Positively and negatively acting signals regulating stalk cell and anterior-like cell differentiation in dictyostelium

Cell, Vol. 65, 983-969,

June

14, 1991, Copyright

0 1991 by Cell Press

Positively and Negatively Acting Signals Regulating Stalk Cell and Anterior-like Cell Differentiation in Dictyostelium Adrian0 Ceccarelli, Hiro Mahbubani, and Jeffrey G. Williams Imperial Cancer Research Fund Clare Hall Laboratories Blanche Lane, South Mimms, Potters Bar EN6 3LD Hertfordshire England

Summary The Dictyostelium ecmiS gene encodes an extracellular matrix protein and is inducible by the stalk cell morphogen DIF. It is expressed in a subset of prestalk (pstB) cells in the slug and surrounding pstA cells first express it at culmination. A region of the ecmB promoter can direct transcription in all anterior prestalk cells, but a separate, downstream region acts to prevent its expression in pstA cells prior to culmination. This may be the site of interaction of a repressor, regulated by an extracellular antagonist to DIF. At culmination, expression of the ecmB gene also becomes greatly elevated in anterior-like cells as they move to surround the spore mass. A distal region of the ecmg promoter directs increased expression in those anterior-like cells that surmount the spore head. This divergence in gene expression suggests that anteriorlike cells and anterior prestalk cells experience different inductive conditions at culmination. Introduction It is relatively straightforward to analyze the distribution of morphogens such as the bicoid protein of Drosophila (Driever and Niisslein-Volhard, 1988), because techniques for the localization of proteins are well established. Low molecular weight morphogens pose a much more difficult technical problem because they are highly diffusible and cannot be fixed in situ. Retinoic acid is believed to act as a morphogen in vertebrate limb formation, and there is a concentration gradient in the expected direction (Tickle et al., 1982; Thaller and Eichele, 1987). This gradient is, however, surprisingly shallow, given that it has to specify multiple positional values. In the case of the Dictyostelium stalk cell inducer, DIF, there is an apparent concentration gradient that is actually the reverse of that expected. Stalk cell precursors are found in the front one-fifth of the migratory slug, but there is more DIF in the back of the slug than in the front (Brookman et al., 1987). Subsequent work suggested that much of the DIF measured in the original study may be sequestered in the extracellular matrix of the slug (Neave et al., 1986), but this uncertainty illustrates a central problem in all studies of morphogen distribution. It is impossible to know if all of the morphogen molecules isolated from a particular region of a tissue, or identified histochemically, were active in vivo. One indirect approach to the problem is to identify genes

