Positive–Negative selection for homologous recombination in Arabidopsis

Gene 272 (2001) 249±255

www.elsevier.com/locate/gene

Positive±Negative selection for homologous recombination in Arabidopsis Helen Xiaohui Wang a,b, Jean-Frederic Viret a,c, Adam Eldridge a,d, Ranjan Perera a,e, Ethan R. Signer a,f, Maurizio Chiurazzi a,g,* a

Department of Biology, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139, USA b Novartis Seeds Biotech Research, 3054 Cornwallis Road, Research Triangle Park, NC 27709, USA c Pricewaterhouse Coopers, Ten Almaden Boulevard, San Jose, CA 95113, USA d Cancer Biology Program, Stanford University School of Medicine, Stanford, CA 94305, USA e Akkadix, 11099 North Torrey Pines Road, Suite 200, La Jolla, CA 92037, USA f Hereditary Disease Foundation, 230 Park Avenue, New York, NY 10169, USA g International Institute of Genetics and Biophysics, Via Marconi 12, 80125, Naples, Italy Received 1 February 2001; received in revised form 23 April 2001; accepted 16 May 2001

Abstract In plants gene knock-outs and targeted mutational analyses are hampered by the inef®ciency of homologous recombination. We have developed a strategy to enrich for rare events of homologous recombination in Arabidopsis using combined positive and negative selection. The T-DNA targeting construct contained two ¯anking regions of the target alcohol dehydrogenase gene as homologous sequences, and neomycin phosphotransferase and cytosine deaminase as positive and negative markers, respectively. A root explant transformation procedure was used to obtain transgenic calli. Among 6250 transformants isolated by positive selection, 39 were found to be resistant to negative selection as well. Of these 39, at least one had undergone homologous recombination correlated with a unidirectional transfer of information. Although the ADH locus was not changed, our data demonstrate that a homologous recombination event can be selected by positive negative selection in plants. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Arabidopsis thaliana; Alcohol dehydrogenase; Gene conversion

1. Introduction Several studies on homologous recombination in plants have been reported (Mengiste and Paszkowski, 1999), most of them conducted in protoplast systems either by direct DNA transfer (Halfter et al., 1992; Offringa et al., 1993; Paszkowski et al., 1988) or by Agrobacterium-mediated transformation (Offringa et al., 1990; Risseeuw et al., 1995, 1997). Targeted recombination among random insertion events has been found, in most of the cases, at frequenAbbreviations: 3 0 ocs, octopine synthase terminator; 5 0 -FU, 5-¯uorouracyl; 5-FC, 5-¯uorocytosine; 5-FC r, 5-¯uorocytosine resistant; A. thaliana, Arabidopsis thaliana; ADH, alcohol deydrogenase; bp, base pair(s); codA, cytosine deaminase; Kan r, kanamycin resistant; Kan s, kanamycin sensitive; kb, kilobases; L. japonicus, Lotus japonicus; mg/l, milligram per liter; NPTII, neomycin phosphotransferase; nt, nucleotides; p35S, 35S promoter; PCR, polymerase chain reaction; pnos, nopaline synthase promoter; PNS, positive negative selection * Corresponding author. International Institute of Genetics and Biophysics, Via Marconi 12, 80125, Naples, Italy. Tel.: 139-081-7257223; fax: 139-081-5936123. E-mail address: [email protected] (M. Chiurazzi).

cies of the order of 10 25 (Lee et al., 1990; Miao and Lam, 1995), while in a single report a knock-out event was achieved among 750 transformants (Kempin et al., 1997). Combined positive and negative selection (PNS) was ®rst developed to enrich for rare homologous recombinants in mouse knockout studies (Mansour et al., 1988). The donor construct includes the targeting sequence, as well as both a positive and a negative selective marker. The positive marker ensures that the recipient cell has integrated the targeting sequence. The negative marker ¯anks the targeting sequence, so that transformants integrating randomly the entire donor construct are sensitive to negative selection, whereas transformants integrating only the targeting sequence by homologous recombination necessarily do not integrate the negative selective marker as well, and therefore are resistant to negative selection (Fig. 1). For plants, appropriate markers are available. The widely used positive selective marker NPT (neomycin phosphotransferase) encodes resistance to kanamycin. The negative selective marker codA (cytosine deaminase) catalyses the conversion of non-toxic 5-¯uorocytosine (5-FC) to toxic 5 0

