Positive selection vector using the KillerRed gene

Analytical Biochemistry 412 (2011) 120–122

Contents lists available at ScienceDirect

Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio

Notes & Tips

Positive selection vector using the KillerRed gene Xuedong Liu 1, Rui Shi 1, Dan Zou 1, Zaiyu Li, Xing Liu, Yanxia Chen, Xiaoguang Yang, Yanna Zhou, Dong Zheng ⇑ Laboratory of Genetics and Molecular Biology, Northeast Forestry University, Harbin 150040, China

a r t i c l e

i n f o

Article history: Received 4 December 2010 Received in revised form 20 January 2011 Accepted 25 January 2011 Available online 1 February 2011

a b s t r a c t Plasmid pZK18S is a novel positive selection vector containing the genetically encoded photosensitizer KillerRed as the selection marker. When transformed into host cells (lacIq or lacI+), the common medical surgical light is sufficient to activate phototoxicity of KillerRed. Thus, only the recombinants with disrupted reading frame of KillerRed genes finally allow forming viable colonies. Because lethality of KillerRed relies on light irradiation, no special host and culture medium are required to amplify and prepare pZK18S vector in larger quantities. The pZK18S was reliable and highly efficient for constructing the serial analysis of gene expression (SAGE) library. Ó 2011 Elsevier Inc. All rights reserved.

After constructing recombinant plasmid DNA by fusing target DNA inserts into the linearized vector and transforming into host cells, some transformants might contain the recombinants; others contain self-ligated or uncut vectors as the backgrounds. It is not easy to separate them. To solve this problem, a positive selection strategy has been theoretically designed to allow only colonies without the backgrounds to grow on a selection medium plate. Those vectors developed based on this strategy are called positive selection vectors or direct selection vectors [1]. To date, a variety of positive selection plasmid vectors have been described. According to mechanisms responsible for direct selection, they rely on inactivating either a lethal gene, a lethal site, a dominant function conferring cell sensitivity to metabolites, or a repressor of an antibiotic resistance function [2]. The commercial vector pZero-1 (Invitrogen, Carlsbad, CA, USA) can be regarded as one of the best examples to explain the mechanism underlying lethal gene-based positive selection vectors. It relies on inactivation of the cytotoxic ccdB gene of the F plasmid. Only recombinant colonies allowing direct positive selection of inserts by disruption of the lethal ccdB gene give rise to viable colonies [3]. Positive selection vectors are efficient tools and simplify in vitro DNA recombination procedures. KillerRed is the first entirely genetically encoded photosensitizer. It was newly engineered from the nonfluorescent and nonphototoxic chromoprotein anm2CP from the hydrozoan jellyfish [4,5]. Unlike chemical photosensitizers, KillerRed can express in individual prokaryotic or eukaryotic cells to emit both visual and fluorescent red, requiring no cofactors or substrates [6]. We recently developed a cloning system by using KillerRed as the ⇑ Corresponding author. Fax: +86 451 82190624. 1

E-mail address: [email protected] (D. Zheng). These authors contributed equally to this work.

0003-2697/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2011.01.034

selection marker to achieve color discrimination of recombinants from backgrounds, namely the red/white cloning screening [7]. On irradiation by green light (520–590 nm), KillerRed can further generate reactive oxygen species (ROS)2 accompanied by profound self-photobleaching. The ROS-induced phototoxicity of KillerRed is at least three orders of magnitude higher than that of other fluorescent proteins exhibiting low background phototoxicity. It would damage and further kill cells [6]. We postulated that light-dependent lethality of KillerRed could also find use in fulfilling the positive selection strategy; thus, only the recombinants are allowed to grow. Here we describe such a positive selection cloning system and summarize its applications to construct a Long SAGE (serial analysis of gene expression) library. We used pUC18 plasmid to demonstrate our theory. To facilitate assembly of vectors, we first composed a DNA modular element [8]. Two phosphorylated oligonucleotides, ZK1 (50 -AATTCG CATG CCATGGGAAG CTTGG) and ZK2 (50 -GATCCCAAGC TTCCCATGGC ATGCG), were designed to form the double-stranded sticky-end polylinker, which contains EcoRI, SphI, AluI, and BamHI cutting sites. Meanwhile, we designed a pair of primers, KR1 (50 CCCGGATCCATGGGTTCAGAGGGCGG) and KR2 (50 -CCCAAGCTTT CAATCCTCGT CGCTACCG), to amplify the KillerRed gene from pKillerRed-B plasmid (Evrogen, Moscow, Russia). A polymerase chain reaction (PCR, total volume 100 ll, 20 pmol of each primer, 10 ng of DNA template, and 2.5 U of Taq DNA polymerase) was performed in an ABI 2710 thermocycler (Applied Biosystems, Foster City, CA, USA). The thermocycle was as follows: 2 min at 94 °C, followed by 35 cycles of 5 s at 94 °C, 30 s at 65 °C, and 30 s at

