- Email: [email protected]
Possibility of insulin-producing cells derived from mouse embryonic stem cells for diabetes treatment
JOURNAL OF BIOSCIENCE AND BIOENGINEERING Vol. 103, No. 2, 140–146. 2007 DOI: 10.1263/jbb.103.140
© 2007, The Society for Biotechnology, Japan
Possibility of Insulin-Producing Cells Derived from Mouse Embryonic Stem Cells for Diabetes Treatment Takahisa Ibii,1 Hideaki Shimada,1 Suguru Miura,1 Eisai Fukuma,1 Hideki Sato,1 and Hiroo Iwata1* Institute for Frontier Medical Sciences, Kyoto University, 53 Kawara-Cho, Shogoin, Sakyo-Ku, Kyoto 606-8507, Japan1 Received 5 September 2006/Accepted 14 November 2006
Insulin injection therapy is the principal current treatment of type 1 diabetes. Patients, however, suffer from various complications generated by insufficient control of blood glucose levels over a long period. Therefore, a method which can infuse insulin in response to changes of blood glucose levels is eagerly desired. Transplantation of insulin releasing cells derived from embryonic stem (ES) cells has been expected to be one of promising approaches to realize this requirement. In this study, ES cell progeny which were derived in culture media with/without fetal calf serum contained two distinct kinds of cells immunostained by anti-insulin and anti-C-peptide antibodies. The cytoplasm and nuclei of one type of cell were immunoreactive against antibodies for insulin, while the other kind of cell only had the cytoplasm stained by the anti-insulin antibody. The first cell type was the major population of insulin-positive cells in serum-free medium, while the latter kind of cells was the major population in medium containing serum. Interestingly, the latter insulin-positive cells could be also immunostained by anti-C-peptide antibodies, and was observed even after nine subcultures in medium containing serum. Although there still remain many issues to be addressed in order to definitely demonstrate that insulin-positive cells derived from ES cells to be truly β cells in the islets, these properties of the obtained cells are believed to promising cells for treatment of type 1 diabetes. [Key words: diabetes, islet transplantation, embryonic stem (ES) cells, differentiation, insulin-producing cells]
mising cell source for cell transplantation therapy for type I diabetes (4–14). Lumelsky et al. (9) reported that more than 20% of cells in ES cell progeny were induced to become insulin-positive cells through the selection of nestin-positive cells. Other groups have modified their original procedure to increase the efficiency of the differentiation of ES cells to insulin-releasing cells (5, 6). However, other researchers reported that Lumelsky’s derived progeny of ES cells were not insulin-producing cells, but simply stained by insulin uptake from the culture medium (15). There still remain many issues to be addressed. In addition, a sufficient number of insulin-producing cells should be available at any time when a type I diabetic patient is treated for cell transplantation therapy. A simple procedure by which insulin-producing cells should be derived from ES cells in a short time is required, and furthermore, a large number of these cells should be obtained by the expansion of the insulin-producing cells or their progenitor cells by subculture. In this study, ES cell progeny derived was carefully examined to distinguish de novo insulin-producing cells from cells stained by insulin uptake from the culture medium. Subcultures of the ES cell progeny was attempted to increase a number of cells with cytoplasm stained by anti-insulin antibodies. As mentioned above, these are important properties to realize a cell transplantation therapy for diabetic patients.
Type 1 diabetes is caused by the auto immune destruction of β cells in the islets of Langerhans (islets). Although insulin injection therapy is the principal current treatment, patients suffer from various complications generated by insufficient control of blood glucose levels over a long period. Therefore, a method which can infuse insulin in response to changes of blood glucose levels is eagerly desired (1, 2). Transplantation of islets has been expected to be one of promising approaches to realize this requirement. It can offer a means of controlling blood glucose levels physiologically. A major breakthrough in clinical islet transplantation has been accomplished in recent years by the Edmonton group (3). More than 80% of the recipients demonstrated normoglycemia without insulin treatment, one year after islet transplantation. However, the shortage of human islets limits its clinical application. Because embryonic stem (ES) cells have been shown to differentiate in vitro into multiple cell lineages including insulin-producing cells, they have been examined as a pro* Corresponding author. e-mail: [email protected] phone: +81-(0)75-751-4119 fax: +81-(0)75-751-4646 Abbreviations: EB, embryoid body; ES, embryonic stem; Glut2, glucose transporter-2; LIF, leukemia inhibitory factor; Pdx1, pancreatic duodenal homeobox 1; RT-PCR, reverse transcription-polymerase chain reaction. 140
VOL. 103, 2007
INSULIN-PRODUCING CELLS DERIVED FROM MOUSE ES CELLS
MATERIALS AND METHODS Culture of mouse ES cells Mouse ES cells (EB5) carrying the blasticidin S-resistant selection marker gene driven by the Oct-3/4 promoter, which were derived from E14tg2a ES cells, were kindly donated by Dr. Niwa (RIKEN Center for Developmental Biology, Kobe). Differentiation of ES cells was carried out by two different methods. In method 1, we followed the 5-stage procedure originally developed by Lumelsky et al. (9) with slight modification. Briefly, stage 1, ES cells were grown on a gelatin-coated dish without feeder cells in Glasgow Minimum Essential Medium (GMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 10% knockout serum replacement (Invitrogen), 2000 units/ml leukemia inhibitory factor (LIF; Chemicon International, Temecula, CA, USA), and 10 µg/ml blasticidin S, and 1% fetal calf serum (FCS; Vitromex, Vilshofen, Germany); stage 2, ES cells were collected and cultured in hanging drops (500 cells/drop) for the preparation of embryoid bodies (EBs); stage 3 in Lumelsky procedure (Lumelsky procedure is abbreviated as L, stage 3L), after 2 d in a hanging drop culture (4 d in the original Lumelsky procedure), the resulting EBs were plated onto gelatin-coated culture dishes. To select nestin-positive cells, the EBs were maintained on culture dishes in serum-free medium supplemented with insulin, transferrin, selenium, and fibronectin; stage 4 in Lumelsky procedure (stage 4L), after 6 d in culture, these cells were dissociated by trypsinization and plated onto culture dishes precoated with poly(L-ornithine) (Sigma, St. Louis, MO, USA) and laminin (BD Biosciences, San Jose, CA, USA), and then subcultured for 4–6 d in the presence of 10 ng/ml basic fibroblast growth factor (R&D Systems, Minneapolis, MN, USA) in serum-free medium containing N2 and B27 supplements (Invitrogen); stage 5 in Lumelsky procedure (stage 5L): After withdrawal of the basic fibroblast growth factor, the cell culture was continued in serum-free medium containing N2 supplemented with B27 and 10 mM nicotinamide to cease cell proliferation and promote differentiation for 6 d. In method 2, ES cells were maintained and cultured under the same conditions as mentioned above during stages 1 and 2. Stage 3S (use of a culture medium supplemented with FCS is abbreviated as S), the EBs were plated onto gelatin-coated culture dishes for 7 d in DMEM/F12 (Invitrogen) supplemented with 10% FCS (Biowest, Nuailles, France). Stage 4S, cells were dissociated and replated onto gelatinized dishes and cultured for at least 6 d in DMEM/F12 supplemented with 15% FCS and 10 mM nicothinamide. For subculturing of the ES cell progenies, cells collected from one culture dish were divided into five dishes every 3–6 d and maintained in the same culture medium as that used in the last stage of the differentiation procedure. Immunocytochemistry, bromodeoxyuridine (BrdU) staining and TUNEL assay Cells were washed three times with phosphate buffered saline (PBS), fixed with 4% paraformaldehyde (PFA) for 30 min at 4°C, and then permeabilized with methanol for 20 min at −20°C. After being blocked with 2% skimmed milk in PBS for 1 h at room temperature, cells were incubated over night at 4°C with the following primary antibodies: guinea pig anti-insulin antibody (1:100–1:200; DakoCytomation, Kyoto), guinea pig antirat C-peptide antibody (1 : 200; Linco Research, St. Louis, MO, USA) and rabbit anti-glucagon antibody (1:100; DakoCytomation). The samples were washed three times with 0.05% polyoxyethylene sorbitan monolaurate (Tween 20; Wako Pure Chemical Industries, Osaka) in PBS, and then incubated with the appropriate secondary antibodies carrying fluorescent dye for 2 h at room temperature. Secondary antibodies were Alexa Fluor 488 goat anti-guinea pig IgG and Alexa Fluor 594 goat anti-rabbit IgG (Molecular Probes, Eugene, OR, USA). Finally, cells were washed three times with 0.05% Tween 20, incubated in Slowfade Equilibration Buffer
141