0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(01)00532-7

250

H. Xiaohui Wang et al. / Gene 272 (2001) 249±255

Fig. 1. Strategy for the targeted disruption of the ADH gene and analysis of recombination events. The genomic DNA (A), T-DNA (B) and the predicted structure of non-recombinant (C) and recombinant events (D) are indicated. Restriction enzyme sites: B, BamHI; Bg, BglII; R, EcoRI; Sc, SacI; Sp, SphI, A, ApaI. LB and RB are left border and right border of T-DNA, respectively. Black bars indicate the probes a, b and c used in the Southern blot analysis. Grey arrowheads indicate the primers used in the PCR analysis.

¯uorouracyl (5 0 -FU) and has been developed for Arabidopsis thaliana (Perera et al., 1993), tobacco and Lotus japonicus (Stougaard, 1993). Recently PNS has been applied to A. thaliana and L. japonicus where a signi®cant enrichment due to the use of codA as negative marker has been described (Gallego et al., 1999; Thykjar et al., 1997). Nevertheless, neither gene replacement nor other types of homologous recombination events were selected despite the use of a long donor targeting sequence (23 kb) (Thykjar et al., 1997), and the analysis of two different loci in both plants. Here we describe a different approach for PNS in Arabidopsis. In our approach the PNS was applied to the agrobacterial transformation of root explants cultures that have been reported to achieve a higher frequency of single TDNA insertion (Grevelding et al., 1995), a key factor in the success of a PNS strategy. Embryogenic calli were obtained by the root explants and transformed with the Agrobacterium strain carrying the targeting construct. The target locus in our experimental system is the alcohol deydrogenase gene (ADH) whose activity can be easily evaluated (Jacobs et al., 1988), allowing the analysis of the target functional destruction on the doubly-selected transformants. We were able to select and characterize a single non-reciprocal homologous recombination event

with a large transfer of information from one ¯anking region of the target gene to the incoming T-DNA. As a consequence, an ectopically repaired copy of the ADH gene was integrated elsewhere into the genome. The reported event is the ®rst example of a homologous recombination event selected by PNS in plants and represents a step forward in the development of such a system in plants.

2. Materials and methods 2.1. Transformation and positive and negative selection The targeting construct was introduced into AGL1, a recA mutant strain of Agrobacterium tumefaciens (Lazo et al., 1991). The Arabidopsis ecotype Bensheim, was transformed. A modi®ed version of the transformation protocol described in Marton and Browse (Marton and Browse, 1991) has been followed. The harvested roots were cultured on callus-inducing medium for 12 d, at which point many embryogenic calli were formed along the length of the roots. Calli surviving the positive selection were then cultured on a combined PNS medium composed of medium supplemented with 50 mg/l kanamycin, 500±750 mg/l 5-¯uorocytosine

H. Xiaohui Wang et al. / Gene 272 (2001) 249±255

(5-FC). The calli for which PNS response was still unclear were subjected to a further round of PNS by transfer to medium containing 50±65 mg/l kanamycin, 750 mg/l 5FC. Green shoots were transferred to non-selective rootinducing medium (Damm et al., 1989). T1 progeny were re-selected by culturing sterilized seeds on GM medium containing 25 mg/l kanamycin and 500 mg/l 5-FC. 2.2. DNA manipulations The construction of the ADH5 0 -Pnos-NPT-3 0 ocs-ADH3 0 cassette shown in Fig. 1B has been previously described (Chiurazzi and Signer, 1994). The 7.0 kb BamHI- BglII region was ligated into PUC18 (cut with BamHI) to obtain pMC5. This ligation destroys the right end BglII site. pMC5 was then linearized with SmaI and blunt-end-ligated with the 2.2 kb EcoRI fragment including the P35S-codA-3 0 ocs cassette (Perera et al., 1993) to obtain pMC67. pMC67 was cut with AatII, ®lled out with T4 polymerase, and blunt-endligated into the ScaI site of the binary vector pGA-3-Sh (Perez et al., 1989) which had its NPT and Sh genes ®rst deleted by BamHI to obtain pMC72. Extraction of genomic DNA from leaves and Southern blot experiments were carried out according to Dellaporta et al. (1983). Oligonucleotide primers (Fig. 1) were as follows (5 0 -3 0 ): P1 P2 P3 P4 P5 P6

