- Email: [email protected]
Possible Role of Extracellular Signal-Regulated Kinase Pathway in Regulation of Sox9 mRNA Expression in Chondrocytes under Hydrostatic Pressure
JOURNAL OF BIOSCIENCE AND BIOENGINEERING Vol. 104, No. 6, 506–509. 2007 DOI: 10.1263/jbb.104.506
© 2007, The Society for Biotechnology, Japan
Possible Role of Extracellular Signal-Regulated Kinase Pathway in Regulation of Sox9 mRNA Expression in Chondrocytes under Hydrostatic Pressure Kensuke Mio,1* Jennifer Kirkham,2 and William A. Bonass2 Academic Unit of Musculo-Skeletal and Rehabilitation Medicine, Bioengineering Division, University of Leeds, Leeds, LS2 9NZ, UK 1 and Department of Oral Biology, Leeds Dental Institute, University of Leeds, Leeds, LS2 9LU, UK 2 Received 28 May 2007/Accepted 2 September 2007
The potential involvement of the extracellular signal-regulated kinase (ERK) pathway in chondrocyte mechanotransduction was tested in bovine chondrocyte-agarose constructs under hydrostatic loading. Results suggested that the ERK pathway may be inhibited by hydrostatic pressureinduced mechanotransduction and may also be a negative regulator of Sox9 mRNA expression, which is an important modulator of chondrocyte function. [Key words: articular chondrocyte, agarose culture, hydrostatic pressure, mechanotransduction, extracellular signal-regulated kinase pathway, Sox9]
not yet been shown how the ERK pathway regulates Sox9 mRNA expression, the pathway consists of a series of cascade reactions resulting in activated ERK entering the nucleus and inducing changes in expression of a range of genes, possibly including Sox9. Sox9 is a transcriptional factor and a member of a family of proteins containing a DNA-binding domain. Sox9 activates enhancer segments of chondrocytespecific genes, such as Type II collagen and aggrecan (19, 20). Agarose-bovine chondrocyte constructs (total volume 0.44 ml) were prepared at a final concentration of 2 ×106 cells/ml in 1% agarose (type VII; Sigma-Aldrich, Poole, UK) (3, 4, 17, 18). These constructs were cultured in Dulbecco’s minimal essential medium (Sigma-Aldrich) containing 10% foetal bovine serum (Sigma-Aldrich) at 37°C under 5% CO2 in air. After 2 d of preculture, 5 Mp hydrostatic pressure was applied to the agarose-chondrocyte constructs for 4 h using a pressure application system as previously detailed by Toyoda et al. (4, 15). Where appropriate, an inhibitor of ERK phosphorylation, PD98059 (Tocris, Bristol, UK) was added 1 h prior to the pressure application at a concentration of 100 µM (shown to suppress ERK phosphorylation for up to 5 h in a preliminary study [data not shown]), remaining samples contained only vehicle (0.1% DMSO). An identical chamber placed in the same water bath was used for the control cells (no loading and without PD98059). At the end of the pressure application period, ERK phosphorylation was determined by Western blotting using a Mini-PROTEIN 3 Cell (Bio-Rad, Hemel Hempstead, UK) according to the manufacturer’s instructions. After electrophoresis, the proteins were transferred to nitrocellulose membranes (Bio-Rad). The blots were probed using a 1 : 1000 dilution of polyclonal antibodies (Cell Signalling Technology, Danvers, MA, USA) specific for either the phosphorylated or total ERK1/2. The
Chondrocytes require appropriate mechanical stress for maintenance of phenotype (1–4), suggesting a role for intracellular mechanotransduction pathways, possibly including those associated with mitogen-activated protein kinases (MAPKs), in cartilage homeostasis (5–10). MAPK pathways are a series of intracellular kinase cascade reactions that transduce a variety of external signals including growth factors, cytokines, viral infections, transforming agents, UV irradiation and heat shock and have been shown to be involved in a wide range of cellular responses (11, 12). The effects of mechanical stress on one of the MAPK pathways, the extracellular signal-regulated kinase pathway (ERK), have been reported in several kinds of cells (5–7). However, the precise role of the ERK pathway in maintenance of chondrocyte phenotype remains controversial and both positive and negative roles have been reported (5–10, 13). Hydrostatic pressure is thought to be one of the main mechanical stresses in articular joints and is considered to be an important factor for tissue homeostasis (4, 14, 15). We hypothesise that the ERK pathway participates in hydrostatic pressure-induced mechanotransduction in chondrocytes. To test the hypothesis, we investigated ERK activation in chondrocytes cultured in agarose gels under conditions of controlled application of hydrostatic pressure. The agarose culture system used here is ideally suited to studies of the effects of mechanical stress on chondrocytes (3, 4, 16–18). Expression of Sox9 mRNA, which plays a pivotal role in chondrocyte differentiation and maintenance of phenotype (19, 20), was determined as a possible downstream target of the pathway. There are an increasing number of reports showing the regulation of Sox9 mRNA expression through the ERK pathway (10, 13). Although it has * Corresponding author. e-mail: [email protected] phone: +81-(0)4-2995-1663 fax: +81-(0)4-2996-5208 506
VOL. 104, 2007