(Molecular Probes) and then covered with Slowfade (Molecular Probes) in order to prevent loss of fluorescence. For BrdU staining, ES cell progeny were incubated in a BrdU labeling solution over night, which was prepared by diluting the original reagent (Zymed Laboratories, San Francisco, CA, USA) to 1: 100 with medium. Then, cells were washed three times with PBS, fixed with 4% PFA, followed by the denaturation of DNA with 1 M HCl (Nacalai Tesque, Kyoto) for 30 min at 37°C. Finally, immunocytochemical staining against BrdU incorporated in the DNA was performed according to the manufacturer’s instructions. The TUNEL assay was done using the Fluorescent Apoptosis Detection Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Briefly, differentiated cells were fixed with 4% PFA and permeabilized with 0.2% TritonX-100. They were washed with PBS three times and incubated with the equilibration buffer for 10 min. They were then treated with terminal deoxynucleotidyl transferase for 2 h. The reaction was stopped using 2 × SSC (30 mM sodium citrate, 300 mM NaCl) and then washed three times with PBS. The cells were examined using a fluorescence microscope IX71 (Olympus, Tokyo) and Confocal Laser Scanning microscope (Olympus). The number of insulin positive cells was counted on whole area of cell culture dishes (φ: 35 mm) and the average number of three different culture dishes was represented. Reverse transcription-polymerase chain reaction (RT-PCR) analysis RT-PCR analyses were carried out to examine gene expression in ES cell progenies at each stage. After washing the cells, the total RNA was isolated using the SV Total RNA Isolation Kit (Promega) following the manufacturer’s instructions. Total RNA was processed for cDNA preparation using a Ready-To-Go T-primed First-Strand Kit (Amersham Biosciences, Piscataway, NJ, USA). DNA amplification was performed by PCR using Ex Taq polymerase (Takara Bio, Shiga). The following genes were examined: insulin 1, insulin 2, glucagon, somatostatin, amylase, glucose transporter-2 (Glut2), pancreatic duodenal homeobox 1 (Pdx1), Ngn3, nestin, Oct-3/4 and GAPDH. All primer sets except for insulin 1 for nested PCR, Pdx1, and nestin were prepared according to the primer sequences designed by Moritoh et al. (11). The primer sequences and PCR conditions used for RT-PCR are shown Table 1. The PCR products were analyzed using 2% agarose gel electrophoresis and stained with ethidium bromide. The PCR products were also confirmed by sequence analyses. C-peptide content determination Intracellular C-peptide contents at stage 1, stage 5L and stage 4S were determined by Mouse C-peptide ELISA Kit (Shibayagi, Gunma) according to the manufacturer’s instructions. Briefly, the cells were washed five times with PBS and then treated with 0.05% trypsin for 5 min at room temperature. After the action of trypsin was inhibited by the addition of 0.25% trypsin inhibitor derived from soy-bean (Nacalai Tesque), cells were collected from the culture dish and washed three times with PBS. The cells were suspended and dispersed in 50 mM HCl/70% ethanol. After centrifugation at 8000 rpm for 5 min, the supernatant was collected from the cell lysate and neutralized by the addition of 50 mM NaOH. C-peptide concentrations in the supernatants were determined using the ELISA Kit. To compare intracellular C-peptide contents between cells at different stages, C-peptide content was expressed by dividing the C-peptide amount by the amount of total protein in the cells at each stage, as determined by the Bradford assay.
RESULTS Generation of insulin producing cells from ES cells In this study, two procedures were examined to differentiate ES cells to insulin-producing cells. In the first method, we
142
J. BIOSCI. BIOENG.,
IBII ET AL.
TABLE 1. Gene-specific primers and PCR conditions Gene
Forward primer
Reverse primer
Insulin 1 Insulin 1 (2nd PCR) Insulin 2 Glucagon Somatostatin Amylase Pdx1 Ngn3 Glut2 Nestin Oct-3/4 GAPDH
ccagctataatcagagacca tcagcaagcaggtcattgt tccgctacaatcaaaaaccat actcacagggcacattcacc tcgctgctgcctgaggacct caggcaatcctgcaggaacaa ggccacacagctctacaagg tggcactcagcaaacagcga cggtgggacttgtgctgctgg ggagagtcgcttagaggtgc accttccccatggc accacagtccatgccatcac
gtgtagaagaagccacgct cccacacaccaggtagaga gctgggtagtggtgggtcta ccagttgatgaagtccctgg gccaagaagtacttggccagttc cacttgcggataactgtgcca ttccacttcatgcgacggtt acccagagccagacaggtct ctctgaagacgccaggaattccat tcaggaaagccaagagaagc acttgatcttttgcccttctg tccaccaccctgttgctgta
followed the 5-stage method reported by Lumelsky et al. (9). ES cells differentiated through transit nestin-positive cells to insulin-producing cells in a serum-free culture medium. After whole procedures were done, more than 20% of the cells were stained with an antibody against insulin, as reported. Morphologies and immunostaining characteristics of the insulin-positive cells were carefully examined. We found two distinct populations of insulin-positive cells (Fig. 1A, C). Insulin-positive cells of the major population mainly existed in cell clusters with multi-cell layers, while insulin-positive cells of a minor population were found in a single-cell layer as a cluster. There are distinctive differences in various aspects between these two insulin-positive cell populations. In the former population, both the cytoplasm and nuclei of the cells were immunoreactive against anti-insulin antibody and also anti-glucagon antibody, as shown in Fig. 1A, and the cells were also insulin/TUNEL double positive cells (about 10 µm in diameter) (Fig. 1B). As Rajagopal et al. (15) reported, those cells were not expected to be insulin-producing cells, but apoptotic or necrotic cells which were simply stained by capturing exogenous insulin from the culture medium. For the second type of insulin-positive cells, the larger cells (about 20 µm in diameter) were immunoreactive against anti-insulin antibody, but not against anti-glucagon antibody (Fig. 1C). The other noteworthy points are that their cytoplasm were stained with anti-insulin antibody, but their nuclei were free from staining (Fig. 1C), as well as being TUNEL-negative (Fig. 1D). The proportion of the larger insulin-positive cells was less than 0.1%. We expect that the latter larger insulin-positive cells are de novo insulin-producing cells. In the second method, ES cells were cultured in a medium supplemented with FCS. After the differentiation procedure (stage 4S), insulin-positive cells were found. Although differentiation efficiency was not so high (about 0.3%), most of the insulin-positive cells looked like the larger cells found in the Lumelsky’s method. Their cytoplasm was stained with anti-insulin antibody, but their nuclei were free from staining and the cells were free from TUNEL staining (Fig. 1F, G). The other interesting point is that smaller insulin/TUNEL double positive cells, which are the major population in the Lumelsky’s method, were hardly detected in the ES cell progeny derived in the culture medium supplemented with FCS.
Size of product (bp) 197 157 411 353 232 484 582 444 416 327 855 452
No. of PCR cycles 35 35 35 35 35 35 35 35 35 30 30 30
Annealing temperature (°C) 55 55 64 62 55 64 55 60 64 55 55 55
Reference no. 11 – 11 11 11 11 13 11 11 – 11 –
C-peptide, which is produced during de novo biosynthesis of insulin, is an important indicator for the derivation of insulin-producing cells from ES cells. Thus, existence of C-peptide in the differentiated cells should be confirmed to claim that insulin-positive ES cell progeny contain insulinproducing cells. Therefore, immunostaining for C-peptide was carried out for ES cell progeny (Fig. 1E, H). C-peptidepositive cells looked like larger insulin-positive cells in both differentiation procedures. Intracellular C-peptide content of differentiated ES cells was also determined by ELISA (included as in insert in Fig. 1). Intracellular C-peptide content are 1153 ± 175.3 pg/mg protein and 1285 ± 302.1 pg/mg protein for stage 5L cells of the Lumelsky’s method and stage 4S cells in the FCS culture medium, respectively. Although a large number of smaller insulin-positive cells were observed in stage 5L as shown in Fig. 1A, we could not find smaller C-peptide-positive cells. There was no difference in C-peptide contents between ES cell progenies for these two methods. These results also support the idea that the larger insulin-positive cells which were found as a cluster in a single cell layer are insulin-producing cells. RT-PCR analyses were performed for cells at each different stage and the results are shown in Fig. 2. No clear difference was found in gene expression in ES cell progenies at stage 5L cells of the Lumelsky’s method and stage 4S cells in the FCS culture medium. There are two non-allelic forms of insulin, insulin 1 and 2 in rodents (16). Insulin 2 gene expression was easily detected by RT-PCR analyses. Insulin 1 gene expression was difficult to detect, but could be observed by the nested PCR analysis. Other endocrine genes, such as glucagon and somatostatin genes, and the exocrine gene, amylase, were also detected. These results suggest that ES cells differentiated into the pancreatic cell lineage, that is, not only into endocrine, but also into exocrine cells, in both procedures. Various transcription factors which are activated in the development of the pancreas were identified (17–19) in embryoid body (EB) cells (stage 2). Gene expression of Pdx1, which is reported to play crucial roles in the early development of the pancreas (20–22), was detected in EB cells and in cells at stage 4S. Expression of the Ngn3 gene was observed at all stages in the both methods. Gene expression of Glut2, which plays an important role in the glucose stimulated insulin secretion, was detected at stage 2 but faded at stage 4S and stage 5L. A neuronal stem/
VOL. 103, 2007
INSULIN-PRODUCING CELLS DERIVED FROM MOUSE ES CELLS
143
FIG. 1. Immunocytochemical analyses of stage 5L cells induced in the serum-free culture medium by Lumelsky’s method (A–E) and stage 4S cells in DMEM/F12 supplemented with 15% FCS (F–H) and their C-peptide contents (insert). S1, S5L and S4S represent stage 1, stage 5L and stage 4S, respectively. Data are shown as mean ±SD.