GGTGCAAAGCTCACTTAAGCA; CACTCAAACCCTCATGGTCCA; TACGCACCGTTTTGTGCCTTG; TTCGAGTACCCCGAAATCTCC; AGAACCTGCGTGCAATCCATC; TCGCCTTCTATCGCCTTCTTG.

Standard cycles and conditions were used for PCR reactions. DNA sequencing was determined with a Thermo Sequenase radiolabeled terminator cycle sequencing kit (Amersham, Milan, Italy). 2.3. Allyl alcohol assay The procedure described in Jacobs et al. (1988) has been followed. 3. Results 3.1. Experimental design Fig. 1 illustrates the PNS transformation strategy for targeting of the Arabidopsis ADH gene by homologous recombination. The targeting construct contains two sequences homologous to the ¯anking regions of the target locus, namely, the 5 0 (2.7 kb) and 3 0 (2.8 kb) ¯anking regions of the ADH. The NPT gene is located between the two homologous sequences, and serves two functions: ®rst, it allows positive selection of transformants for resis-

251

tance to kanamycin, and second, as consequence of a double crossover it can replace the endogenous ADH coding sequences to generate an inactive ADH allele and thereby report successful targeting (Fig. 1B). The codA gene, linked to the 5 0 -¯anking region near the left TDNA border, catalyzes the conversion of non-toxic 5-¯uorocytocine (5-FC) to toxic 5-¯uorouracil (5-FU). Integration of the entire construct renders the resulting transformants sensitive to 5-FC, homologous recombination in the 5 0 ¯anking (either a crossover or gene conversion) eliminates the codA marker, so that the resulting transformant will be resistant to kanamycin and to 5-FC. Alternative mechanisms that can determinate the loss of codA activity are conversion of the T-DNA by the target locus, degradation of the T-DNA and gene silencing. 3.2. Transformation of embryogenic cells and Positive± Negative selection conditions For the positive negative selection, we decided to follow the experimental scheme previously described (Gallego et al., 1999) and therefore to apply the negative selection after the isolation of kanamycin resistant calli. However, an important difference in our experimental system was the transformation procedure. We used root explants as starting material for transformation because these have been reported to increase the frequency of single T-DNA insertions (64%) compared with a leaf-disc transformation method (Grevelding et al., 1995). In Arabidopsis, both adventitious embryogenesis and transformation of embryogenic cells are ef®cient (Marton and Browse, 1991), and we have therefore used embryogenic calli as a cell source. A large number of embryogenic calli could be induced from ecotype Benshein after roots were cultured on ARMI medium for 12 days, and ,100 kanamycin-resistant calli could be obtained per 20 cm Petri dish. To determine conditions necessary for PNS in our experimental system, we applied dual selection stresses over a range of drug concentrations to two independent transgenic lines bearing the targeting construct. Concentrations of 500± 1000 mg/l 5-FC and 50±60 mg/l kanamycin resulted in clear lethal effects in both lines, though the two lines responded slightly differently to the lower concentrations. The concentrations of 500±750 mg/l 5-FC and 50±60 mg/l kanamycin chosen for further work generally resulted in tight selection with dark green shoots escaping only rarely. In a few experiments, however, morphogenesis occurred much earlier than usual, and shoots grew very fast for unknown reasons. In such cases shoots or plantlets were observed closely and labeled for further monitoring, kanamycin-sensitivity being recognized as pale spots on quickly-growing leaves, and 5-FC sensitivity as brown or pale coloration in callus basal sectors or leaves. Among a collection of 6250 kanamycin-resistant transformants, 39 candidates also resistant to 5-FC were selected.