responsive to a candidate morphogen and to determine how their expression is localized. For example, the human HOX2 homeoboxgenes are expressed in a specific pattern along the anteroposterior axis of the developing CNS, and there is a good correlation between their domains of expression and apparent relative sensitivities to retinoic acid (Simeone et al., 1990). Possibly, therefore, there is a temporal and/or spatial gradient of retinoic acid, with each gene having a particular threshold concentration for induction. We are using an analogous approach to investigate morphogenetic signaling in Dictyostelium. Expression of the ecmA (formerly called pDd63) and ecmB (formerly called pDd56) genes is dependent on, and under appropriate conditions rapidly induced by, DIF (Berks and Kay, 1988; Jermyn et al., 1987; Williams et al., 1987). The two genes encode extracellular matrix proteins with possible roles in slug migration and in the architecture of the stalk (McRobbie et al., 1988a, 1988b). We have constructed cell autonomous markers by fusing their promoters to enzymatically and immunologically detectable reporter genes (Jermyn et al., 1989). Expression of the two genes defines different kinds of prestalk cell. The ecmA gene is expressed in all prestalk cells in the anterior of the slug, although in slugs migrating in the dark there is a gradient of expression with cells near the front expressing the gene most strongly (Jermyn et al., 1989; Jermyn and Williams, 1991). The ecmB gene is expressed in a subset of anterior prestalk cells that form a cone in the slug tip with its base facing forward. These cells also express the ecmA gene (K. A. Jermyn and J. G. Williams, unpublished data). We call cells expressing the ecmA gene but not the ecm6 gene pstA cells and cells expressing both markers pstB cells. At culmination the slug sits on end and prestalk cells near the tip initiate synthesis of a cylinder of protein and cellulose known as the stalk tube. The core of pstB cells, in the tip of the migratory slug, are the first cells to enter the stalk tube. PstA cells transform into pstB cells by activating expression of the ecmB gene upon entering the stalk tube (Jermyn and Williams, 1991). We wish to determine the nature of the inductive signal responsible for this localized activation of the ecmB gene. This is of central importance in understanding pattern formation in all dictyostelids. D. discoideum is one of the few slime mold species that forms a freely migrating slug. In other species a stalk is formed continuously during slug migration. This occurs by the rapid transdifferentiation of prespore cells at the entrance to the stalk tube (Gregg and Davis, 1982). Even among those species that form a freely migrating slug, D. discoideum is unusual in the large size of the prestalk zone (Schaap et al., 1985). Other species have a smaller prestalk zone, with some of the “prespore” cells converting into stalk cells at culmination. The signal at the entrance to the stalk tube therefore provides an overriding control, responsible for determining eventual cell fate irrespective of any bias toward one or other pathway that may exist in the slug.

Cell 984

CAACCAATTTTTTATTTGTACAAAACCAAATTAAGTTTGAAARTTAC

~TAATAAAATAAATAAATAAATAAATATATA~

TTTAACAATCATGTGGTGTATATTACATTTTGTTTTTTTTAC~TGTGT~G~

TTAATATAATFACAAGTTTTTTAA

TTATAATAAAATAATAAAAGATAGGATTTAAATCACACAGAAATATTTTA

GAAATTTGCAATTTTAATGATTAGTTCATGTCAAAATTTTTTA p--877 TAAATTGGCAAACAAAAAA TATCATCATAATTACACATTGGGTACTTTTTTTTTTTAAAAAAA -85EJ

TTAAAAATTTAGTAGCAAGTGGGTTAGTGTGGGTTTTAAACCTTTT

AATGTTAGAAATAGGAGATGAAAT AAAAAATTTTAACCCCGTATCATTATAGTATGATTTGTAA -757 J r-656 AAAAAACCAATCCATTTTTACAATTAGGAAAATAGGAAAAT~TCAACACTAATAT AAAAAATAAHAT~TTAAAATTTTTAT~C~G~TAGATTTTTTTTTTTATTTGTTTTTTTTTACT~~ -632 J P-536 N&I

r-432

GTTAATAGGGGGTTGGGGGGTTAATAATTTTGT~TTT~T~TATTAT~ATTTGTTTTG~CMCATATATATTTATACATATACACCAT~TACTATATACAT~TCAT -5304 TGGGAAATCTCATTTTACTTATCACATTGTTTTATTGTTATTTTTTACATAGT~TTTATTTTTGGATATTTTC~TTTGATTTC~TT~

CAAAATGCTGTCAAATTATTT AluI-208

Sau3A -109

ATATTTTTTTTTTTTTGTATAAATAGAAGTIlATAATTTTTTTTTTT~CCCCTCCATTTTT BglII

Figure

1. The Nucleotide

The sequence isolate of the and this may The proposed closely spaced

Sequence

of the Region

Upstream

was determined using synthetic oligonucleotides same gene, and the sequence of the upstream be the result of strain diversity; the SC253 gene cap sites also differ, and the cap site indicated primer extension products and only the major

of the ecmB

AAAAAATTAAACCAATTA

CAAAGAAAAAAAAAAAAAARAACCAAAAAAAAAAAA

Gene

derived from relatively GC-rich regions of the sequence. SC253 is an independent region has been published (Ayres et al., 1987). The two sequences differ somewhat was isolated from the strain Ax3, while the ecmS gene was isolated from strain Ax2. here derives from primer extension analysis (data not shown). There were several proposed start site is shown.