progenitor cell marker, nestin, which has been believed to be expressed in precursors for pancreatic endocrine cells (23), was detected by RT-PCR as early as stage 2. Oct-3/4 gene expression, which is required for the maintenance of the undifferentiated state, was clearly observed at stage 1 and stage 2 and disappeared at stage 4S and became weak at stage 5L. These immunostaining and RT-PCR analyses indicate that insulin-producing cells are derived by both procedures, and that these cells are larger in size and their cytoplasm is immunostained by anti-insulin and anti-C-peptide antibodies. Other ES cell strains, such as CCE cells (Stem Cell Technologies, British Columbia, Canada), were also examined in this study and demonstrated similar behavior of the EB5 cells (data not included). Cell proliferation In the clinical setting, the procedure by which insulin-producing cells are derived needs to as simple as possible, and a sufficient number of cells need
to be available at any given time for a patient. Therefore, the possibility of cell number expansion was examined. The cell proliferation activity of ES cell progeny was studied using the BrdU incorporation method. As shown in Fig. 3A, many cells, not only the insulin-positive cells but also insulin-negative cells, incorporated BrdU. The insulin-negative cells not incorporated BrdU also existed in the same dish. After differentiation, insulin-producing cells still maintained proliferation activity. Cells which were obtained at stage 5L of the Lumelsky’s method and at stage 4S in FCS containing culture medium were able to be subcultured several times. Cells which were collected from one culture dish were divided into five dishes and then cultured in the same media used in stage 5L or stage 4S. ES cell progeny contained cells which were able to form insulin-positive cell clusters after subculture, as shown in Fig. 3B and 3C. Cells obtained in stage 4S could be subcultured many times and maintained for long term in a medium supplemented with
144
J. BIOSCI. BIOENG.,
IBII ET AL.
clearly detected after 3 times subcultures. On the other hand, the expression level of the pancreatic exocrine gene, amylase, decreased with during the subcultures. These results indicate that insulin-producing cells seemed to mature during repeated subcultures. DISCUSSION
FIG. 2. RT-PCR analysis of gene expression of EB5 cells at different stages. Lane 1, Stage 1 (undifferentiated ES cells); lane 2, stage 2 (embryoid body formed in the absence of LIF); lane 3, stage 5L cells (ES cell progeny induced in the serum free culture medium by Lumelsky’s method); lane 4, stage 4S cells (ES cell progeny induced in DMEM/F12 supplemented with 15% FCS).
FCS. Even after nine times of subculturing, insulin-positive cell clusters were still observed, as shown in Fig. 3D. On the other hand, for cells obtained by Lumelsky’s method, small insulin-positive cells found in stage 5L appeared during the subculture, and ES cell progeny produced clusters of lager insulin-positive cells after subculture, as shown in Fig. 3E, but gradually deteriorated and lost their proliferation potential in the serum-free medium after several subcultures. The number of larger insulin-positive cells (about 20 µm in diameter) found in a culture dish was followed with subculture times and presented in Fig. 4. The number of insulin-positive cells at each stage by Lumelsky’s method (method 1) were as follows: stage 5L, 102 ± 49 cells/cm2; P1L, 102± 59 cells/cm2; P2L, 109±65 cells/cm2; P3L, 46 ±12 cells/cm2; P4L, not detected (most of cells died), whereas in the method 2, stage 4S, 238 ± 100 cells/cm2; P1S, 313 ± 135 cells/cm2; P2S, 146 ± 41 cells/cm2; P3S, 180 ± 73 cells/cm2; and P4S, 146 ± 51 cells/cm2. These results indicate that insulin-positive cells proliferated during the subculture. Taking into account the results that BrdU-incorporated insulin-positive cells appeared in differentiated cells, we reached an opinion that insulin-positive cells or their progenitor cells can proliferate and expand their number by subculturing many times. RT-PCR analyses were completed for gene expression of subcultured cells obtained in the medium of stage 4S (Fig. 3F). Expression levels of the insulin 2 gene increased with the number of subcultures. Moreover, Glut2 gene expression, which was rarely detected before subculture, was
In this study, two distinct populations of insulin-positive cells were found in ES cell progeny. Cells in one population, which were smaller and carried small, condensed, and TUNEL-positive nuclei, appeared to be similar to those derived by Lumelsky et al. (9), and noted by Rajagopal et al. (15). These are dead cells stained with exogenous insulin from the culture medium. The other population is a group of larger cells whose cytoplasm was immunostained with antibodies to insulin and C-peptide, but contained nuclei free from these stainings and were TUNEL-negative. In Lumelsky’s nestin-positive cell selection method using a serumfree medium (method 1), although the latter insulin-positive cells larger in size were found, the majority of the insulinpositive cells were the former insulin-stained small cells. On the other hand, in method 2 using a medium containing FCS, the latter type of insulin-positive cells was the majority, and TUNEL-positive apoptotic/necrotic cells co-stained with insulin were rarely detected. Lumelsky’s method includes the stage to select nestin-positive cells. It was thought that a large number of non-neural cells were forced to apoptosis/necrosis during this selection, and that these cells took insulin from the serum-free medium containing insulin. Contrary to the results found in method 1, few dead cells were found in method 2, because the cell selection stage was not included. C-peptide, which is produced during de novo biosynthesis of insulin, is an important indicator to confirm derivation of insulin-producing cells from ES cells. Unfortunately, we could not carry out double staining for both insulin and C-peptide in the same cultures, because both antibodies against insulin and C-peptide were developed in guinea pigs. In our cultures, C-peptide-positive cells were clearly detected by the immunocytochemical method and their shape looked like those of larger insulin-positive cells as shown in Fig. 1. Only the cytoplasm of both cells, but not the nuclei, was insulin and C-peptide-positive, respectively. Intracellular C-peptide content increased as the differentiation stage advanced and the amounts of intracellular C-peptide content was not significantly different between the two methods. Although we could not demonstrate that the larger insulinpositive cells were co-positive for C-peptide by double staining, all of these facts suggest that C-peptide-positive cells seemed to be of the same population as insulin-positive cells shown in Fig. 1C and 1F. Recently, Sipione reported that insulin-producing cells derived from ES cells by a modified method of Lumelsky were not β cells, but neuronal insulin-expressing cells (24). Furthermore, Roche et al. reported that insulin-producing cells derived from ES cells in their study might be mainly ectoderm in origin (25). Rodents have two non-allelic forms of insulin, that is, insulin 1 and 2 (16). Insulin 1 gene expression is restricted to the pancreatic β cells, whereas insu-
VOL. 103, 2007
INSULIN-PRODUCING CELLS DERIVED FROM MOUSE ES CELLS
145
FIG. 3. Immunocytochemical examination and RT-PCR analysis of ES cell progeny before and after several subcultures. (A) Insulin-positive and BrdU labeled cells found in stage 4S; (B–D) insulin-positive cells found after 1, 3 and 9 times subculturing of stage 4S cells, respectively; (E) insulin-positive cells obtained after 3 times subculturing of stage 5L cells; (F) RT-PCR analysis of ES cell progeny before and after several subcultures. Lane 1, Stage 4S cells before subcultured; lane 2, insulin-positive cells obtained after three subcultures of stage 4S cells.