252

H. Xiaohui Wang et al. / Gene 272 (2001) 249±255

3.3. Southern analysis and markers segregation of candidates The 39 candidates were analyzed by Southern blotting with the entire Pnos-NPT-3 0 ocs region as a probe (probe b in Fig. 1B). The expected pattern of non-homologous or homologous recombination events are described in Fig. 1C,D. A single transformant (line 4) showed the expected targeted homologous recombination pattern of BglII bands at 3.9 and 4.4 kb (Fig. 2A). Further digestion with EcoRI of line 4 gave also the predicted recombinant band at 5.7 kb (Fig. 2A). Both patterns are consistent with an event of double-crossover recombination (gene-replacement). The additional BglII bands at 6.2 and ,10.0 kb and EcoRI band at ,12 kb (Fig. 2A), presumably represent a second, random insertion. This unexpected insert probably re¯ects deletion of the left arm eliminating the EcoRI site in the random insert (see Fig. 1B). This was con®rmed by analysis

Fig. 2. Southern blot analysis of line 4 and 27. (A) DNA of line 4 BglII and EcoRI digested and hybridized with probe b of Fig. 1. (B) hybridization of the PCR ampli®ed fragments obtained by line 27 with probe a. (C) DNA of line 27 (pool of T1 plants) BglII digested and hybridized with probe b. (D) DNA of line 27 (pool of T1 plants) digested with BglII and hybridized with probe a. (E) DNA of T2 segregants of line 27 BglII digested and hybridized with probe c. Lanes 1±10, independent Kan r T2 segregants, wt, wild type DNA. (F) DNA of a pool of T2 segregants of line 27 SphI 1 ApaI and SphI digested and hybridized with probe a. The sizes of the wild type and recombinant bands are indicated.

of absence of codA (see below). Unfortunately, this line was lost during the regeneration procedure and could not be further analyzed. The BglII digestions indicated that 69% (27/39) of the doubly-selected transformants, have single copies of the NPTII gene, whereas 31% (12/39) have two or more copies (data not shown). These data are consistent with the analysis of segregation of the Kan r phenotype among T1 segregants (data not shown). Furthermore, among the segregants from PNS transformants, the ratio of double resistant (kanamycin and 5-FC) to sensitive progeny was slightly lower than Kan r/Kan s, possibly re¯ecting increased stress of the dual selection on seed germination (data not shown). 3.4. Fate of the negative selective marker Since all the candidates analyzed here were selected as resistant to 5-FC, the negative selective codA marker should be either absent or inactive. In order to provide information on the fate of the negative marker and thus to check whether the absence of the codA expression was due to large T-DNA deletion or to other reasons (silencing, point mutation, small deletion), we tested most of the doubly-selected lines (27 out of 39) for the presence of codA by Southern blotting. DNA was digested with BglII and hybridized with a p35ScodA probe (Fig. 3). Among the 27 lines analyzed, 19 (70%) gave no signal, indicating a large deletion of codA; signi®cantly, these included the potentially targeted transformant (line 4). In the remaining eight transformants which instead gave a signal with the codA probe (Fig. 3, lines: 7, 12, 13, 14, 17, 18, 20, 23), the sizes of the hybridizing bands were

Fig. 3. Southern blotting of negative selection marker. DNA of 27 out of the 39 doubly-selected lines was BglII digested and hybridized to the 35S-codA probe. Numbers on the top of the panels indicate the transgenic lines analyzed. Sizes are indicated in kb.