There is also a nonpositionally localized induction of the ecm6 gene in a population of amoebae called anterior-like cells (ALCs). Vital dyes, such as neutral red, selectively stain prestalk cells in the anterior one-fifth of the migratory slug (Banner, 1952). There are, scattered throughout the rear four-fifths of the slug, an approximately equal number of neutral red-staining cells, the ALCs (Sternfeld and David, 1981). They share most of the biochemical properties of the prestalk cells in the anterior region (Devine and Loomis, 1985). If the anterior region is removed, then the ALCs reconstitute a prestalk zone (Sternfeld and David, 1981). There is also evidence for a continuing interchange between ALCs and anterior prestalk cells during normal slug migration (Kakutani and Takeuchi, 1986). ALCs have been posited to play a central role in the regulation of cell type proportioning in models that invoke nonpositional signaling (Blaschke et al., 1986). At culmination ALCs sort to form a cup above the spore head, a cup below the spore head, and the outer part of the basal disc (Sternfeld and David, 1982). The upper cup derives from ALCs that move upward. After their arrival at the base, the ALCs that move downward are split in two by the stalk tube. Those nearest the apex, prior to the arrival of the stalk tube, form the lower cup and so are carried upward with the spore head as the stalk extends. Those nearer the base retain their position and come to form the outer part of the basal disc. A large fraction of

ALCs express the ecmB gene at a low level during slug migration, and, at culmination, there is a dramatic increase in the level of ecm6 expression in them (Jermyn and Williams, 1991). Here the initial inductive signal must be dispersed, because ALCs show an elevated level of ecmB gene expression prior to their movement above and below the spore head. We wish to know whether this is the same inductive signal responsible for activating the ecmB gene at the entrance to the stalk tube. By dissecting the promoter of the ecm6 gene into subregions, and analyzing their pattern of expression, we have gained insights into the mechanisms regulating cellular differentiation in both anterior prestalk cells and ALCs. Results A Distal Region of the Promoter Is Both Necessary and Sufficient for Expression in ALCs That Sort to the Upper Cup at Culmination The previous analysis of ecmB gene expression during culmination (Jermyn and Williams, 1991) was performed using a f3-galactosidase (P-gal) fusion gene containing 1614 nucleotides of sequence upstream of the cap site (Figures 1 and 2). During culmination it is expressed in cells within the stalk tube and in ALCs as they sort to form the lower and upper cups and the outer part of the basal disc (Figure 3A). (The lower cup and the outer basal disc

Dictyostelium 985

Figure

Stalk Cell Differentiation

2. Structure

of Constructs

Used

in the Analysis

of the ecm6

Promoter

Constructs A and B were created by fusion of a PCR product, extending from the indicated position upstream of the cap site of the ecmB gene to the Bglll site in the polylinker of the laczvector pDDlac-1 (Dingermann et al., 1989). The PCR primers incorporated a BamHl site at their S’ends, and the products were cleaved with BamHl and Bglll before ligation. The TATA box and cap site of the ecm6 gene are deleted in constructs C to G and replaced by sequences from the Actin gene (indicated by a diagonally striped line). The Actin75 sequences derive from the Al 5ABam-gal vector, in which two G-rich sequences necessary for gene expression were deleted and replaced with a BamHl site (Pears and Williams, 1988). Again, the reporter is P-gal and the PCR products incorporated SamHI and Bglll sites and were cleaved before insertion.