NOTES
507
TABLE 1. Primer sets used for PCR and sequence accession numbera Amplicon size ACGCCGAGCTCAGCAAGA CACGAACGGCCGCTTCT 71 Sox9 GAPDH CTAGGCTACACTGAGGACCAGGTT CCCAGCATCGAAGGTAGAAGAGT 75 Primer sets for Sox9 and GAPDH are referred from Wong et al. (27) and Mio et al. (3), respectively. a From NCBI Entrez. Target Gene
Sense Primer 5′ to 3′ sequence
Antisense Primer 5′ to 3′ sequence
blots were developed using the ExtraAvidin Alkaline Phosphatase Staining Kit (Sigma-Aldrich) and BCIP/NBT (Sigma-Aldrich) as per manufacturer’s instruction. The intensity of the bands was analyzed using Quantity One software (Bio-Rad). The intensity of the phosphorylated ERK bands of each sample was normalized relative to the intensity of the total ERK protein bands per lane. Total RNA was extracted from chondrocytes in agarose gels at the end of the loading period according to the method of Mio et al. (21). Total RNA (50 ng) was reverse transcribed (RT) to cDNA in 20 µl of reverse transcription reaction mixture using RETROscript (Ambion) according to the manufacturer’s instructions. One µl aliquot of RT product was then used for the polymerase chain reaction (PCR) in a 25 µl reaction mixture containing 1 × SensiMix (Quantace, London, UK), 1 × SYBR Green solution, and 200 nM of each primer (Table 1). The thermocycle included 1 cycle at 95°C for 10 min and 40 cycles at 95°C for 15 s, at 58°C for 20 s and at 72°C for 20 s, followed by a melting curve program (72– 95°C with a heating rate of 0.2°C per s). Melting curve analysis and agarose gel electrophoresis showed the presence of a single PCR product (data not shown). The relative differences among the groups were determined using the ∆∆ threshold cycle (Ct) method, as outlined in the Applied Biosystems protocol for RT-PCR (22, 23). All of the data were expressed as ratios to the mean values of the control group (without loading and without the addition of PD98059). Statistical analysis was carried out using Mann–Whitney test. P values less than 0.05 were considered significant. Results showed an inverse relationship between ERK phosphorylation and Sox9 expression after application of 5 Mp hydrostatic pressure for 4 h (Figs. 1 and 2). Quantification of the Western blot analysis showed a significant decrease (p < 0.001) in ERK phosphorylation down to 72.0% of controls (Fig. 1B) after loading. In contrast, analysis of Sox9 mRNA expression showed a significant increase (p = 0.038) of 278.0% compared to controls as a result of pressure application (Fig. 2). A similar effect was seen when the inhibitor of ERK phosphorylation, PD98059, was added in the absence of hydrostatic pressure. Without pressure application, PD98059 supplementation at 100 µM caused a significant decrease (p < 0.001) in ERK phosphorylation down to 47.5% (Fig. 1) and a significant increase (p = 0.008) in Sox9 mRNA expression to 331.3% compared to controls (Fig. 2). Taken together, these data suggest that the ERK pathway participates in hydrostatic pressure-induced mechanotransduction and may also be a negative regulator of Sox9 mRNA expression. The ERK pathway could therefore play a role in the maintenance of chondrocytic phenotype. Given that Sox9 protein has a pivotal role in chondrocyte differentiation, is required for chondrocyte development and also directly regulates expression of genes important for chondrocyte function,
Sequence accession no. AF278703 (partial coding sequence) U85042 (partial coding sequence)
such as Type II collagen and aggrecan (19, 20), a mechanotransduction system which regulates Sox9 mRNA expression would be expected to have an important role in cartilage homeostasis. Our results suggest that hydrostatic pressure may modulate the negative effect of the chondrocyte ERK pathway and contribute towards maintaining cell homeostasis by stimulating Sox9 mRNA expression. Toyoda et al. (4, 15) reported upregulation of Type II collagen and aggrecan mRNA expression after application of hydrostatic pressure for 4 h using the same pressure system as that described here. This suggests that Type II collagen and aggrecan are also regulated in part by the ERK pathway in chondrocytes. Although further research, including the influence of ERK inhibitor on the gene expression of Type II collagen and aggrecan, will be required to elucidate these relationships, we focussed upon Sox9 mRNA expression in this research as an initial step. Previous reports of the effects of mechanical
FIG. 1. Western blot analysis to determine relative amounts of total and phospho-ERK. (A) Representative blots following probing with antibodies to total ERK and phospho-ERK. Consistent levels of total ERK can be seen in each group. Phospho-ERK levels appear to be reduced after application of 5 MPa hydrostatic pressure compared to the control group. Addition of PD98059 (an inhibitor of ERK phosphorylation) also appeared to result in decreased ERK phosphorylation compared to the control group. (B) Graph showing the percentage of signal intensity of phospho-ERK compared to the corresponding total ERK normalised to the control mean. Bars represent the mean ±standard deviation (n = 18 in each treatment group) (Mann–Whitney test; NS, not significant).