H. Xiaohui Wang et al. / Gene 272 (2001) 249±255

identical to the bands observed with the NPTII probe (data not shown), indicating that fracturing and random integration of the T-DNA did not occur at high frequency. Within this set, line 17 showed a 4.0 kb codA hybridizing band (Fig. 3) that suggested inactivation of the codA gene by partial deletion (see Fig. 1C). In the other seven lines, either silencing or partial deletion of codA is a possible explanation for survival to negative selection. However, this effect seems not to be associated with multiple-copy-induced silencing of the codA since Southern blot analysis (Fig. 3) and segregation of the Kan r marker (data not shown) suggested that a single copy of the T-DNA was integrated in these lines. This result clearly indicates that a large rearrangement of the TDNA molecule (possibly a signi®cant degradation from the left border) is responsible of the selection of at least 74% of the Kan r-5-FC r lines. 3.5. Further molecular analysis of the progeny To complete the Southern analysis and search for homologous recombination events that do not give the expected gene replacement pattern, a PCR screening was performed. Such recombination events can include a conversion of the T-DNA by the target locus with a concomitant loss of the codA gene. When homologous recombination has taken place, the primers indicated in Fig. 1D should amplify fragments of 4.5 kb (P1±P5) and 3.6 kb (P2±P5) and 3.9 kb (P3± P6) and 4.7 kb (P4±P6), respectively. Twenty out of the 27 lines described above, allowed further analysis of progeny. DNA was extracted from a pool of T1 Kan r segregants and the two bands representing the 5 0 recombination junction, were obtained from line 27 only, whereas the primer pairs P3±P6 and P4±P6, did not generate bands in any of the candidates tested (data not shown). Ampli®ed fragments of the expected sizes have been previously observed in a different PNS protocol applied to cell suspension cultures (Gallego et al., 1999) but further analysis indicated that those bands were not diagnostic of a gene conversion event. Thus, the positive PCR ampli®ed products obtained from line 27 with the two set of primers covering the 5 0 ¯anking region of the ADH gene were subjected to Southern blotting (Fig. 2B). Both bands strongly hybridized to the 5 0 ¯anking fragment which was not included in the construct (probe a in Fig. 1A). This result is diagnostic of a 5 0 recombinant junction in line 27 and is in agreement with the results of the Southern blots shown in Fig. 2C,D. Fig. 2C shows that hybridization of the BglII digested DNA with the exogenous NPTII probe lightened the 5 0 recombinant 3.9 kb band (see Fig. 1D), and a 12 kb band (rather than 4.4 kb). This result further indicated that homologous recombination did not take place in the 3 0 ADH ¯anking region (see Fig. 1D). The expected wild type 10 kb band was detected with probe a (Fig. 2D). To obtain more accurate information, the 4.5 kb fragment ampli®ed by PCR was then sequenced. The sequence from the NPT 5 0 primer indicated a conservation of the T-DNA

253

structure. Sequencing of the ampli®ed fragment with primers P1 and P2 con®rmed the recombinant nature of the fragments and indicated the precise junction site in accordance with the Southern data. 3.6. ADH functional analysis and Southern blotting in progenies of line 27 The results shown in Fig. 2B±D indicated that in line 27 a homologous recombination event took place at one end but not the other. To check whether this event was coupled with a rearrangement at the target locus (Risseeuw et al., 1995), we tested the T2 and T3 generation of line 27 for ADH function. Wild type ADH catalyses conversion of nontoxic allyl alcohol to the toxic compound acrolein, and therefore ADH mutants survive treatment with allyl alcohol (Jacobs et al., 1988). Several hundred T2 and T3 seeds of line 27 were plated on germination medium supplemented with allyl alcohol. No seeds germinated indicating an intact ADH gene. The same negative result was obtained with the T1 seeds of the other 20 lines analyzed by PCR. Furthermore, genomic DNA was isolated from 10 Kan r T2 segregants of line 27, digested with BglII and hybridized with the ADH probe c of Fig. 1. The bands obtained were the same in all the T2 segregants (Fig. 2E). As expected, the wild type 10 kb band was observed together with the 12 kb band to which the NPTII probe b hybridized (Fig. 2C). We interpret these data as indicating that in line 27 a non-reciprocal recombination event took place and the ADH locus was left unchanged. Although an alternative possibility that gene targeting occurred in line 27 and that the homozygous segregants were lethal can not be excluded, the stoichiometry of the hybridizing bands (Fig. 2E) suggests that the TDNA is homozygous in some of the segregants (lanes 1, 5). To understand how much information had been transferred, we digested line 27 DNA with enzymes SphI and SphI plus ApaI that cut upstream of the BglII site. As shown in Fig. 2F, probe a gives the two wild type bands of 20 kb (SphI fragment, Fig. 1A) and 17 kb (SphI- ApaI fragment, Fig. 1A). In addition we detect two bands of 10.5 and 7.2 kb, respectively, whose sizes are consistent with the recombinant fragments indicated in Fig. 1D. Therefore, the information transferred extended at least to the SphI site located 6.5 kb upstream of the BamHI site representing the left end of homology in the incoming T-DNA. The presence of only two bands in Fig. 2F excludes strict linkage (within the region de®ned by the two SphI sites in the ADH locus) of the integrated recombinant T-DNA with the ADH locus. 4. Discussion We have applied PNS for homologous recombination at the ADH locus of A. thaliana embryogenic cultures. A classical gene-replacement event could not be con®rmed in our analysis since the candidate line for such a gene targeting event, showing several hybridizing bands expected as a