derive from the population of ALCs that move downward as culmination is initiated. While staining in the lower cup always mirrors that in the outer part of the basal disc, the preservation of the disc varies from sample to sample, and therefore only results for the upper cup will be presented.) To analyze the promoter further, polymerase chain reaction (PCR) was performed, using a series of primers, and the products were cloned next to the P-gal gene. This generated a set of 5’ to 3’ deletion clones with decreasing amounts of sequence upstream of the cap site. Removal of sequences between -1614 and -877 (to generate construct A; Figure 2) results in a dramatic change in the pattern of gene expression at culmination. If the assay for B-gal activity is performed for only a few hours, there is no staining within the upper or lower cup but expression within the stalk tube is entirely normal. In a timed incubation with X-Gal, transformants containing constructAshowasrapidastainingwithinthestalktubeas the starting (-1614) construct (Figure 3B). If transformants containing construct A are stained for several days, then very weak expression is observed in the lower cup but there is no detectable staining in the upper cup (Figure 3C). A further deletion, to nucleotide -656 (construct B), completely abolishes expression in both the stalk tube and the lower cup (data not shown). These data suggest the existence of at least two separate elements: a distal ele-

ment necessary for expression in those ALCs that sort to the upper cup during culmination and a more proximal element necessary for expression within the stalk tube. To determine whether the upstream sequences shown to be necessary for expression in the upper cup were sufficient to direct expression in this site, a PCR product derived from this region of the ecmS promoter was inserted into the vector Al5ABam-gal. In the construction of this vector two G-rich sequences upstream of the TATA box of the Actin gene that are required for expression were removed and replaced with a unique BamHl restriction site (Pears and Williams, 1988; A. Ceccarelli and H. J. Mahbubani, unpublished data). Construct C contains sequences between -1503 and -858 inserted into A15ABam-gal. It is not detectably expressed in ALCs in migrating slugs (data not shown) but is expressed in ALCs at culmination, when it directs expression in cells in the upper cup but not in the lower cup (Figure 3D). Thus sequences upstream of -858 are sufficient to direct expression in ALCs that sort to the upper cup. The position of sequences directing expression in the lower cup cannot be identified definitively, although the fact that the -877 construct shows a low level of expression in the lower cup after extended periods of staining suggests that they may be located, at least in part, downstream of -877. Alternatively, it is possible that sequences required for

Cell 986

C

A

D

E

Dictyostelium 987

Stalk Cell Differentiation

expression in the lower cup are located in the region of nucleotide -877 and, in construct A, they are interrupted or the proximity of vector sequences reduces their activity. Sequences Proximal to the Cap Site Repress Expression of the Gene in Anterior PstA Cells Construct D contains the Clal-Alul fragment, extending from nucleotide -1814 to -208, fused to Al SABam-gal. It directs a pattern of expression in culminants indistiguishable from that of the starting construct (data not shown). Thus the sequences necessary to direct correct expression of the ecmB gene lie upstream of the cap site, and their fusion to heterologous basal promoter elements has no apparent deleterious effect. Remarkably, a slightly smaller fragment, extending from nucleotide -1503 to -486 (construct E), directs B-gal expression in anterior pstA cells during culmination (Figure 3E) and is also expressed in the papilla of pstA cells during slug formation (data not shown). Thus, deletion of sequences between nucleotide -486 and -208 effectively changes the pattern of expression of the ecmB gene into that of the ecmA gene. In culminants derived from transformants containing construct E, cells within the stalk tube and in the upper and lower cups are also stained (Figure 3E). Although the upper cup is immediately adjacent to the papilla of pstA cells, it is possible to deduce their respective boundaries from the shape of the emerging spore head, and hence we are confident that the gene is expressed in the upper cup. (This conclusion is supported by analysis of construct G; see below.) A similar pattern of expression is observed for a fragment extending from nucleotide -1503 to -832 (construct F; Figure 3F). The fact that there is expression in the lower cup in construct F indicates that, if there is a lower cup-specific element downstream of -877, it must lie upstream of -632. A Fragment Containing the Region -872 to -757 Directs Expression in Anterior Prestalk Cells We have shown that construct A is activated in cells as they enter the stalk tube at culmination but construct B is completely inactive. This indicates that one or more regions of sequence between -877 and -656 are essential for expression in the stalk tube. To determine whether this region contains sequences that are also sufficient to direct prestalk-specific gene expression, the region -877 to -757 was synthesized as a PCR product and inserted into AlSABam-gal, to yield construct G. At culmination it directs expression in cells within the stalk tube and within pstA cells in the apical papilla but not in the upper and lower cups (Figure 3G). (Again we deduce that there is PO expression in the upper cup because the “shoulder” region of the aggregate is not stained. The fact that construct