508
J. BIOSCI. BIOENG.,
MIO ET AL.
FIG. 2. Expression of Sox9 mRNA by bovine articular chondrocytes in agarose culture. Graph showing the percentage of Sox9 mRNA expression relative to GAPDH mRNA normalised to the control mean. The bars represent the mean ± standard deviation. Sox9 mRNA expression increased under hydrostatic pressure in the absence of PD98059 compared to control. Sox9 expression also increased compared to controls in the presence of PD98059 (an inhibitor of ERK phosphorylation) (n=12 in each treatment group) (Mann–Whitney test; NS, not significant).
stress on the ERK pathway in several cell types have been equivocal, with both positive and negative effects being described (5–10, 13). Our results indicate that ERK may be a negative regulator for articular chondrocyte phenotype maintenance as demonstrated by the decrease in ERK phosphorylation accompanied by a concomitant increase in Sox9 mRNA expression. This result is compatible with that reported by Yoon et al. (9) and Hung et al. (5) who showed that phospho-ERK decreases type II collagen and aggrecan expression in articular chondrocytes. The ERK pathway also restricts chondrogenic differentiation in mesenchymal cells (8, 10). However, Murakami et al. (13) showed a positive role for phospho-ERK in mesenchymal cell differentiation along a chondrocytic lineage. Recently, Bobick et al. (24) reported that the role of the ERK pathway varies according to cell origin or growth stage. The ERK pathway acts as a negative regulator of chondrocyte differentiation in the frontonasal mesenchyme of stage 24/25 chick embryos but functions as a positive regulator in stage 24/25 mandibular arch mesenchyme as well as in frontonasal mesenchyme of stage 28/29 embryos. This differential effect according to cell origin or growth stage may help explain some of the apparent discrepancies regarding the role of ERK between previous reports. Our results of ERK inhibition as a consequence of application of hydrostatic pressure may seem to contradict previous reports which showed activation of ERK by mechanical stresses in various cell types (25, 26) including articular chondrocytes (5). However, Shiratsuchi et al. (7) showed pressure-induced inhibition of ERK in the human monocytic cell line, THP-1. Sawada et al. (6), using fibroblastic L-929 cells or human embryonic kidney-derived cells showed that different stresses elicit different responses in the ERK pathway in the same cells, as cell stretching activated the ERK pathway and cell contraction caused inactivation, suggesting that different physical forces may have opposite effects on ERK in these cells. Given that articular cartilage plays an important role in the transmission of mechanical forces, the chondrocyte (the only cell present in
the cartilage), may react elastically to different mechanical stresses to keep equilibrium with the surrounding environment and maintain homeostasis via mechanotransduction. Several studies have investigated the effects of mechanical stress on articular cartilage, with diverse results (3, 4, 15, 17, 18, 27). The mechanical stimulation schemes, the cell culture methods and the source of cartilage samples all differ among these studies and could well explain the discrepancies between the reports. The agarose culture system used in this study has previously been shown to maintain chondrocyte phenotype (as evidenced by Type II collagen and aggrecan expression [16]), and was therefore suitable for investigating the effects of mechanical stress on these cells (3, 4, 17, 18). Reports describing a decrease in matrix synthesis following mechanical compression or application of hydrostatic pressure (28, 29) appear to contradict our results. However, other studies are in line with our own (4, 14, 30). Toyoda et al. (4) showed increased proteoglycan synthesis under a statically applied hydrostatic pressure of 5 MPa for 4 h. They assumed that static hydrostatic pressure could be stimulatory to chondrocytes but only when applied for relatively short periods. The timing and level of the pressure signal is crucial and this may be one reason for the previously reported contradicting results. Further study will be required to determine the optimum loading conditions to stimulate chondrocyte metabolism. In summary, the ERK pathway may participate in hydrostatic pressure-induced mechanotransduction and may also be a negative regulator of Sox9 mRNA expression. Hydrostatic pressure may therefore modulate the negative effect of the ERK pathway in chondrocytes and contribute towards maintaining cell homeostasis by stimulating Sox9 mRNA expression. Hydrostatic pressure does not cause cellular deformation and investigation of the mechanism by which the chondrocytes sense the pressure change of the environment may be an interesting future target. These data will contribute towards a better understanding of mechanotransduction in chondrocytes and the role of application of mechanical stress in tissue engineering and cartilage repair. It may be also possible to apply optimised pressure for future therapeutic repair of damaged cartilage clinically. Furthermore, understanding the mechanotransduction pathway may lead to the development of drugs which can stimulate anabolic pathway or inhibit catabolic pathway in chondrocytes. We would like to thank Dr. Bahaa Seedhom (Academic Unit of Musculo-Skeletal and Rehabilitation Medicine, Bioengineering Division, University of Leeds) for excellent advice and support.