2 Abbreviations used: ROS, reactive oxygen species; SAGE, serial analysis of gene expression; PCR, polymerase chain reaction; LB, Luria–Bertani; CFU, colony-forming units; X-Gal, 5-bromo-4-chloro-3-idolyl-b-D -galactoside; IPTG, isopropyl-b-D thiogalactopyranoside.

Notes & Tips / Anal. Biochem. 412 (2011) 120–122

121

Fig.1. Construction and characterization of pZK18S vector. (A) Structures of the KillerRed-based pZK18S vector. The pZK18S vector (3386 bp, GenBank accession no. HM162834) was constructed by inserting the DNA modular element containing polylinker and KillerRed gene downstream of the promoter lacP of pUC18 plasmid. The locations of unique restriction sites, multiple cutting sites (black), the b-lactamase (AmpR), the ColE1 origin of DNA replication (Ori), the lacP, and the KillerRed gene are shown. DNA inserts may be sequenced using a standard BcaBEST RV-M primer (50 -GAGCGGATAA CAATTTCACA CAGG) and a KillerRed direct primer (50 -ACTTCTGGCC GTTCACCTCG C). In addition, all of the overhangs within linearized pZK18S vectors are indicated with asterisks (). (B) Characteristics of KillerRed-based lethal positive selection strategy: Time course of light-induced killing of E. coli expressing lacZa and KillerRed. The transformants were irradiated with white light at a photon flux of 1550 lmol/m2 s. (C) Chromatogram of sequencing data samples from white colonies after lethal positive selection. The four asterisks () show the insert–vector junction between single SAGE ditag and pZK18S, and the arrow (;) shows the first base of start codon (ATG) of the KillerRed gene. After annotation and blast analysis, this SAGE ditag represents fibroblast growth factor receptor 2 (FGFR2) and an unknown transcribed locus.

72 °C and then by an additional 7 min at 72 °C. At the end of PCR, we added restriction enzymes BamHI and HindIII (30 U each, New England Biolabs, Ipswich, MA, USA) directly into amplification products. The mixtures were incubated at 37 °C for 12 h to digest the cutting sites at each terminal of PCR products [9]. After gel electrophoresis, we recovered DNA with a QIAEX II Gel Extraction Kit (Qiagen, Germantown, MD, USA). By mixing double-digested KillerRed genes (2 lg) with the polylinker at the equal molar in a 20-ll ligation reaction system (16 °C for 12 h), the final DNA modular element was generated. This element could be universally interchangeable and simplifies customized vector construction. We finally ligated the DNA modular element into EcoRI/HindIII double-digested pUC18 to obtain circular pZK18S vector (3386 bp) (Fig. 1A). This vector can be maintained in either lacIq or lacI+ host cells for preservation and preparation in large quantities. We designed pZK18S vector mainly for SAGE library construction. This vector works in the following way. SphI digestion would linearize pZK18S vectors with two 50 -CATG overhangs. We ligate ditags (or concatemers) into the pZK18S vectors to obtain the SAGE library. After a conventional cloning procedure, to achieve the positive selection strategy, a single step of light irradiation would be executed immediately after a 1-h incubation (37 °C) subsequent to transformation. Because cells containing the backgrounds (self-ligated or uncut vector) express functional KillerRed polypeptide, phototoxicity of KillerRed induced by light irradiation would kill these cells. Consequently, only the recombinants with disrupted reading frame of KillerRed genes finally allow the formation of viable colonies. We intentionally used self-ligated pZK18S to define the time course of light-induced phototoxicity of KillerRed. First, the pZK18S (2 lg) was linearized with SphI (5 U) in a 50-ll reaction system at 37 °C for 6 h. Then it was recovered with the QIAEX II