254

H. Xiaohui Wang et al. / Gene 272 (2001) 249±255

result of a double cross-over pathway, was lost during the regeneration procedure. However, a clear-cut evidence for the selection of a one-side homologous recombination event has been obtained. In plants different types of homologous recombination events have been reported. An `ectopic recombination' event as a combination of homologous and illegitimate recombination has been previously characterized (Offringa et al., 1993). In that report, a defective Kan r gene present on the incoming T-DNA was restored by homologous recombination (gene conversion) with the target locus; the target locus was left unchanged and the corrected T-DNA inserted far from the target locus. Here we suggest that recombination in line 27 took place through a similar two-step recombination pathway: in the ®rst step, annealing occurred between the left homologous sequences and via end extension repair chromosomal sequences were copied from the 5 0 ¯anking ADH locus. Such a mechanism depends on the invasion of a 3 0 -ended strand into an intact template sequence to initiate new DNA synthesis by homologous recombination. When the end of the invading DNA is not homologous to the donor, the non-homologous sequence must be removed before new synthesis can begin (Paques and Haber, 1997), thus leading to the loss of the codA gene in line 27 (Fig. 3). Our data show that the gene conversion event was extended for at least 6.5 kb (Fig. 2F). In plant, an analogous repair via end extension has been reported with copy of the chromosomal sequences over a length of more than 10 kb (Risseeuw et al., 1995). In S. cerevisiae very long co-conversions involving up to 70 kb have been reported (Voelkel-Meiman and Roeder, 1990). Long conversions have also been reported in mammalian cells by Richardson and Moynahan (1998) where the lack of crossover events that would have led to translocations supports a model in which recombination is coupled to replication. Line 27 does not show any evident somatic morphological abnormalities or loss of fertility, indicating that gene conversion was not coupled with translocation or chromosomal aberration. Subsequently, as a second step, the extended T-DNA with the acquired ADH information was integrated randomly into the genome via illegitimate recombination giving an ectopically inserted ADH sequence in a locus not strictly linked to the wild type allele. Gene conversion after a random integration event of the T-DNA, which could alternatively explain line 27, is quite unlikely because of the observed low frequency of ectopic homologous recombination in plants (Puchta, 1999). However, it can not be excluded that such an event occurred at the somatic level, and was then selected from a large cell population. PNS as a strategy to enrich for the rare events of gene targeting in plants has been attempted elsewhere. Thykjar et al. (1997) in L. japonicus by using a targeting construct carrying very long regions of homology and codA as negative marker, obtained a 100-fold enrichment for putative targeting events, due to the codA marker, but did not ®nd homologous recombination events among 185 doubly