REFERENCES 1. Enneking, W. F. and Horowitz, M.: The intra-articular effects of immobilization on the human knee. J. Bone Joint Surg. Am., 54, 973–985 (1972). 2. Mooney, V. and Stills, M.: Continuous passive motion with joint fractures and infections. Orthop. Clin. North Am., 18, 1–9 (1987). 3. Mio, K., Saito, S., Tomatsu, T., and Toyama, Y.: Intermittent compressive strain may reduce aggrecanase expression in cartilage: a study of chondrocytes in agarose gel. Clin. Orthop. Relat. Res., 433, 225–232 (2005).
VOL. 104, 2007
4. Toyoda, T., Seedhom, B. B., Yao, J. Q., Kirkham, J., Brookes, S., and Bonass, W. A.: Hydrostatic pressure modulates proteoglycan metabolism in chondrocytes seeded in agarose. Arthritis Rheum., 48, 2865–2872 (2003). 5. Hung, C. T., Henshaw, D. R., Wang, C. C., Mauck, R. L., Raia, F., Palmer, G., Chao, P. H., Mow, V. C., Ratcliffe, A., and Valhmu, W. B.: Mitogen-activated protein kinase signaling in bovine articular chondrocytes in response to fluid flow does not require calcium mobilization. J. Biomech., 33, 73– 80 (2000). 6. Sawada, Y., Nakamura, K., Doi, K., Takeda, K., Tobiume, K., Saitoh, M., Morita, K., Komuro, I., De Vos, K., Sheetz, M., and Ichijo, H.: Rap1 is involved in cell stretching modulation of p38 but not ERK or JNK MAP kinase. J. Cell Sci., 114, 1221–1227 (2001). 7. Shiratsuchi, H. and Basson, M. D.: Extracellular pressure stimulates macrophage phagocytosis by inhibiting a pathway involving FAK and ERK. Am. J. Physiol. Cell Physiol., 286, C1358–1366 (2004). 8. Bobick, B. E. and Kulyk, W. M.: The MEK-ERK signaling pathway is a negative regulator of cartilage-specific gene expression in embryonic limb mesenchyme. J. Biol. Chem., 279, 4588–4595 (2004). 9. Yoon, Y. M., Kim, S. J., Oh, C. D., Ju, J. W., Song, W. K., Yoo, Y. J., Huh, T. L., and Chun, J. S.: Maintenance of differentiated phenotype of articular chondrocytes by protein kinase C and extracellular signal-regulated protein kinase. J. Biol. Chem., 277, 8412–8420 (2002). 10. Zakany, R., Szijgyarto, Z., Matta, C., Juhasz, T., Csortos, C., Szucs, K., Czifra, G., Biro, T., Modis, L., and Gergely, P.: Hydrogen peroxide inhibits formation of cartilage in chicken micromass cultures and decreases the activity of calcineurin: implication of ERK1/2 and Sox9 pathways. Exp. Cell Res., 305, 190–199 (2005). 11. Schaeffer, H. J. and Weber, M. J.: Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol. Cell. Biol., 19, 2435–2444 (1999). 12. Johnson, G. L. and Lapadat, R.: Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science., 298, 1911–1912 (2002). 13. Murakami, S., Kan, M., McKeehan, W. L., and de Crombrugghe, B.: Up-regulation of the chondrogenic Sox9 gene by fibroblast growth factors is mediated by the mitogenactivated protein kinase pathway. Proc. Natl. Acad. Sci. USA, 97, 1113–1118 (2000). 14. Mizuno, S., Tateishi, T., Ushida, T., and Glowacki, J.: Hydrostatic fluid pressure enhances matrix synthesis and accumulation by bovine chondrocytes in three-dimensional culture. J. Cell. Physiol., 193, 319–327 (2002). 15. Toyoda, T., Seedhom, B. B., Kirkham, J., and Bonass, W. A.: Upregulation of aggrecan and type II collagen mRNA expression in bovine chondrocytes by the application of hydrostatic pressure. Biorheology, 40, 79–85 (2003). 16. Aydelotte, M. B., Greenhill, R. R., and Kuettner, K. E.: Differences between sub-populations of cultured bovine articular chondrocytes. II. Proteoglycan metabolism. Connect Tissue Res., 18, 223–234 (1988).