FIG. 4. Number of insulin-positive cells found after subculturing of cells of stage 5L and stage 4S. Number of insulin-positive cells is expressed by cell number ± SD per 1 cm2. White bars, Insulin-positive cells obtained by subculturing of cells from stage 5L; black bars, insulin-positive cells obtained by subculturing the cells from stage 4S.
lin 2 is more broadly expressed in the developing brain and yolk sac as well as in the pancreatic β cells (16, 26). In our studies, insulin 1 gene expression was weak, but could be
seen by the nested PCR. Other pancreatic endocrine genes, insulin 2, glucagon, somatostatin, and an exocrine gene, amylase, were clearly detected by gene expression analyses by RT-PCR. These facts indicate that at least a portion of the insulin-producing cells derived in this study has a phenotype of pancreatic β cells. It is desired that the number of insulin-producing cells or their progenitor cells can be increased by subculturing for the cell therapy of diabetic patients. Although about 1100 insulin-positive cells were derived in a culture dish (φ: 35 mm) by the method 1, we could not subculture the insulin-positive cells more than four times. A culture medium used in the method 1 was serum free. It would not be suitable for maintenance of the insulin-positive or insulin-negative cells for a long period. On the other hand, about 1500–3000 insulin-positive cells were derived in a dish by the method 2. Cells collected from the dish were divided into five dishes in each subculture step. Insulin-positive cells were still observed even after nine times of subculturing, as shown in Fig. 3D. Serum components, such as proteins and free fatty acids, might afford a good condition for long term maintenance and growth of insulin precursor cells or immature insulin/BrdU positive cells. Though the proliferation activity was weaken gradually as times of subculture went, after nine times subcultures total cell numbers of insulin-positive
146
J. BIOSCI. BIOENG.,
IBII ET AL.
cells will be up to 2000 ×59 = 4 ×109 cells. For clinical islet transplantation, approximately 600,000 islets are transplanted to a patient of 60 kg in body weight. If one islet contains 2000 β cells, then 1.2 ×109 β cells were transplanted to the patient. Although many problems, such as isolation of the insulin-positive cells, still need to be overcome, in principle, sufficient numbers of insulin-positive cells can be obtained by nine subcultures of ES cell progeny. In this paper, we showed that mouse ES cells can be differentiated to insulin-producing cells and the number of these can be expanded by subculture of the ES cell progeny. There are many issues that still remain before we claim that the insulin-positive cells obtained are promising for cell therapy of a diabetic patient. For example, functions of insulin-positive cells, such as insulin release in response to glucose concentration changes, should be carefully examined. An effective method to isolate progenitor cells for insulin-producing cells should be developed to ensure a cell source for cell therapy for the diabetic patient. We are currently investigating isolation of pancreatic progenitor cells from the ES cell progeny by use of a reporter gene which is expressed specifically for pancreatic progenitor cells. In the future, it will be reported that more detailed examinations of insulin releasing cells from ES cells as cells that can be utilized in development of a method which can release insulin in response to changes of blood glucose levels for therapy in type I diabetes.
9.
10.
11.
12.
13.
14.
15. 16.
17.
ACKNOWLEDGMENTS We thank Dr. J. Miyazaki, Osaka University for valuable advices. We also thank Dr. T. Richey for English correction of the manuscript. This work was supported in part by grants of Leading Project and Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan.
18. 19. 20.
REFERENCES 1. Hanazaki, K., Nosé, Y., and Brunicardi, F. C.: Artificial endocrine pancreas. Am. Coll. Surg., 193, 310–322 (2001). 2. Kost, J.: Ultrasound-assisted insulin delivery and noninvasive glucose sensing. Diabetes Technol. Ther., 4, 489–497 (2002). 3. Shapiro, A. M., Lakey, J. R., Ryan, E. A., Korbutt, G. S., Toth, E., Warnock, G. L., Kneteman, N. M., and Rajotte, R. V.: Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N. Engl. J. Med., 343, 230–238 (2000). 4. Assady, S., Maor, G., Amit, M., Itskovitz-Eldor, J., Skorecki, K. L., and Tzukerman, M.: Insulin production by human embryonic stem cells. Diabetes, 50, 1691–1697 (2001). 5. Blyszczuk, P., Czyz, J., Kania, G., Wagner, M., Roll, U., St-Onge, L., and Wobus, A.: Expression of Pax4 in embrygenitor and insulin-producing cells. Proc. Natl. Acad. Sci. USA, 100, 998–1003 (2003). 6. Hori, Y., Rulifson, I. C., Tsai, B. C., Heit, J. J., Cahoy, J. D., and Kim, S. K.: Growth inhibitors promote differentiation of insulin-producing tissue from embryonic stem cells. Proc. Natl. Acad. Sci. USA, 99, 16105–16110 (2002). 7. Kahan, B. W., Jacobson, L. M., Hullett, D. A., Ochoada, J. M., Oberley, T. D., Lang, K. M., and Odorico, J. S.: Pancreatic precursors and differentiated islet cell types from murine embryonic stem cells: an in vitro model to study islet differentiation. Diabetes, 52, 2016–2024 (2003). 8. Leon-Quinto, T., Jones, J., Skoudy, A., Burcin, M., and
21. 22.
23.
24.
25.
26.
Soria, B.: In vitro directed differentiation of mouse embryonic stem cells into insulin-producing cells. Diabetologia, 47, 1442–1451 (2004). Lumelsky, N., Blondel, O., Laeng, P., Velasco, I., Ravin, R., and McKay, R.: Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science, 292, 1389–1394 (2001). Miyazaki, S., Yamato, E., and Miyazaki, J.: Regulated expression of pdx-1 promotes in vitro differentiation of insulinproducing cells from embryonic stem cells. Diabetes, 53, 1030–1037 (2004). Moritoh, Y., Yamato, E., Yasui, Y., Miyazaki, S., and Miyazaki, J.: Analysis of insulin-producing cells during in vitro differentiation from feeder-free embryonic stem cells. Diabetes, 52, 1163–1168 (2003). Segev, H., Fishman, B., Ziskind, A., Shulman, M., and Itskovitz-Eldor, J.: Differentiation of human embryonic stem cells into insulin-producing clusters. Stem Cells, 22, 265–274 (2004). Shiroi, A., Yoshikawa, M., Yokota, H., Fukui, H., Ishizaka, S., Tatsumi, K., and Takahashi, Y.: Identification of insulinproducing cells derived from embryonic stem cells by zincchelating dithizone. Stem Cells, 20, 284–292 (2002). Soria, B., Roche, E., Berna, G., Leon-Quinto, T., Reig, J. A., and Martin, F.: Insulin-secreting cells derived from embryonic stem cells normalize glycemia in streptozotocininduced diabetic mice. Diabetes, 49, 157–162 (2000). Rajagopal, J., Anderson, W. J., Kume, S., Martinez, O. I., and Melton, D. A.: Insulin staining of ES cell progeny from insulin uptake. Science, 299, 363 (2003). Deltour, L., Leduque, P., Blume, N., Madsen, O., Dubois, P., Jami, J., and Bucchini, D.: Differential expression of the two nonallelic proinsulin genes in the developing mouse embryo. Proc. Natl. Acad. Sci. USA, 90, 527–531 (1993). Edlund, H.: Pancreatic organogenesis—developmental mechanisms and implications for therapy. Nat. Rev. Genet., 3, 524–532 (2002). Servitja, J. M. and Ferrer, J.: Transcriptional network controlling pancreatic development and beta cell function. Diabetologia, 47, 597–613 (2004). Soria, B.: In-vitro differentiation of pancreatic beta-cells. Differentiation, 68, 205–219 (2001). Ahlgren, U., Jonsson, J., Jonsson, L., Simu, K., and Edlund, H.: β-Cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the β-cell phenotype and maturity onset diabetes. Genes Dev., 12, 1763–1768 (1998). Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H.: Insulin-promoter-factor 1 is required for pancreas development in mice. Nature, 371, 606–609 (1994). Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein, R. W., Magnuson, M. A., Hogan, B. L. M., and Wright, C. V. E.: PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development, 122, 983– 995 (1996). Zulewski, H., Abraham, E. J., Gerlach, M. J., Daniel, P. B., Moritz, W., Müller, B., Vallejo, M., Thomas, M. K., and Habener, J. F.: Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes, 50, 521–533 (2001). Sipione, S., Eshpeter, A., Lyon, J. G., Korbutt, G. S., and Bleackley, R. C.: Insulin expressing cells from differentiated embryonic stem cells are not beta cells. Diabetologia, 47, 499–508 (2004). Roche, E., Sepulcre, P., Reig, J. A., Santana, A., and Soria, B.: Ectodermal commitment of insulin-producing cells derived from embryonic stem cells. FASEB J., 19, 1341–1343 (2005). McGrath, K. E. and Palis, J.: Expression of homeobox genes, including an insulin promoting factor, in the murine yolk sac at the time of hematopoietic initiation. Mol. Reprod. Dev., 48, 145–153 (1997).
