Curr. Opin. Genet. Dev. 12:441–446; 2002. [24] Bieda, M.; Xu, X.; Singer, M. A.; Green, R.; Farnham, P. J. Unbiased location analysis of E2F1-binding sites suggests a widespread role for E2F1 in the human genome. Genome Res. 16:595–605; 2006. [25] Jin, V. X.; O'Geen, H.; Iyengar, S.; Green, R.; Farnham, P. J. Identification of an OCT4 and SRY regulatory module using integrated computational and experimental genomics approaches. Genome Res. 17:807–817; 2007. [26] DeGregori, J.; Johnson, D. G. Distinct and overlapping roles for E2F family members in transcription, proliferation and apoptosis. Curr. Mol. Med. 6:739–748; 2006. [27] Woods, K.; Thomson, J. M.; Hammond, S. M. Direct regulation of an oncogenic micro-RNA cluster by E2F transcription factors. J. Biol. Chem. 282:2130–2134; 2007. [28] Xu, X.; Bieda, M.; Jin, V. X.; Rabinovich, A.; Oberley, M. J.; Green, R.; Farnham, P. J. A comprehensive ChIP-chip analysis of E2F1, E2F4, and E2F6 in normal and tumor cells reveals interchangeable roles of E2F family members. Genome Res. 17:1550–1561; 2007. [29] Sun, A.; Bagella, L.; Tutton, S.; Romano, G.; Giordano, A. From G0 to S phase: a view of the roles played by the retinoblastoma (Rb) family members in the Rb-E2F pathway. J. Cell. Biochem. 102:1400–1404; 2007. [30] Rothstein, E. C.; Lucchesi, P. A. Redox control of the cell cycle: a radical encounter. Antioxid. Redox Signal. 7:701–703; 2005. [31] Obaya, A. J.; Sedivy, J. M. Regulation of cyclin-Cdk activity in mammalian cells. Cell. Mol. Life Sci. 59:126–142; 2002. [32] Giangrande, P. H.; Zhang, J.; Tanner, A.; Eckhart, A. D.; Rempel, R. E.; Andrechek, E. R.; Layzer, J. M.; Keys, J. R.; Hagen, P. O.; Nevins, J. R.; Koch, W. J.; Sullenger, B. A. Distinct roles of E2F proteins in vascular smooth muscle cell proliferation and intimal hyperplasia. Proc. Natl. Acad. Sci. USA 104:12988–12993; 2007. [33] Takahashi, Y.; Rayman, J. B.; Dynlacht, B. D. Analysis of promoter binding by the E2F and pRB families in vivo: distinct E2F proteins mediate activation and repression. Genes Dev. 14:804–816; 2000. [34] Sturrock, A.; Cahill, B.; Norman, K.; Huecksteadt, T. P.; Hill, K.; Sanders, K.; Karwande, S. V.; Stringham, J. C.; Bull, D. A.; Gleich, M.; Kennedy, T. P.; Hoidal, J. R. Transforming growth factor-beta1 induces Nox4 NAD(P)H oxidase and reactive oxygen species-dependent proliferation in human pulmonary artery smooth muscle cells. Am. J. Physiol. Lung Cell Mol. Physiol. 290:L661–L673; 2006. [35] Sturrock, A.; Huecksteadt, T. P.; Norman, K.; Sanders, K.; Murphy, T. M.; Chitano, P.; Wilson, K.; Hoidal, J. R.; Kennedy, T. P. Nox4 mediates TGF-beta1-induced retinoblastoma protein phosphorylation, proliferation, and hypertrophy in human airway smooth muscle cells. Am. J. Physiol. Lung Cell Mol. Physiol. 292: L1543–L1555; 2007.