Gel Extraction Kit and eluted at 50 ng/ll. We used self-ligated pZK18S (50 ng)-transformed JM109 as the test group and pUC18transformed JM109 the control. For either the test or control group, we diluted cells from a single Escherichia coli colony containing vectors into 1 ml of Luria–Bertani (LB)–ampicillin broth buffer and aliquotted into six equal portions. One of them was kept in darkness. We irradiated the other five ones with white light (photon flux 1550 lmol/m2 s under common medical surgical lights) for 5, 10, 20, 40, and 80 min, respectively. Then we plated all aliquots onto LB–ampicillin agar. The number of growing colonies corresponded to the number of bacteria cells surviving after irradiation, that is, colony-forming units (CFU). We finally compared the CFU number for the irradiated E. coli portion with that for the nonirradiated one to estimate the relative time course phototoxic effects. Our results indicated that, even at a basal expression level (without any inducer), KillerRed could kill 94.2% of E. coli cells after 20 min and could kill nearly all cells after 80 min of white light irradiation, whereas more than 89.7% cells were still viable after 80 min of light irradiation in the parallel control group (Fig. 1B). We next tested pZK18S vector by constructing the Long SAGE library. Total RNA (10 lg) was extracted from subcultured keratinocyte with an SV Total RNA Isolation System (Promega, Madison, WI, USA). Based on the manufacturer’s instructions, we used the I-SAGE Long Kit (Invitrogen) to generate 34-bp ditags from total RNA. Minor modifications were made in the subsequent procedures. We divided elute (35 ll) of the 34-bp ditags into two equal portions. For the control group, we ligated one aliquot portion into the linearized pZero-1 vectors. After transformed ligates into DH5a host cells and a 1-h incubation, we plated transformants on low-salt LB– Zeocin agar plates for overnight incubation. The test group was established with the linearized pZK18S vector and the other aliquot portion. When finished the 1-h incubation after transformation,

122

Notes & Tips / Anal. Biochem. 412 (2011) 120–122

Fig.2. Representative results to explain workflow for KillerRed-based insertional inactivation and positive selection strategies. The pZK18S-based keratinocyte Long SAGE library was constructed as described and transformed into DH5a host cells. We divided this library into two equal portions. One portion was used for the red/ white cloning screening; we just followed the conventional procedures without light irradiation. After overnight incubation on LB–ampicillin agar plates, colonies containing the recombinants (white) would coexist with those containing the backgrounds (red) on the agar plates (panel A: 10 white vs. 10 red). The left portion was for the positive selection strategy (panel B). A single step of light irradiation would activate KillerRed phototoxicity, requiring no cofactors, substrates, or inducer. Thus, most colonies containing the backgrounds (red) would be killed; the positive selection strategy allows the recombinant transformed host cells to form visible white colonies (panel B: 10 white vs. 1 red). The arrowheads in both panels show the colonies containing the backgrounds (red) on the agar plates. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

2

we irradiated the transformants with white light (1550 lmol/m s) for 30 min and then plated them on LB–ampicillin agar plates. After overnight incubation, we randomly picked more than 1000 white colonies from both the control and test groups for the colony PCR and DNA sequencing. Then we used SAGE 2000 analysis software (version 4.5, Invitrogen) to analyze sequencing data. Results showed that the KillerRed-based pZK18S vector yielded fully represented Long SAGE libraries equivalent to those made by the commercial ccdB-based pZero-1 vectors; inserts ranging from 250 to 4000 bp were efficient (data not shown). In addition, we tested the ability of small inserts to inactivate the KillerRed gene and found that the KillerRed gene was inactivated by insertions as small as one 34-bp ditag (Fig. 1C). This further implied that KillerRed-based lethal positive selection was more sensitive to short inserts than ccdB-based lethal positive selection, according to the data showing that the ccdB gene was inactivated by in-frame insertions as small as 75 bp [10]. Our experiments proved that KillerRed has been an efficient positive selection effector. Before light irradiation, KillerRed polypep-