© 2007, The Society for Biotechnology, Japan
Possibility of Insulin-Producing Cells Derived from Mouse Embryonic Stem Cells for Diabetes Treatment Takahisa Ibii,1 Hideaki Shimada,1 Suguru Miura,1 Eisai Fukuma,1 Hideki Sato,1 and Hiroo Iwata1* Institute for Frontier Medical Sciences, Kyoto University, 53 Kawara-Cho, Shogoin, Sakyo-Ku, Kyoto 606-8507, Japan1 Received 5 September 2006/Accepted 14 November 2006
Insulin injection therapy is the principal current treatment of type 1 diabetes. Patients, however, suffer from various complications generated by insufficient control of blood glucose levels over a long period. Therefore, a method which can infuse insulin in response to changes of blood glucose levels is eagerly desired. Transplantation of insulin releasing cells derived from embryonic stem (ES) cells has been expected to be one of promising approaches to realize this requirement. In this study, ES cell progeny which were derived in culture media with/without fetal calf serum contained two distinct kinds of cells immunostained by anti-insulin and anti-C-peptide antibodies. The cytoplasm and nuclei of one type of cell were immunoreactive against antibodies for insulin, while the other kind of cell only had the cytoplasm stained by the anti-insulin antibody. The first cell type was the major population of insulin-positive cells in serum-free medium, while the latter kind of cells was the major population in medium containing serum. Interestingly, the latter insulin-positive cells could be also immunostained by anti-C-peptide antibodies, and was observed even after nine subcultures in medium containing serum. Although there still remain many issues to be addressed in order to definitely demonstrate that insulin-positive cells derived from ES cells to be truly β cells in the islets, these properties of the obtained cells are believed to promising cells for treatment of type 1 diabetes. [Key words: diabetes, islet transplantation, embryonic stem (ES) cells, differentiation, insulin-producing cells]
mising cell source for cell transplantation therapy for type I diabetes (4–14). Lumelsky et al. (9) reported that more than 20% of cells in ES cell progeny were induced to become insulin-positive cells through the selection of nestin-positive cells. Other groups have modified their original procedure to increase the efficiency of the differentiation of ES cells to insulin-releasing cells (5, 6). However, other researchers reported that Lumelsky’s derived progeny of ES cells were not insulin-producing cells, but simply stained by insulin uptake from the culture medium (15). There still remain many issues to be addressed. In addition, a sufficient number of insulin-producing cells should be available at any time when a type I diabetic patient is treated for cell transplantation therapy. A simple procedure by which insulin-producing cells should be derived from ES cells in a short time is required, and furthermore, a large number of these cells should be obtained by the expansion of the insulin-producing cells or their progenitor cells by subculture. In this study, ES cell progeny derived was carefully examined to distinguish de novo insulin-producing cells from cells stained by insulin uptake from the culture medium. Subcultures of the ES cell progeny was attempted to increase a number of cells with cytoplasm stained by anti-insulin antibodies. As mentioned above, these are important properties to realize a cell transplantation therapy for diabetic patients.
Type 1 diabetes is caused by the auto immune destruction of β cells in the islets of Langerhans (islets). Although insulin injection therapy is the principal current treatment, patients suffer from various complications generated by insufficient control of blood glucose levels over a long period. Therefore, a method which can infuse insulin in response to changes of blood glucose levels is eagerly desired (1, 2). Transplantation of islets has been expected to be one of promising approaches to realize this requirement. It can offer a means of controlling blood glucose levels physiologically. A major breakthrough in clinical islet transplantation has been accomplished in recent years by the Edmonton group (3). More than 80% of the recipients demonstrated normoglycemia without insulin treatment, one year after islet transplantation. However, the shortage of human islets limits its clinical application. Because embryonic stem (ES) cells have been shown to differentiate in vitro into multiple cell lineages including insulin-producing cells, they have been examined as a pro* Corresponding author. e-mail: [email protected] phone: +81-(0)75-751-4119 fax: +81-(0)75-751-4646 Abbreviations: EB, embryoid body; ES, embryonic stem; Glut2, glucose transporter-2; LIF, leukemia inhibitory factor; Pdx1, pancreatic duodenal homeobox 1; RT-PCR, reverse transcription-polymerase chain reaction. 140
VOL. 103, 2007
INSULIN-PRODUCING CELLS DERIVED FROM MOUSE ES CELLS
MATERIALS AND METHODS Culture of mouse ES cells Mouse ES cells (EB5) carrying the blasticidin S-resistant selection marker gene driven by the Oct-3/4 promoter, which were derived from E14tg2a ES cells, were kindly donated by Dr. Niwa (RIKEN Center for Developmental Biology, Kobe). Differentiation of ES cells was carried out by two different methods. In method 1, we followed the 5-stage procedure originally developed by Lumelsky et al. (9) with slight modification. Briefly, stage 1, ES cells were grown on a gelatin-coated dish without feeder cells in Glasgow Minimum Essential Medium (GMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 10% knockout serum replacement (Invitrogen), 2000 units/ml leukemia inhibitory factor (LIF; Chemicon International, Temecula, CA, USA), and 10 µg/ml blasticidin S, and 1% fetal calf serum (FCS; Vitromex, Vilshofen, Germany); stage 2, ES cells were collected and cultured in hanging drops (500 cells/drop) for the preparation of embryoid bodies (EBs); stage 3 in Lumelsky procedure (Lumelsky procedure is abbreviated as L, stage 3L), after 2 d in a hanging drop culture (4 d in the original Lumelsky procedure), the resulting EBs were plated onto gelatin-coated culture dishes. To select nestin-positive cells, the EBs were maintained on culture dishes in serum-free medium supplemented with insulin, transferrin, selenium, and fibronectin; stage 4 in Lumelsky procedure (stage 4L), after 6 d in culture, these cells were dissociated by trypsinization and plated onto culture dishes precoated with poly(L-ornithine) (Sigma, St. Louis, MO, USA) and laminin (BD Biosciences, San Jose, CA, USA), and then subcultured for 4–6 d in the presence of 10 ng/ml basic fibroblast growth factor (R&D Systems, Minneapolis, MN, USA) in serum-free medium containing N2 and B27 supplements (Invitrogen); stage 5 in Lumelsky procedure (stage 5L): After withdrawal of the basic fibroblast growth factor, the cell culture was continued in serum-free medium containing N2 supplemented with B27 and 10 mM nicotinamide to cease cell proliferation and promote differentiation for 6 d. In method 2, ES cells were maintained and cultured under the same conditions as mentioned above during stages 1 and 2. Stage 3S (use of a culture medium supplemented with FCS is abbreviated as S), the EBs were plated onto gelatin-coated culture dishes for 7 d in DMEM/F12 (Invitrogen) supplemented with 10% FCS (Biowest, Nuailles, France). Stage 4S, cells were dissociated and replated onto gelatinized dishes and cultured for at least 6 d in DMEM/F12 supplemented with 15% FCS and 10 mM nicothinamide. For subculturing of the ES cell progenies, cells collected from one culture dish were divided into five dishes every 3–6 d and maintained in the same culture medium as that used in the last stage of the differentiation procedure. Immunocytochemistry, bromodeoxyuridine (BrdU) staining and TUNEL assay Cells were washed three times with phosphate buffered saline (PBS), fixed with 4% paraformaldehyde (PFA) for 30 min at 4°C, and then permeabilized with methanol for 20 min at −20°C. After being blocked with 2% skimmed milk in PBS for 1 h at room temperature, cells were incubated over night at 4°C with the following primary antibodies: guinea pig anti-insulin antibody (1:100–1:200; DakoCytomation, Kyoto), guinea pig antirat C-peptide antibody (1 : 200; Linco Research, St. Louis, MO, USA) and rabbit anti-glucagon antibody (1:100; DakoCytomation). The samples were washed three times with 0.05% polyoxyethylene sorbitan monolaurate (Tween 20; Wako Pure Chemical Industries, Osaka) in PBS, and then incubated with the appropriate secondary antibodies carrying fluorescent dye for 2 h at room temperature. Secondary antibodies were Alexa Fluor 488 goat anti-guinea pig IgG and Alexa Fluor 594 goat anti-rabbit IgG (Molecular Probes, Eugene, OR, USA). Finally, cells were washed three times with 0.05% Tween 20, incubated in Slowfade Equilibration Buffer
141