Figure

3. Analysis

of the Expression

of ecmB

Promoter

Fragments

Coupled

A, which also lacks the region upstream of -877, is not expressed in the upper cup strongly supports this conclusion.) Although construct G is not detectably expressed in the lower cup it is not safe to assume that the sequences required for expression in these cells lie within the region -757 to -632. Construct F, which extends to -632 and is expressed in the lower cup, also differs from construct G in containing sequences upstream of -877. These are necessary for optimal expression in the lower cup, and their absence in construct G may account for its lack of expression in these cells. Discussion The ecmB promoter has a complex organization with at least three, and possibly four, separate regulatory elements (Figure 4). First, sequences between nucleotides -858 and -1503 direct expression in the subset of ALCs that sort to the upper cup during culmination. Second, the region downstream of -877 directs expression in the lower cup, and sequences downstream of -632 are not required for expression in these cells. With only 877 nucleotides present upstream of the cap site, the level of expression in the lower cup is extremely low. It is possible, therefore, that sequences between -877 and -632 interact with sequences further upstream to direct high level expression in the lower cup. Third, the region between nucleotides -877 and -757 is sufficient to direct expression in all anterior prestalk cells. There is a soluble DIF-binding protein with some of the properties expected of a steroid receptor (Insall and Kay, 1990) and this region may contain its binding site. Fourth, there is a negatively acting sequence, located between -486 and -208, which acts to repress expression in anterior prestalk cells until they enter the stalk tube at culmination. Thus regulation of the expression of the ecmB gene is more complex than might have been expected for a gene product characteristic of a single, differentiated cell type: the stalk cell. These observations shed new light on the nature of the cell types generated during Dictyostelium development and can, perhaps, give insights into the extracellular signals regulating cellular differentiation. In a previous study ALCs were purified from slugs by isolating the posterior region by microdissection and separating ALCs from prespore cells on a Percoll gradient (Devine and Loomis, 1985). Two-dimensional gel analysis showed the ALCs to be very similar to anterior, prestalk cells. The major differences were a decreased amount of two weakly prestalk-specific mRNAs, a reduced rate of synthesis of the ST430 (ecmA) protein, and the presence of a prespore-specific protein, PSP59. The latter protein is of limited usefulness as a marker, because it is first expressed in all cells and its synthesis is then turned off

to the p-Gal Gene

These are whole mounts of culminants stained for varying periods of time with X-Gal. They derive from transformant strains containing the fusion genes described in Figure 2. (A) Starting -1614 construct; (8) construct A stained for approximately 2 hr; (C) construct A stained for approximately 2 days; (D) construct C; (E) construct E; (F) construct F; (G) construct G. The lack of staining in the region of stalk within the spore head is an artifact, possibly caused by the inability of X-Gal to diffuse efficiently through the spore mass.