NOTES
509
17. Buschmann, M. D., Gluzband, Y. A., Grodzinsky, A. J., Kimura, J. H., and Hunziker, E. B.: Chondrocytes in agarose culture synthesize a mechanically functional extracellular matrix. J. Orthop. Res., 10, 745–758 (1992). 18. Lee, D. A. and Bader, D. L.: Compressive strains at physiological frequencies influence the metabolism of chondrocytes seeded in agarose. J. Orthop. Res., 15, 181–188 (1997). 19. Lefebvre, V., Huang, W., Harley, V., Goodfellow, P., and de Crombrugghe, B.: SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol. Cell. Biol., 17, 2336–2346 (1997). 20. Sekiya, I., Tsuji, K., Koopman, P., Watanabe, H., Yamada, Y., Shinomiya, K., Nifuji, A., and Noda, M.: SOX9 enhances aggrecan gene promoter/enhancer activity and is upregulated by retinoic acid in a cartilage-derived cell line, TC6. J. Biol. Chem., 275, 10738–10744 (2000). 21. Mio, K., Kirkham, J., and Bonass, W. A.: Tips for extracting total RNA from chondrocytes cultured in agarose gel using a silica-based membrane kit. Anal. Biochem., 351, 314–316 (2006). 22. Applied Biosystems: Applied Biosystems Bulletin 2. Applied Biosystems, Foster City, CA (1997). 23. Christenson, L. K., Stouffer, R. L., and Strauss, J. F., 3rd.: Quantitative analysis of the hormone-induced hyperacetylation of histone H3 associated with the steroidogenic acute regulatory protein gene promoter. J. Biol. Chem., 276, 27392– 27399 (2001). 24. Bobick, B. E. and Kulyk, W. M.: MEK-ERK signaling plays diverse roles in the regulation of facial chondrogenesis. Exp. Cell Res., 312, 1079–1092 (2006). 25. Jiang, G.-L., White, C. R., Stevens, H. Y., and Frangos, J. A.: Temporal gradients in shear stimulate osteoblastic proliferation via ERK1/2 and retinoblastoma protein. Am. J. Physiol. Endocrinol. Metab., 283, E383–389 (2002). 26. Tsuda, Y., Okazaki, M., Uezono, Y., Osajima, A., Kato, H., Okuda, H., Oishi, Y., Yashiro, A., and Nakashima, Y.: Activation of extracellular signal-regulated kinases is essential for pressure-induced proliferation of vascular smooth muscle cells. Europ. J. Pharmacol., 446, 15–24 (2002). 27. Wong, M., Siegrist, M., and Goodwin, K.: Cyclic tensile strain and cyclic hydrostatic pressure differentially regulate expression of hypertrophic markers in primary chondrocytes. Bone, 33, 685–693 (2003). 28. Torzilli, P. A., Grigiene, R., Huang, C., Friedman, S. M., Doty, S. B., Boskey, A. L., and Lust, G.: Characterization of cartilage metabolic response to static and dynamic stress using a mechanical explant test system. J. Biomech., 30, 1–9 (1997). 29. Larsson, T., Aspden, R. M., and Heinegard, D.: Effects of mechanical load on cartilage matrix biosynthesis in vitro. Matrix, 11, 388–394 (1991). 30. Takahashi, I., Nuckolls, G. H., Takahashi, K., Tanaka, O., Semba, I., Dashner, R., Shum, L., and Slavkin, H. C.: Compressive force promotes sox9, type II collagen and aggrecan and inhibits IL-1beta expression resulting in chondrogenesis in mouse embryonic limb bud mesenchymal cells. J. Cell Sci., 111(Pt 14), 2067–2076 (1998).