(Molecular Probes) and then covered with Slowfade (Molecular Probes) in order to prevent loss of fluorescence. For BrdU staining, ES cell progeny were incubated in a BrdU labeling solution over night, which was prepared by diluting the original reagent (Zymed Laboratories, San Francisco, CA, USA) to 1: 100 with medium. Then, cells were washed three times with PBS, fixed with 4% PFA, followed by the denaturation of DNA with 1 M HCl (Nacalai Tesque, Kyoto) for 30 min at 37°C. Finally, immunocytochemical staining against BrdU incorporated in the DNA was performed according to the manufacturer’s instructions. The TUNEL assay was done using the Fluorescent Apoptosis Detection Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Briefly, differentiated cells were fixed with 4% PFA and permeabilized with 0.2% TritonX-100. They were washed with PBS three times and incubated with the equilibration buffer for 10 min. They were then treated with terminal deoxynucleotidyl transferase for 2 h. The reaction was stopped using 2 × SSC (30 mM sodium citrate, 300 mM NaCl) and then washed three times with PBS. The cells were examined using a fluorescence microscope IX71 (Olympus, Tokyo) and Confocal Laser Scanning microscope (Olympus). The number of insulin positive cells was counted on whole area of cell culture dishes (φ: 35 mm) and the average number of three different culture dishes was represented. Reverse transcription-polymerase chain reaction (RT-PCR) analysis RT-PCR analyses were carried out to examine gene expression in ES cell progenies at each stage. After washing the cells, the total RNA was isolated using the SV Total RNA Isolation Kit (Promega) following the manufacturer’s instructions. Total RNA was processed for cDNA preparation using a Ready-To-Go T-primed First-Strand Kit (Amersham Biosciences, Piscataway, NJ, USA). DNA amplification was performed by PCR using Ex Taq polymerase (Takara Bio, Shiga). The following genes were examined: insulin 1, insulin 2, glucagon, somatostatin, amylase, glucose transporter-2 (Glut2), pancreatic duodenal homeobox 1 (Pdx1), Ngn3, nestin, Oct-3/4 and GAPDH. All primer sets except for insulin 1 for nested PCR, Pdx1, and nestin were prepared according to the primer sequences designed by Moritoh et al. (11). The primer sequences and PCR conditions used for RT-PCR are shown Table 1. The PCR products were analyzed using 2% agarose gel electrophoresis and stained with ethidium bromide. The PCR products were also confirmed by sequence analyses. C-peptide content determination Intracellular C-peptide contents at stage 1, stage 5L and stage 4S were determined by Mouse C-peptide ELISA Kit (Shibayagi, Gunma) according to the manufacturer’s instructions. Briefly, the cells were washed five times with PBS and then treated with 0.05% trypsin for 5 min at room temperature. After the action of trypsin was inhibited by the addition of 0.25% trypsin inhibitor derived from soy-bean (Nacalai Tesque), cells were collected from the culture dish and washed three times with PBS. The cells were suspended and dispersed in 50 mM HCl/70% ethanol. After centrifugation at 8000 rpm for 5 min, the supernatant was collected from the cell lysate and neutralized by the addition of 50 mM NaOH. C-peptide concentrations in the supernatants were determined using the ELISA Kit. To compare intracellular C-peptide contents between cells at different stages, C-peptide content was expressed by dividing the C-peptide amount by the amount of total protein in the cells at each stage, as determined by the Bradford assay.
RESULTS Generation of insulin producing cells from ES cells In this study, two procedures were examined to differentiate ES cells to insulin-producing cells. In the first method, we
142
J. BIOSCI. BIOENG.,
IBII ET AL.
TABLE 1. Gene-specific primers and PCR conditions Gene
Forward primer
Reverse primer
Insulin 1 Insulin 1 (2nd PCR) Insulin 2 Glucagon Somatostatin Amylase Pdx1 Ngn3 Glut2 Nestin Oct-3/4 GAPDH
ccagctataatcagagacca tcagcaagcaggtcattgt tccgctacaatcaaaaaccat actcacagggcacattcacc tcgctgctgcctgaggacct caggcaatcctgcaggaacaa ggccacacagctctacaagg tggcactcagcaaacagcga cggtgggacttgtgctgctgg ggagagtcgcttagaggtgc accttccccatggc accacagtccatgccatcac
gtgtagaagaagccacgct cccacacaccaggtagaga gctgggtagtggtgggtcta ccagttgatgaagtccctgg gccaagaagtacttggccagttc cacttgcggataactgtgcca ttccacttcatgcgacggtt acccagagccagacaggtct ctctgaagacgccaggaattccat tcaggaaagccaagagaagc acttgatcttttgcccttctg tccaccaccctgttgctgta
followed the 5-stage method reported by Lumelsky et al. (9). ES cells differentiated through transit nestin-positive cells to insulin-producing cells in a serum-free culture medium. After whole procedures were done, more than 20% of the cells were stained with an antibody against insulin, as reported. Morphologies and immunostaining characteristics of the insulin-positive cells were carefully examined. We found two distinct populations of insulin-positive cells (Fig. 1A, C). Insulin-positive cells of the major population mainly existed in cell clusters with multi-cell layers, while insulin-positive cells of a minor population were found in a single-cell layer as a cluster. There are distinctive differences in various aspects between these two insulin-positive cell populations. In the former population, both the cytoplasm and nuclei of the cells were immunoreactive against anti-insulin antibody and also anti-glucagon antibody, as shown in Fig. 1A, and the cells were also insulin/TUNEL double positive cells (about 10 µm in diameter) (Fig. 1B). As Rajagopal et al. (15) reported, those cells were not expected to be insulin-producing cells, but apoptotic or necrotic cells which were simply stained by capturing exogenous insulin from the culture medium. For the second type of insulin-positive cells, the larger cells (about 20 µm in diameter) were immunoreactive against anti-insulin antibody, but not against anti-glucagon antibody (Fig. 1C). The other noteworthy points are that their cytoplasm were stained with anti-insulin antibody, but their nuclei were free from staining (Fig. 1C), as well as being TUNEL-negative (Fig. 1D). The proportion of the larger insulin-positive cells was less than 0.1%. We expect that the latter larger insulin-positive cells are de novo insulin-producing cells. In the second method, ES cells were cultured in a medium supplemented with FCS. After the differentiation procedure (stage 4S), insulin-positive cells were found. Although differentiation efficiency was not so high (about 0.3%), most of the insulin-positive cells looked like the larger cells found in the Lumelsky’s method. Their cytoplasm was stained with anti-insulin antibody, but their nuclei were free from staining and the cells were free from TUNEL staining (Fig. 1F, G). The other interesting point is that smaller insulin/TUNEL double positive cells, which are the major population in the Lumelsky’s method, were hardly detected in the ES cell progeny derived in the culture medium supplemented with FCS.
Size of product (bp) 197 157 411 353 232 484 582 444 416 327 855 452
No. of PCR cycles 35 35 35 35 35 35 35 35 35 30 30 30
Annealing temperature (°C) 55 55 64 62 55 64 55 60 64 55 55 55
Reference no. 11 – 11 11 11 11 13 11 11 – 11 –
C-peptide, which is produced during de novo biosynthesis of insulin, is an important indicator for the derivation of insulin-producing cells from ES cells. Thus, existence of C-peptide in the differentiated cells should be confirmed to claim that insulin-positive ES cell progeny contain insulinproducing cells. Therefore, immunostaining for C-peptide was carried out for ES cell progeny (Fig. 1E, H). C-peptidepositive cells looked like larger insulin-positive cells in both differentiation procedures. Intracellular C-peptide content of differentiated ES cells was also determined by ELISA (included as in insert in Fig. 1). Intracellular C-peptide content are 1153 ± 175.3 pg/mg protein and 1285 ± 302.1 pg/mg protein for stage 5L cells of the Lumelsky’s method and stage 4S cells in the FCS culture medium, respectively. Although a large number of smaller insulin-positive cells were observed in stage 5L as shown in Fig. 1A, we could not find smaller C-peptide-positive cells. There was no difference in C-peptide contents between ES cell progenies for these two methods. These results also support the idea that the larger insulin-positive cells which were found as a cluster in a single cell layer are insulin-producing cells. RT-PCR analyses were performed for cells at each different stage and the results are shown in Fig. 2. No clear difference was found in gene expression in ES cell progenies at stage 5L cells of the Lumelsky’s method and stage 4S cells in the FCS culture medium. There are two non-allelic forms of insulin, insulin 1 and 2 in rodents (16). Insulin 2 gene expression was easily detected by RT-PCR analyses. Insulin 1 gene expression was difficult to detect, but could be observed by the nested PCR analysis. Other endocrine genes, such as glucagon and somatostatin genes, and the exocrine gene, amylase, were also detected. These results suggest that ES cells differentiated into the pancreatic cell lineage, that is, not only into endocrine, but also into exocrine cells, in both procedures. Various transcription factors which are activated in the development of the pancreas were identified (17–19) in embryoid body (EB) cells (stage 2). Gene expression of Pdx1, which is reported to play crucial roles in the early development of the pancreas (20–22), was detected in EB cells and in cells at stage 4S. Expression of the Ngn3 gene was observed at all stages in the both methods. Gene expression of Glut2, which plays an important role in the glucose stimulated insulin secretion, was detected at stage 2 but faded at stage 4S and stage 5L. A neuronal stem/
VOL. 103, 2007
INSULIN-PRODUCING CELLS DERIVED FROM MOUSE ES CELLS
143
FIG. 1. Immunocytochemical analyses of stage 5L cells induced in the serum-free culture medium by Lumelsky’s method (A–E) and stage 4S cells in DMEM/F12 supplemented with 15% FCS (F–H) and their C-peptide contents (insert). S1, S5L and S4S represent stage 1, stage 5L and stage 4S, respectively. Data are shown as mean ±SD.