Cell 988

CAP Clal

Sau3A1

Ndel

A,“,

SaujA

-!614

Figure 4. The Proposed Promoter

Structure

of the ecm6

0 -I inr

-208

-486

on in upper CUP

on I” anterior prestalk cells

Off I" anterior prestalk cells

in prestalk cells (Morrissey et al., 1984). The reduced rate of synthesis of the ecmA protein is consistent with the fact that only about one-third of the ALCs express the ecmA gene and they do so at a very low level (Jermyn and Williams, 1991). These data led to the view that ALCs and anterior prestalk ceils are very similar in their properties. There is evidence for frequent interchange of cells between the anterior and posterior compartments during normal slug migration (Kakutani and Takeuchi, 1988) and Devine and Loomis (1985) suggested that ALCs are prespore or prestalk cells in the process of respecification. The fact that the ecm/3 gene is activated both in ALCs and anterior prestalk cells at culmination (Jermyn and Williams, 1991) would seem to support this notion. However, the observation that at culmination the elements of the ecmB promoter that direct expression in ALCs are different than those that direct expression in anterior prestalk cells argues against this view. This difference is remarkably clear cut, with an apparent complete cell type specificity of the two different regions of the promoter. The fact that ALCs and anterior prestalk cells differ in their ability to activate specific promoter elements raises the possibility that there may be gene products specific to one or other cell type that were not detected by gel electrophoresis. Also, construct C provides a specific marker that can be used to characterize the subset of ALCs that sort to the upper cup. The Dictyostelium slug is a regulative structure, in which extracellular signals act to direct cellular differentiation and hence maintain the ratios of the various cell types (Blaschke et al., 1986). Presumably, therefore, ALCs and anterior prestalk cells perceive different extracellular signals. Assuming that DIF acts as the inducer in both the anterior and posterior compartments, there may be a difference in the level of DIF, or of a DIF antagonist, between the two regions. This would require that there be distinct thresholds of induction for the two different ecmf3 promoter regions. Alternatively, different inducers may be operative. There are several DIF-related compounds that are biologically active in stalkcell induction, albeit at a higher concentration than DIF itself (Masento et al., 1988). One of these may specifically activate one or other of the two promoter regions. The existence of distinct regions of the promoter directing expression in different subpopulations of the ALCs adds further potential complexities to the extracellular signaling system. During culmination there is an induction of ecmB gene expression in ALCs before they sort to sur-

round thespore head (Jermyn and Williams, 1991), but we cannot rule out a further activation, after cells coalesce to form the upper cup. Indeed, the fact that expression in ALCs that sort upward can be uncoupled from expression in those that sort downward suggests the existence of such an activation, with inductive conditions at the upper cup differing from those at the lower cup. Analysis of the ecmB promoter provides evidence for the existence of a repressor that prevents activation of the ecmB gene until cells enter the stalk tube at culmination. We propose this to be a protein that binds to the region between -486 and -208 and lies at the end of a signal transduction pathway activated by an extracellular inhibitor of culmination. There are two strong candidates for this latter role, CAMP and NH3. At times after cells become competent to respond to DIF, CAMP acts to repress expression of the ecmB gene but marginally stimulates expression of the ecmA gene (Berks and Kay, 1988, 1990). NH3 is antagonistic to DIF, in its induction of the expression of the ecmB gene and in stalk cell formation (Gross et al., 1983; Wang et al., 1990) and a drop in NH3 concentration is believed to be the trigger for culmination (Schindler and Sussman, 1977). These two possibilities for a DIF antagonist need not be mutually exclusive. High NH3 levels are known to elevate intracellular CAMP concentration (Riley and Barclay, 1990). Therefore, a drop in NH, levels at culmination may trigger ecmB gene expression by reducing intracellular CAMP. If this model is correct then the negative element between -475 and -208 should confer responsiveness to intracellular CAMP. We are currently testing this hypothesis. Experimental

Procedures

Cell Culture and Development Transformants of the axenic strain Ax2, isolated as described previously (Early and Williams, 1987; Nellen et al., 1984) were grown in the presence of G418 at 20 ug/ml. For development, cells were washed in KKZ (16.5 mM KH2P04, 3.8 mM K2HP04 [pH 8.21) and spread on nitrocellulose filters. When migrating slugs were to be analyzed, cells were developed on 2% Bacto agar (Difco) plates. These were incubated at 22V either in clear humid boxes or in dark, humid chambers with a single slit to allow light entry. In situ detection of D-gal activity was performed as described previously (Dingermann et al., 1989) with staining times of 1-4 hr except where indicated in the legend to Figure 3. Construction of Mutants The clone pDd58CAT (Jermyn et al., 1989) was used as a template for PCR reactions to generate DNA fragments for cloning. PCRs were performed using Taq DNA polymerase (AmpliTaq, Perkin-Elmer Cetus) in 100 ul of 10 mM Tris-HCI (pH 8.3) 50 mM KCI, 1.5 mM