© 2007, The Society for Biotechnology, Japan
Possible Role of Extracellular Signal-Regulated Kinase Pathway in Regulation of Sox9 mRNA Expression in Chondrocytes under Hydrostatic Pressure Kensuke Mio,1* Jennifer Kirkham,2 and William A. Bonass2 Academic Unit of Musculo-Skeletal and Rehabilitation Medicine, Bioengineering Division, University of Leeds, Leeds, LS2 9NZ, UK 1 and Department of Oral Biology, Leeds Dental Institute, University of Leeds, Leeds, LS2 9LU, UK 2 Received 28 May 2007/Accepted 2 September 2007
The potential involvement of the extracellular signal-regulated kinase (ERK) pathway in chondrocyte mechanotransduction was tested in bovine chondrocyte-agarose constructs under hydrostatic loading. Results suggested that the ERK pathway may be inhibited by hydrostatic pressureinduced mechanotransduction and may also be a negative regulator of Sox9 mRNA expression, which is an important modulator of chondrocyte function. [Key words: articular chondrocyte, agarose culture, hydrostatic pressure, mechanotransduction, extracellular signal-regulated kinase pathway, Sox9]
not yet been shown how the ERK pathway regulates Sox9 mRNA expression, the pathway consists of a series of cascade reactions resulting in activated ERK entering the nucleus and inducing changes in expression of a range of genes, possibly including Sox9. Sox9 is a transcriptional factor and a member of a family of proteins containing a DNA-binding domain. Sox9 activates enhancer segments of chondrocytespecific genes, such as Type II collagen and aggrecan (19, 20). Agarose-bovine chondrocyte constructs (total volume 0.44 ml) were prepared at a final concentration of 2 ×106 cells/ml in 1% agarose (type VII; Sigma-Aldrich, Poole, UK) (3, 4, 17, 18). These constructs were cultured in Dulbecco’s minimal essential medium (Sigma-Aldrich) containing 10% foetal bovine serum (Sigma-Aldrich) at 37°C under 5% CO2 in air. After 2 d of preculture, 5 Mp hydrostatic pressure was applied to the agarose-chondrocyte constructs for 4 h using a pressure application system as previously detailed by Toyoda et al. (4, 15). Where appropriate, an inhibitor of ERK phosphorylation, PD98059 (Tocris, Bristol, UK) was added 1 h prior to the pressure application at a concentration of 100 µM (shown to suppress ERK phosphorylation for up to 5 h in a preliminary study [data not shown]), remaining samples contained only vehicle (0.1% DMSO). An identical chamber placed in the same water bath was used for the control cells (no loading and without PD98059). At the end of the pressure application period, ERK phosphorylation was determined by Western blotting using a Mini-PROTEIN 3 Cell (Bio-Rad, Hemel Hempstead, UK) according to the manufacturer’s instructions. After electrophoresis, the proteins were transferred to nitrocellulose membranes (Bio-Rad). The blots were probed using a 1 : 1000 dilution of polyclonal antibodies (Cell Signalling Technology, Danvers, MA, USA) specific for either the phosphorylated or total ERK1/2. The
Chondrocytes require appropriate mechanical stress for maintenance of phenotype (1–4), suggesting a role for intracellular mechanotransduction pathways, possibly including those associated with mitogen-activated protein kinases (MAPKs), in cartilage homeostasis (5–10). MAPK pathways are a series of intracellular kinase cascade reactions that transduce a variety of external signals including growth factors, cytokines, viral infections, transforming agents, UV irradiation and heat shock and have been shown to be involved in a wide range of cellular responses (11, 12). The effects of mechanical stress on one of the MAPK pathways, the extracellular signal-regulated kinase pathway (ERK), have been reported in several kinds of cells (5–7). However, the precise role of the ERK pathway in maintenance of chondrocyte phenotype remains controversial and both positive and negative roles have been reported (5–10, 13). Hydrostatic pressure is thought to be one of the main mechanical stresses in articular joints and is considered to be an important factor for tissue homeostasis (4, 14, 15). We hypothesise that the ERK pathway participates in hydrostatic pressure-induced mechanotransduction in chondrocytes. To test the hypothesis, we investigated ERK activation in chondrocytes cultured in agarose gels under conditions of controlled application of hydrostatic pressure. The agarose culture system used here is ideally suited to studies of the effects of mechanical stress on chondrocytes (3, 4, 16–18). Expression of Sox9 mRNA, which plays a pivotal role in chondrocyte differentiation and maintenance of phenotype (19, 20), was determined as a possible downstream target of the pathway. There are an increasing number of reports showing the regulation of Sox9 mRNA expression through the ERK pathway (10, 13). Although it has * Corresponding author. e-mail: [email protected] phone: +81-(0)4-2995-1663 fax: +81-(0)4-2996-5208 506
VOL. 104, 2007
NOTES
507