progenitor cell marker, nestin, which has been believed to be expressed in precursors for pancreatic endocrine cells (23), was detected by RT-PCR as early as stage 2. Oct-3/4 gene expression, which is required for the maintenance of the undifferentiated state, was clearly observed at stage 1 and stage 2 and disappeared at stage 4S and became weak at stage 5L. These immunostaining and RT-PCR analyses indicate that insulin-producing cells are derived by both procedures, and that these cells are larger in size and their cytoplasm is immunostained by anti-insulin and anti-C-peptide antibodies. Other ES cell strains, such as CCE cells (Stem Cell Technologies, British Columbia, Canada), were also examined in this study and demonstrated similar behavior of the EB5 cells (data not included). Cell proliferation In the clinical setting, the procedure by which insulin-producing cells are derived needs to as simple as possible, and a sufficient number of cells need
to be available at any given time for a patient. Therefore, the possibility of cell number expansion was examined. The cell proliferation activity of ES cell progeny was studied using the BrdU incorporation method. As shown in Fig. 3A, many cells, not only the insulin-positive cells but also insulin-negative cells, incorporated BrdU. The insulin-negative cells not incorporated BrdU also existed in the same dish. After differentiation, insulin-producing cells still maintained proliferation activity. Cells which were obtained at stage 5L of the Lumelsky’s method and at stage 4S in FCS containing culture medium were able to be subcultured several times. Cells which were collected from one culture dish were divided into five dishes and then cultured in the same media used in stage 5L or stage 4S. ES cell progeny contained cells which were able to form insulin-positive cell clusters after subculture, as shown in Fig. 3B and 3C. Cells obtained in stage 4S could be subcultured many times and maintained for long term in a medium supplemented with
144
J. BIOSCI. BIOENG.,
IBII ET AL.
clearly detected after 3 times subcultures. On the other hand, the expression level of the pancreatic exocrine gene, amylase, decreased with during the subcultures. These results indicate that insulin-producing cells seemed to mature during repeated subcultures. DISCUSSION
FIG. 2. RT-PCR analysis of gene expression of EB5 cells at different stages. Lane 1, Stage 1 (undifferentiated ES cells); lane 2, stage 2 (embryoid body formed in the absence of LIF); lane 3, stage 5L cells (ES cell progeny induced in the serum free culture medium by Lumelsky’s method); lane 4, stage 4S cells (ES cell progeny induced in DMEM/F12 supplemented with 15% FCS).
FCS. Even after nine times of subculturing, insulin-positive cell clusters were still observed, as shown in Fig. 3D. On the other hand, for cells obtained by Lumelsky’s method, small insulin-positive cells found in stage 5L appeared during the subculture, and ES cell progeny produced clusters of lager insulin-positive cells after subculture, as shown in Fig. 3E, but gradually deteriorated and lost their proliferation potential in the serum-free medium after several subcultures. The number of larger insulin-positive cells (about 20 µm in diameter) found in a culture dish was followed with subculture times and presented in Fig. 4. The number of insulin-positive cells at each stage by Lumelsky’s method (method 1) were as follows: stage 5L, 102 ± 49 cells/cm2; P1L, 102± 59 cells/cm2; P2L, 109±65 cells/cm2; P3L, 46 ±12 cells/cm2; P4L, not detected (most of cells died), whereas in the method 2, stage 4S, 238 ± 100 cells/cm2; P1S, 313 ± 135 cells/cm2; P2S, 146 ± 41 cells/cm2; P3S, 180 ± 73 cells/cm2; and P4S, 146 ± 51 cells/cm2. These results indicate that insulin-positive cells proliferated during the subculture. Taking into account the results that BrdU-incorporated insulin-positive cells appeared in differentiated cells, we reached an opinion that insulin-positive cells or their progenitor cells can proliferate and expand their number by subculturing many times. RT-PCR analyses were completed for gene expression of subcultured cells obtained in the medium of stage 4S (Fig. 3F). Expression levels of the insulin 2 gene increased with the number of subcultures. Moreover, Glut2 gene expression, which was rarely detected before subculture, was
In this study, two distinct populations of insulin-positive cells were found in ES cell progeny. Cells in one population, which were smaller and carried small, condensed, and TUNEL-positive nuclei, appeared to be similar to those derived by Lumelsky et al. (9), and noted by Rajagopal et al. (15). These are dead cells stained with exogenous insulin from the culture medium. The other population is a group of larger cells whose cytoplasm was immunostained with antibodies to insulin and C-peptide, but contained nuclei free from these stainings and were TUNEL-negative. In Lumelsky’s nestin-positive cell selection method using a serumfree medium (method 1), although the latter insulin-positive cells larger in size were found, the majority of the insulinpositive cells were the former insulin-stained small cells. On the other hand, in method 2 using a medium containing FCS, the latter type of insulin-positive cells was the majority, and TUNEL-positive apoptotic/necrotic cells co-stained with insulin were rarely detected. Lumelsky’s method includes the stage to select nestin-positive cells. It was thought that a large number of non-neural cells were forced to apoptosis/necrosis during this selection, and that these cells took insulin from the serum-free medium containing insulin. Contrary to the results found in method 1, few dead cells were found in method 2, because the cell selection stage was not included. C-peptide, which is produced during de novo biosynthesis of insulin, is an important indicator to confirm derivation of insulin-producing cells from ES cells. Unfortunately, we could not carry out double staining for both insulin and C-peptide in the same cultures, because both antibodies against insulin and C-peptide were developed in guinea pigs. In our cultures, C-peptide-positive cells were clearly detected by the immunocytochemical method and their shape looked like those of larger insulin-positive cells as shown in Fig. 1. Only the cytoplasm of both cells, but not the nuclei, was insulin and C-peptide-positive, respectively. Intracellular C-peptide content increased as the differentiation stage advanced and the amounts of intracellular C-peptide content was not significantly different between the two methods. Although we could not demonstrate that the larger insulinpositive cells were co-positive for C-peptide by double staining, all of these facts suggest that C-peptide-positive cells seemed to be of the same population as insulin-positive cells shown in Fig. 1C and 1F. Recently, Sipione reported that insulin-producing cells derived from ES cells by a modified method of Lumelsky were not β cells, but neuronal insulin-expressing cells (24). Furthermore, Roche et al. reported that insulin-producing cells derived from ES cells in their study might be mainly ectoderm in origin (25). Rodents have two non-allelic forms of insulin, that is, insulin 1 and 2 (16). Insulin 1 gene expression is restricted to the pancreatic β cells, whereas insu-
VOL. 103, 2007
INSULIN-PRODUCING CELLS DERIVED FROM MOUSE ES CELLS
145
FIG. 3. Immunocytochemical examination and RT-PCR analysis of ES cell progeny before and after several subcultures. (A) Insulin-positive and BrdU labeled cells found in stage 4S; (B–D) insulin-positive cells found after 1, 3 and 9 times subculturing of stage 4S cells, respectively; (E) insulin-positive cells obtained after 3 times subculturing of stage 5L cells; (F) RT-PCR analysis of ES cell progeny before and after several subcultures. Lane 1, Stage 4S cells before subcultured; lane 2, insulin-positive cells obtained after three subcultures of stage 4S cells.