tide is completely nontoxic to cells. The common medical surgical light is sufficient to activate its phototoxicity. After being activated, KillerRed functions with its killing activity very powerfully without cofactors, substrates, or an inducer. For either lacIq or lacI+ host cells, KillerRed-based positive selection strategy can work well based merely on basal expression of the KillerRed gene, requiring no 5-bromo-4-chloro-3-idolyl-b-D-galactoside (X-Gal), isopropylb-D-thiogalactopyranoside (IPTG), or other substrates. Because phototoxicity of KillerRed depends only on light irradiation, no special host and culture medium are required to amplify and prepare the pZK18S vector in larger quantities. Until now, many strategies have been developed to eliminate the problem of backgrounds, including insertional inactivation, positive selection, directional cloning, and phosphatase treatment [2]. We previously reported using KillerRed to achieve insertional inactivation strategy—the novel red/white cloning screening [7]. Summing up our data, we can conclude that any cloning system in which KillerRed is embedded as the selection marker could execute both insertional inactivation and positive selection strategies. To achieve an insertional inactivation strategy, we just follow the conventional cloning procedures. However, by using only one additional step of light irradiation, it is easy to switch to a phototoxicity-based positive selection strategy (Fig. 2). In summary, KillerRed can work well as a lethal selection gene for DNA cloning. It supports the lethality-based positive selection strategy. We demonstrated it through the cloning vector pZK18S newly developed for SAGE library construction. The vector embedding KillerRed possesses a simple structure and simpler cloning procedures, and it is sensitive to small insert cloning. Although limited embodiments of our methodology were described here, we envision that many modifications and variations will be used to customize and prepare novel vector systems according to principles of our methodology. Acknowledgments This work was supported by Fundamental Research Funds for the Central Universities (DL09CA07 to Xuedong Liu) and the National Natural Science Foundation of China (30771218 to Dong Zheng). References [1] Y.J. Choi, T.T. Wang, B.H. Lee, Positive selection vectors, Crit. Rev. Biotechnol. 22 (2002) 225–244. [2] P. Bernard, P. Gabant, E.M. Bahassi, M. Couturier, Positive-selection vectors using the F plasmid ccdB killer gene, Gene 148 (1994) 71–74. [3] L. Van Melderen, Molecular interactions of the CcdB poison with its bacterial target, the DNA gyrase, Intl. J. Med. Microbiol. 291 (2002) 537–544. [4] M.E. Bulina, D.M. Chudakov, O.V. Britanova, Y.G. Yanushevich, D.B. Staroverov, T.V. Chepurnykh, E.M. Merzlyak, M.A. Shkrob, S. Lukyanov, K.A. Lukyanov, A genetically encoded photosensitizer, Nat. Biotechnol. 24 (2006) 95–99. [5] P. Carpentier, S. Violot, L. Blanchoin, D. Bourgeois, Structural basis for the phototoxicity of the fluorescent protein KillerRed, FEBS Lett. 583 (2009) 2839– 2842. [6] S. Pletnev, N.G. Gurskaya, N.V. Pletneva, K.A. Lukyanov, D.M. Chudakov, V.I. Martynov, V.O. Popov, M.V. Kovalchuk, A. Wlodawer, Z. Dauter, V. Pletnev, Structural basis for phototoxicity of the genetically encoded photosensitizer KillerRed, J. Biol. Chem. 284 (2009) 32028–32039. [7] X. Liu, X. Liu, Y. Zhou, D. Zou, R. Shi, Z. Li, D. Zheng, T vector bearing KillerRed protein marker for red/white cloning screening, Anal. Biochem. 405 (2010) 272–274. [8] W.F. Donahue, B.M. Turczyk, K.A. Jarrell, Rapid gene cloning using terminator primers, modular vectors, Nucleic Acids Res 30 (2002) e95. [9] X.D. Liu, D. Zheng, Y.N. Zhou, W.W. Mao, J.Z. Ma, Restriction endonucleases digesting DNA in PCR buffer, J. Forest. Res. 16 (2005) 58–60. [10] P. Bernard, Positive selection of recombinant DNA by CcdB, BioTechniques 21 (1996) 320–323.