TABLE 1. Primer sets used for PCR and sequence accession numbera Amplicon size ACGCCGAGCTCAGCAAGA CACGAACGGCCGCTTCT 71 Sox9 GAPDH CTAGGCTACACTGAGGACCAGGTT CCCAGCATCGAAGGTAGAAGAGT 75 Primer sets for Sox9 and GAPDH are referred from Wong et al. (27) and Mio et al. (3), respectively. a From NCBI Entrez. Target Gene
Sense Primer 5′ to 3′ sequence
Antisense Primer 5′ to 3′ sequence
blots were developed using the ExtraAvidin Alkaline Phosphatase Staining Kit (Sigma-Aldrich) and BCIP/NBT (Sigma-Aldrich) as per manufacturer’s instruction. The intensity of the bands was analyzed using Quantity One software (Bio-Rad). The intensity of the phosphorylated ERK bands of each sample was normalized relative to the intensity of the total ERK protein bands per lane. Total RNA was extracted from chondrocytes in agarose gels at the end of the loading period according to the method of Mio et al. (21). Total RNA (50 ng) was reverse transcribed (RT) to cDNA in 20 µl of reverse transcription reaction mixture using RETROscript (Ambion) according to the manufacturer’s instructions. One µl aliquot of RT product was then used for the polymerase chain reaction (PCR) in a 25 µl reaction mixture containing 1 × SensiMix (Quantace, London, UK), 1 × SYBR Green solution, and 200 nM of each primer (Table 1). The thermocycle included 1 cycle at 95°C for 10 min and 40 cycles at 95°C for 15 s, at 58°C for 20 s and at 72°C for 20 s, followed by a melting curve program (72– 95°C with a heating rate of 0.2°C per s). Melting curve analysis and agarose gel electrophoresis showed the presence of a single PCR product (data not shown). The relative differences among the groups were determined using the ∆∆ threshold cycle (Ct) method, as outlined in the Applied Biosystems protocol for RT-PCR (22, 23). All of the data were expressed as ratios to the mean values of the control group (without loading and without the addition of PD98059). Statistical analysis was carried out using Mann–Whitney test. P values less than 0.05 were considered significant. Results showed an inverse relationship between ERK phosphorylation and Sox9 expression after application of 5 Mp hydrostatic pressure for 4 h (Figs. 1 and 2). Quantification of the Western blot analysis showed a significant decrease (p < 0.001) in ERK phosphorylation down to 72.0% of controls (Fig. 1B) after loading. In contrast, analysis of Sox9 mRNA expression showed a significant increase (p = 0.038) of 278.0% compared to controls as a result of pressure application (Fig. 2). A similar effect was seen when the inhibitor of ERK phosphorylation, PD98059, was added in the absence of hydrostatic pressure. Without pressure application, PD98059 supplementation at 100 µM caused a significant decrease (p < 0.001) in ERK phosphorylation down to 47.5% (Fig. 1) and a significant increase (p = 0.008) in Sox9 mRNA expression to 331.3% compared to controls (Fig. 2). Taken together, these data suggest that the ERK pathway participates in hydrostatic pressure-induced mechanotransduction and may also be a negative regulator of Sox9 mRNA expression. The ERK pathway could therefore play a role in the maintenance of chondrocytic phenotype. Given that Sox9 protein has a pivotal role in chondrocyte differentiation, is required for chondrocyte development and also directly regulates expression of genes important for chondrocyte function,
Sequence accession no. AF278703 (partial coding sequence) U85042 (partial coding sequence)
such as Type II collagen and aggrecan (19, 20), a mechanotransduction system which regulates Sox9 mRNA expression would be expected to have an important role in cartilage homeostasis. Our results suggest that hydrostatic pressure may modulate the negative effect of the chondrocyte ERK pathway and contribute towards maintaining cell homeostasis by stimulating Sox9 mRNA expression. Toyoda et al. (4, 15) reported upregulation of Type II collagen and aggrecan mRNA expression after application of hydrostatic pressure for 4 h using the same pressure system as that described here. This suggests that Type II collagen and aggrecan are also regulated in part by the ERK pathway in chondrocytes. Although further research, including the influence of ERK inhibitor on the gene expression of Type II collagen and aggrecan, will be required to elucidate these relationships, we focussed upon Sox9 mRNA expression in this research as an initial step. Previous reports of the effects of mechanical
FIG. 1. Western blot analysis to determine relative amounts of total and phospho-ERK. (A) Representative blots following probing with antibodies to total ERK and phospho-ERK. Consistent levels of total ERK can be seen in each group. Phospho-ERK levels appear to be reduced after application of 5 MPa hydrostatic pressure compared to the control group. Addition of PD98059 (an inhibitor of ERK phosphorylation) also appeared to result in decreased ERK phosphorylation compared to the control group. (B) Graph showing the percentage of signal intensity of phospho-ERK compared to the corresponding total ERK normalised to the control mean. Bars represent the mean ±standard deviation (n = 18 in each treatment group) (Mann–Whitney test; NS, not significant).
508
J. BIOSCI. BIOENG.,
MIO ET AL.