selected transformants. More recently Gallego et al. (1999) reported an at least 25-fold enrichment for putative targeting events, due to the use of codA, but neither gene replacement or gene conversion events from the target locus were selected. In our work we obtained a 160-fold enrichment (39 5-FC r/6250 Kan r) and were able to identify and characterize a homologous recombination event among the doubly-selected candidates. No evident gene replacement was detected, although there is some uncertainty for candidates that could not be regenerated, particularly line 4 which had the recombinant bands (Fig. 2A) predicted for a precise gene replacement event. The relative success of our strategy is probably related to the higher enrichment observed in our conditions (160 fold) which could be due to several factors since, as previously stated (Gallego et al., 1999), the additional selective power offered by the PNS protocol might vary in a signi®cant way from experimental system to experimental system. One of the more important parameter to establish the success of a PNS protocol is the number of transforming molecules per cell as integration of a second un-recombined T-DNA copy will lead to selection against cells that have undergone the desired targeting event. The root transformation method used here, which favors single T-DNA insertions (Grevelding et al., 1995) compared with the hypocotyl and suspension culture procedures used by others (Gallego et al., 1999; Thykjar et al., 1997) can be one of the key factors to explain our higher enrichment. Furthermore, the structural stability of the T-DNA in the cell either before, during or after the integration event (Risseeuw et al., 1997) is another factor that establishes the success of a PNS protocol. The plant somatic embryogenic tissues used in our experimental system are genetically stable, exhibiting both less somaclonal variation and a strong capacity for plant morphogenesis. However, our analysis on the small sample of selected lines showed that a signi®cant rearrangement of the T-DNA molecule was detected in at least 74% of the cases (Fig. 3). The event described in this work represents the ®rst example of a homologous recombination event selected by PNS in plants. Although we were not successful in knocking out the gene, our strategy did in fact enrich for one of the two homologous recombination events required, thus bringing practical gene targeting one step closer. One possibility is that a double cross-over could be selected by placing negative markers at both ends of the targeting construct. PNS could be particularly useful if combined with new transformation methods that can produce higher numbers of transformants. Since, 5-FC can be applied to germinating seeds a PNS strategy might be particularly effective when combined with vacuum ¯oral in®ltration (Clough and Bent, 1998). Acknowledgements We thank Dr Giovanna Grimaldi, Dr Aurora Storlazzi and

H. Xiaohui Wang et al. / Gene 272 (2001) 249±255

Dr Kathleen Smith for valuable discussion. This research was supported by post-doctoral fellowships from the US National Institute of Health to J.V. and from the Consiglio Nationale delle Ricerche and the North Atlantic Treaty Organization to M.C., and research grants from the US National Science Foundation (MCB-9318929, MCB 9206129) and the US Department of Agriculture (9337304-8945) to E.R.S. M.C. acknowledges support from the MURST via a grant to IIGB. References Chiurazzi, M., Signer, E.R., 1994. Termini and telomers in T-DNA transformation. Plant Mol. Biol. 26, 923±934. Clough, S., Bent, A.F., 1998. Floral dip: a simpli®ed method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735±743. Damm, B., Schmidt, R., Willmitzer, L., 1989. Regeneration of fertile plants from protoplasts of different Arabidopsis thaliana genotypes. Mol. Gen. Genet. 17, 6±12. Dellaporta, S.L., Wood, J., Hicks, J.B., 1983. A plant DNA mini preparation: version II. Plant Mol. Biol. Rep. 1, 19±21. Gallego, M.E., Sirand-Pugnet, P., White, C.I., 1999. Positive±Negative selection and T-DNA stability in Arabidopsis transformation. Plant Mol. Biol. 39, 83±93. Grevelding, C., Fantes, V., Miao, Z.H., Lam, E., 1995. Single-copy T-DNA insertions in Arabidopsis are the predominant form of integration in root-derived transgenics, whereas multiple insertions are found in leaf discs. Plant J. 7, 359±365. Halfter, U., Morris, P.C., Willmitzer, L., 1992. Gene targeting in Arabidopsis thaliana. Mol. Gen. Genet. 231, 186±193. Jacobs, M., Dolferus, R., Van den Bossche, D., 1988. Isolation and biochemical analysis of ethyl methanesulfonate-induced alcohol dehydrogenase null mutants of Arabidopsis thaliana (L.) Heynh. Biochem Genet. 26, 105±122. Kempin, S., Liljegren, S.J., Block, L.M., Rounsley, S.D., Yanofsky, M.F., Lam, E., 1997. Targeted disruption in Arabidopsis. Nature 389, 802± 803. Lazo, G.R., Stein, P.A., Ludwig, R.A., 1991. A DNA transformation competent Arabidopsis genomic library in Agrobacterium. Biotechnology 9, 963±967. Lee, K.Y., Lund, P., Lowe, K., Dunsmuir, P., 1990. Homologous recombination in plant cells after Agrobacterium-mediated transformation. Plant Cell 2, 415±425. Mansour, S.L., Thomas, K.R., Capecchi, M.R., 1988. Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general