Dictyostelium 989

Stalk Cell Differentiation

MgCI,, and 0.1% Triton X-100, containing approximately 20 pg of template and 50 pmol of each primer. After the PCR, reaction products were extracted once with phenol-chloroform and ethanol precipitated. The DNAwas digested with restriction enzymes (recognition sites were incorporated in the oligonucleotides used as primers), ligated into the appropriate vector, and transformed into Escherichia coli. Details of the structure of individual constructs are given in the legend to Figure 2. Acknowledgments We would like to thank David Ratner and Adrian Harwood for their careful reading and constructive comments on this manuscript. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received

January

9, 1991; revised

March

4, 1991

McRobbie, S., Tilly, R., Blight, K., Ceccarelli, A., and Williams, J. G. (1988a). Identification and localization of proteins encoded by two DIF inducible genes of Dictyostelium. Dev. Biol. 725, 59-63. McRobbie, S. J., Jermyn, K. A., Duffy, K., Blight, K., and Williams, J. G. (1988b). Two DIF-inducible, prestalk-specific mRNAs of Dictyostelium encode extracellular matrix proteins of the slug. Development 704, 275-284. Morrissey, J., Devine, K., and Loomis, W. (1984). The timing of celltype-specific differentiation in Dictyostelium discoideum. Dev. Biol. 703, 414-424. Neave, N., Kwong, L., Macdonald, J., and Weeks, G. (1986). The distribution of the stalk cell-differentiation inducing factor and other lipids during the differentiation of Dictyostelium discoideum. Biochem. Cell Biol. 64, 85-90. Nellen, W., Silan, C., and Firtel, R. (1984). tion in Dictyostelium discoideum-regulated gene fusion. Mol. Cell. Biol. 4, 2890-2898.

References Ayres, K., Neuman, W., Rowekamp, W., and Chung, S. (1987). Developmental regulation of DNAse l-hypersensitive sites in Dictyostelium discoideum. Mol. Cell. Biol. 7, 1823-1829. Berks, M., and Kay, R. R. (1988). cell differentiation in Dicfyostelium 114.

Cyclic AMP is an inhibitor of stalk discoideom. Dev. Biol. 125, 108-

Berks, M., and Kay, R. R. (1990). Combinatorial control of cell differentiation by CAMP and DIF-I during development of Dictyostelium discoideum. Development 770, 977-984. Blaschke, A., Weijer, C., and Macwilliams, H. (1986). Dictyosteiium discoideum cell type proportioning, cell differentiation preference, cell fate, and the behavior of anterior-like cells in HSlIHS2 and G+/Gmixtures. Differentiation 32, l-9. Bonner, J. T. (1952). The pattern of differentiation molds. American Naturalist 86, 79-89.

in amoeboid

slime

Brookman, J., Jermyn, K., and Kay, R. (1987). Nature and distribution of the morphogen DIF in the Dictyostelium slug. Development 700, 119-124. Devine, K., and Loomis, W. (1985). Molecular characterization of anterior-like cells in Dicfyosfelium discoideum. Dev. Biol. 707, 364372. Dingermann, Harwood, A., situ detection Dicfyostelium

Masento, M., Morris, H., Taylor, G., Johnson, S., Skapski, A., and Kay, R. (1988). Differentiation-inducing factor from the slime mold Dictyosteliom discoideum and its analogs: synthesis, structure and biological activity. Biochem. J. 256, 23-28.

T., Reindl, N., Werner, H., Hildebrandt, M., Nellen, W., Williams, J., and Nerke, K. (1989). Optimization and in of Escherichia co/i 8-galactosidase gene expression in discoideum. Gene 85, 353-362.