FIG. 4. Number of insulin-positive cells found after subculturing of cells of stage 5L and stage 4S. Number of insulin-positive cells is expressed by cell number ± SD per 1 cm2. White bars, Insulin-positive cells obtained by subculturing of cells from stage 5L; black bars, insulin-positive cells obtained by subculturing the cells from stage 4S.
lin 2 is more broadly expressed in the developing brain and yolk sac as well as in the pancreatic β cells (16, 26). In our studies, insulin 1 gene expression was weak, but could be
seen by the nested PCR. Other pancreatic endocrine genes, insulin 2, glucagon, somatostatin, and an exocrine gene, amylase, were clearly detected by gene expression analyses by RT-PCR. These facts indicate that at least a portion of the insulin-producing cells derived in this study has a phenotype of pancreatic β cells. It is desired that the number of insulin-producing cells or their progenitor cells can be increased by subculturing for the cell therapy of diabetic patients. Although about 1100 insulin-positive cells were derived in a culture dish (φ: 35 mm) by the method 1, we could not subculture the insulin-positive cells more than four times. A culture medium used in the method 1 was serum free. It would not be suitable for maintenance of the insulin-positive or insulin-negative cells for a long period. On the other hand, about 1500–3000 insulin-positive cells were derived in a dish by the method 2. Cells collected from the dish were divided into five dishes in each subculture step. Insulin-positive cells were still observed even after nine times of subculturing, as shown in Fig. 3D. Serum components, such as proteins and free fatty acids, might afford a good condition for long term maintenance and growth of insulin precursor cells or immature insulin/BrdU positive cells. Though the proliferation activity was weaken gradually as times of subculture went, after nine times subcultures total cell numbers of insulin-positive
146
J. BIOSCI. BIOENG.,
IBII ET AL.
cells will be up to 2000 ×59 = 4 ×109 cells. For clinical islet transplantation, approximately 600,000 islets are transplanted to a patient of 60 kg in body weight. If one islet contains 2000 β cells, then 1.2 ×109 β cells were transplanted to the patient. Although many problems, such as isolation of the insulin-positive cells, still need to be overcome, in principle, sufficient numbers of insulin-positive cells can be obtained by nine subcultures of ES cell progeny. In this paper, we showed that mouse ES cells can be differentiated to insulin-producing cells and the number of these can be expanded by subculture of the ES cell progeny. There are many issues that still remain before we claim that the insulin-positive cells obtained are promising for cell therapy of a diabetic patient. For example, functions of insulin-positive cells, such as insulin release in response to glucose concentration changes, should be carefully examined. An effective method to isolate progenitor cells for insulin-producing cells should be developed to ensure a cell source for cell therapy for the diabetic patient. We are currently investigating isolation of pancreatic progenitor cells from the ES cell progeny by use of a reporter gene which is expressed specifically for pancreatic progenitor cells. In the future, it will be reported that more detailed examinations of insulin releasing cells from ES cells as cells that can be utilized in development of a method which can release insulin in response to changes of blood glucose levels for therapy in type I diabetes.
9.
10.
11.
12.
13.
14.
15. 16.
17.
ACKNOWLEDGMENTS We thank Dr. J. Miyazaki, Osaka University for valuable advices. We also thank Dr. T. Richey for English correction of the manuscript. This work was supported in part by grants of Leading Project and Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan.
18. 19. 20.
REFERENCES 1. Hanazaki, K., Nosé, Y., and Brunicardi, F. C.: Artificial endocrine pancreas. Am. Coll. Surg., 193, 310–322 (2001). 2. Kost, J.: Ultrasound-assisted insulin delivery and noninvasive glucose sensing. Diabetes Technol. Ther., 4, 489–497 (2002). 3. Shapiro, A. M., Lakey, J. R., Ryan, E. A., Korbutt, G. S., Toth, E., Warnock, G. L., Kneteman, N. M., and Rajotte, R. V.: Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N. Engl. J. Med., 343, 230–238 (2000). 4. Assady, S., Maor, G., Amit, M., Itskovitz-Eldor, J., Skorecki, K. L., and Tzukerman, M.: Insulin production by human embryonic stem cells. Diabetes, 50, 1691–1697 (2001). 5. Blyszczuk, P., Czyz, J., Kania, G., Wagner, M., Roll, U., St-Onge, L., and Wobus, A.: Expression of Pax4 in embrygenitor and insulin-producing cells. Proc. Natl. Acad. Sci. USA, 100, 998–1003 (2003). 6. Hori, Y., Rulifson, I. C., Tsai, B. C., Heit, J. J., Cahoy, J. D., and Kim, S. K.: Growth inhibitors promote differentiation of insulin-producing tissue from embryonic stem cells. Proc. Natl. Acad. Sci. USA, 99, 16105–16110 (2002). 7. Kahan, B. W., Jacobson, L. M., Hullett, D. A., Ochoada, J. M., Oberley, T. D., Lang, K. M., and Odorico, J. S.: Pancreatic precursors and differentiated islet cell types from murine embryonic stem cells: an in vitro model to study islet differentiation. Diabetes, 52, 2016–2024 (2003). 8. Leon-Quinto, T., Jones, J., Skoudy, A., Burcin, M., and
21. 22.
23.
24.
25.
26.
Soria, B.: In vitro directed differentiation of mouse embryonic stem cells into insulin-producing cells. Diabetologia, 47, 1442–1451 (2004). Lumelsky, N., Blondel, O., Laeng, P., Velasco, I., Ravin, R., and McKay, R.: Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science, 292, 1389–1394 (2001). Miyazaki, S., Yamato, E., and Miyazaki, J.: Regulated expression of pdx-1 promotes in vitro differentiation of insulinproducing cells from embryonic stem cells. Diabetes, 53, 1030–1037 (2004). Moritoh, Y., Yamato, E., Yasui, Y., Miyazaki, S., and Miyazaki, J.: Analysis of insulin-producing cells during in vitro differentiation from feeder-free embryonic stem cells. Diabetes, 52, 1163–1168 (2003). Segev, H., Fishman, B., Ziskind, A., Shulman, M., and Itskovitz-Eldor, J.: Differentiation of human embryonic stem cells into insulin-producing clusters. Stem Cells, 22, 265–274 (2004). Shiroi, A., Yoshikawa, M., Yokota, H., Fukui, H., Ishizaka, S., Tatsumi, K., and Takahashi, Y.: Identification of insulinproducing cells derived from embryonic stem cells by zincchelating dithizone. Stem Cells, 20, 284–292 (2002). Soria, B., Roche, E., Berna, G., Leon-Quinto, T., Reig, J. A., and Martin, F.: Insulin-secreting cells derived from embryonic stem cells normalize glycemia in streptozotocininduced diabetic mice. Diabetes, 49, 157–162 (2000). Rajagopal, J., Anderson, W. J., Kume, S., Martinez, O. I., and Melton, D. A.: Insulin staining of ES cell progeny from insulin uptake. Science, 299, 363 (2003). Deltour, L., Leduque, P., Blume, N., Madsen, O., Dubois, P., Jami, J., and Bucchini, D.: Differential expression of the two nonallelic proinsulin genes in the developing mouse embryo. Proc. Natl. Acad. Sci. USA, 90, 527–531 (1993). Edlund, H.: Pancreatic organogenesis—developmental mechanisms and implications for therapy. Nat. Rev. Genet., 3, 524–532 (2002). Servitja, J. M. and Ferrer, J.: Transcriptional network controlling pancreatic development and beta cell function. Diabetologia, 47, 597–613 (2004). Soria, B.: In-vitro differentiation of pancreatic beta-cells. Differentiation, 68, 205–219 (2001). Ahlgren, U., Jonsson, J., Jonsson, L., Simu, K., and Edlund, H.: β-Cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the β-cell phenotype and maturity onset diabetes. Genes Dev., 12, 1763–1768 (1998). Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H.: Insulin-promoter-factor 1 is required for pancreas development in mice. Nature, 371, 606–609 (1994). Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein, R. W., Magnuson, M. A., Hogan, B. L. M., and Wright, C. V. E.: PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development, 122, 983– 995 (1996). Zulewski, H., Abraham, E. J., Gerlach, M. J., Daniel, P. B., Moritz, W., Müller, B., Vallejo, M., Thomas, M. K., and Habener, J. F.: Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes, 50, 521–533 (2001). Sipione, S., Eshpeter, A., Lyon, J. G., Korbutt, G. S., and Bleackley, R. C.: Insulin expressing cells from differentiated embryonic stem cells are not beta cells. Diabetologia, 47, 499–508 (2004). Roche, E., Sepulcre, P., Reig, J. A., Santana, A., and Soria, B.: Ectodermal commitment of insulin-producing cells derived from embryonic stem cells. FASEB J., 19, 1341–1343 (2005). McGrath, K. E. and Palis, J.: Expression of homeobox genes, including an insulin promoting factor, in the murine yolk sac at the time of hematopoietic initiation. Mol. Reprod. Dev., 48, 145–153 (1997).