255

strategy for targeting mutations to non-selectable genes. Nature 336, 348±352. Marton, L., Browse, J., 1991. Facile transformation of Arabidopsis. Plant Cell Rep. 10, 235±239. Mengiste, T., Paszkowski, J., 1999. Prospects for the precise engineering of plant genomes by homologous recombination. Biol. Chem. 380, 749± 758. Miao, Z.H., Lam, E., 1995. Targeted disruption of the TGA3 locus in Arabidopsis thaliana. Plant J. 7, 359±365. Offringa, R., Duk, M.E.I., Groot, M.J.A., Elzen, P.J.M., Hooykaas, P.J.J., 1990. Extrachromosomal homologous recombination and gene targeting in plant cells after Agrobacterium mediated transformation. EMBO J. 9, 3077±3084. Offringa, R., Groot, M.J.A., Haagsman, H.J., Does, M.P., Elzen, P.J.M., Hooykaas, P.J.J., 1993. Nonreciprocal homologous recombination between Agrobacterium transferred DNA and a plant chromosomal locus. Proc. Natl. Acad. Sci. USA 90, 7346±7350. Paques, F., Haber, J.E., 1997. Two pathways for removal of nonhomologous DNA ends during double-strand break repair in Saccaromyces cerevisiae. Mol. Cell Biol. 17, 6765±6771. Paszkowski, J., Bauer, M., Bogucki, A., Potrykus, I., 1988. Gene targeting in plants. EMBO J. 7, 4021±4026. Perera, R.J., Linard, C.G., Signer, E.R., 1993. Cytosine deaminonase as a negative selective marker for Arabidopsis. Plant Mol. Biol. 23, 793± 799. Perez, P., Tiraby, G., Kallerhoff, J., Perret, J., 1989. Phleomycin resistance as a dominant selectable marker for plant cell transformation. Plant Mol. Biol. 23, 365±373. Puchta, H., 1999. Double-strand break-induced recombination between ectopic homologous sequences in somatic plant cells. Genetics 152, 1173±1181. Richardson, C., Moynahan, M.E., Jasin, M., 1998. Double-strand break repair by interchromosomal recombination: suppression of chromosomal translocations. Genes Dev. 12, 3831±3842. Risseeuw, E., Offringa, R., Franke-van Dijk, M.E.I., Hooykaas, P.J.J., 1995. Targeted recombination in plants using Agrobacterium coincides with additional reaarangements at the target locus. Plant J. 7, 109±119. Risseeuw, E., Franke-van Dijk, M.E.I., Hooykaas, P.J.J., 1997. Gene targeting and instability of Agrobacterium T-DNA loci in the plant genome. Plant J. 11, 717±726. Stougaard, J., 1993. Substrate-dependent negative selection in plants using a bacterial cytosine deaminase gene. Plant J. 3, 755±761. Thykjar, T., Finnemann, J., Schauser, L., Christensen, L., Poulsen, C., Stougaard, J., 1997. Gene targeting approaches using positive±negative selection and large ¯anking regions. Plant Mol. Biol. 35, 523±530. Voelkel-Meiman, K., Roeder, G.S., 1990. A chromosome containing HOT1 preferentially receives information during interchromosomal gene conversion. Genetics 124, 561±572.