Driever, W., and Nusslein-Volhard, C. (1988). A gradient tein in Drosophila embryos. Cell 54, 83-93.

of bicoid

pro-

Early, A., and Williams, J. (1987). Two vectors which facilitate gene manipulation and a simplified transformation procedure for Dictyostebum discoideum. Gene 59, 99-106. Gregg, J., and Davis, R. (1982). Dynamics of cell redifferentiation Dictyostelium mucoroides. Differentiation 27, 200-205. Gross, J., Bradbury, J., Kay, R., and Peacey, M. (1983). pH and the control of cell-differentiation in Dictyostelium Nature 303, 244-245. Insall, R., and Kay, R. R. (1990). A specific Dictyostelium. EMBO J. 9, 3323-3328.

DIF binding

in

intracellular discoideum. protein

in

Jermyn, K. A., and Williams, J. G. (1991). An analysis of culmination in Dictyostelium using prestalk and stalk-specific cell autonomous markers. Development 7 7 7, 779-787. Jermyn, K. A., Berks, M., Kay, R. R., and Williams, J. G. (1987). Two distinct classes of prestalk-enriched mRNA sequences in Dictyostebum discoideum. Development 700, 745-755. Jermyn, K. A., Duffy, K., and Williams, J. G. (1989). A new anatomy of the prestalk zone of Dictyostelium. Nature 340, 144-146. Kakutani, T., and Takeuchi, I. (1986). Characterization cells in Dictyostelium as analyzed by their movement. 439-445.

of anterior-like Dev. Biol. 775,

DNA-mediated expression

transformaof an actin

Pears, C. J., and Williams, J. G. (1988). Multiple copies of a G-rich element upstream of a CAMP-inducible Dicfyostelium gene are necessary but not sufficient for efficient gene expression. Nucl. Acids Res. 16, 8487-8488. Riley, B. B., and Barclay, S. M. (1990). Ammonia promotes accumufation of intracellular CAMP in differentiating amoebae of Dictyosfelium discoideum. Development 709, 715-722. Schaap, P., Pinas, J., and Wang, M. (1985). tion in several cellular slime mold species.

Patternsof cell differentiaDev. Biol. 777, 51-61.

Schindler, J., and Sussman, M. (1977). Ammonia choice of morphogenetic pathways in Dictyostelium Mol. Biol. 776, 161-170.

determines discoideum.

the J.

Simeone, A., Acampora, D., Arcioni, L., Andrews, P. W., Boncinelli, E., and Mavilio, F. (1990). Sequential activation of HOX2 homeobeox genes by retinoic acid in human embryonal carcinoma cells. Nature 346, 763-766. Sternfeld, J., and David, C. N. (1981). tion in Dictyosfelium. Differentiation

Cell sorting 20, 10-20.

during pattern

Sternfeld, J., and David, C. (1982). Fate and regulation cells in Dictyostelium slugs. Dev. Biol. 93, 11 l-l 18.

forma-

of anterior-like

Thaller, C., and Eichele, G. (1987). Identification and spatial ditribution of retinoids in the developing chick limb bud. Nature 327, 626-628. Tickle, C., Summerbell, D., and Wolpert, of retinoic acid to the limb bud mimics region. Nature 254, 199-202.

L. (1982). Local application the action of the polarizing

Wang, M., Roelfsema, J. H., Williams, J. G., and Schaap, P. (1990). Cytoplasmic acidification facilitates but does not mediate DIF-induced prestalk gene expression in Dictyostelium discoideum. Dev. Biol. 740, 182-,188. Wrlliams, J. G., Ceccarelli, A., McRobbie, S., Mahbubani, “1. R., Early, A., Berks, M., and Jermyn, K. A. (1987). Direct of Dictyostelium prestalk gene expression by DIF provides that DIF is a morphogen. Cell 49, 185-192.

H., Kay, induction evidence