FIG. 2. Expression of Sox9 mRNA by bovine articular chondrocytes in agarose culture. Graph showing the percentage of Sox9 mRNA expression relative to GAPDH mRNA normalised to the control mean. The bars represent the mean ± standard deviation. Sox9 mRNA expression increased under hydrostatic pressure in the absence of PD98059 compared to control. Sox9 expression also increased compared to controls in the presence of PD98059 (an inhibitor of ERK phosphorylation) (n=12 in each treatment group) (Mann–Whitney test; NS, not significant).
stress on the ERK pathway in several cell types have been equivocal, with both positive and negative effects being described (5–10, 13). Our results indicate that ERK may be a negative regulator for articular chondrocyte phenotype maintenance as demonstrated by the decrease in ERK phosphorylation accompanied by a concomitant increase in Sox9 mRNA expression. This result is compatible with that reported by Yoon et al. (9) and Hung et al. (5) who showed that phospho-ERK decreases type II collagen and aggrecan expression in articular chondrocytes. The ERK pathway also restricts chondrogenic differentiation in mesenchymal cells (8, 10). However, Murakami et al. (13) showed a positive role for phospho-ERK in mesenchymal cell differentiation along a chondrocytic lineage. Recently, Bobick et al. (24) reported that the role of the ERK pathway varies according to cell origin or growth stage. The ERK pathway acts as a negative regulator of chondrocyte differentiation in the frontonasal mesenchyme of stage 24/25 chick embryos but functions as a positive regulator in stage 24/25 mandibular arch mesenchyme as well as in frontonasal mesenchyme of stage 28/29 embryos. This differential effect according to cell origin or growth stage may help explain some of the apparent discrepancies regarding the role of ERK between previous reports. Our results of ERK inhibition as a consequence of application of hydrostatic pressure may seem to contradict previous reports which showed activation of ERK by mechanical stresses in various cell types (25, 26) including articular chondrocytes (5). However, Shiratsuchi et al. (7) showed pressure-induced inhibition of ERK in the human monocytic cell line, THP-1. Sawada et al. (6), using fibroblastic L-929 cells or human embryonic kidney-derived cells showed that different stresses elicit different responses in the ERK pathway in the same cells, as cell stretching activated the ERK pathway and cell contraction caused inactivation, suggesting that different physical forces may have opposite effects on ERK in these cells. Given that articular cartilage plays an important role in the transmission of mechanical forces, the chondrocyte (the only cell present in
the cartilage), may react elastically to different mechanical stresses to keep equilibrium with the surrounding environment and maintain homeostasis via mechanotransduction. Several studies have investigated the effects of mechanical stress on articular cartilage, with diverse results (3, 4, 15, 17, 18, 27). The mechanical stimulation schemes, the cell culture methods and the source of cartilage samples all differ among these studies and could well explain the discrepancies between the reports. The agarose culture system used in this study has previously been shown to maintain chondrocyte phenotype (as evidenced by Type II collagen and aggrecan expression [16]), and was therefore suitable for investigating the effects of mechanical stress on these cells (3, 4, 17, 18). Reports describing a decrease in matrix synthesis following mechanical compression or application of hydrostatic pressure (28, 29) appear to contradict our results. However, other studies are in line with our own (4, 14, 30). Toyoda et al. (4) showed increased proteoglycan synthesis under a statically applied hydrostatic pressure of 5 MPa for 4 h. They assumed that static hydrostatic pressure could be stimulatory to chondrocytes but only when applied for relatively short periods. The timing and level of the pressure signal is crucial and this may be one reason for the previously reported contradicting results. Further study will be required to determine the optimum loading conditions to stimulate chondrocyte metabolism. In summary, the ERK pathway may participate in hydrostatic pressure-induced mechanotransduction and may also be a negative regulator of Sox9 mRNA expression. Hydrostatic pressure may therefore modulate the negative effect of the ERK pathway in chondrocytes and contribute towards maintaining cell homeostasis by stimulating Sox9 mRNA expression. Hydrostatic pressure does not cause cellular deformation and investigation of the mechanism by which the chondrocytes sense the pressure change of the environment may be an interesting future target. These data will contribute towards a better understanding of mechanotransduction in chondrocytes and the role of application of mechanical stress in tissue engineering and cartilage repair. It may be also possible to apply optimised pressure for future therapeutic repair of damaged cartilage clinically. Furthermore, understanding the mechanotransduction pathway may lead to the development of drugs which can stimulate anabolic pathway or inhibit catabolic pathway in chondrocytes. We would like to thank Dr. Bahaa Seedhom (Academic Unit of Musculo-Skeletal and Rehabilitation Medicine, Bioengineering Division, University of Leeds) for excellent advice and support.
REFERENCES 1. Enneking, W. F. and Horowitz, M.: The intra-articular effects of immobilization on the human knee. J. Bone Joint Surg. Am., 54, 973–985 (1972). 2. Mooney, V. and Stills, M.: Continuous passive motion with joint fractures and infections. Orthop. Clin. North Am., 18, 1–9 (1987). 3. Mio, K., Saito, S., Tomatsu, T., and Toyama, Y.: Intermittent compressive strain may reduce aggrecanase expression in cartilage: a study of chondrocytes in agarose gel. Clin. Orthop. Relat. Res., 433, 225–232 (2005).
VOL. 104, 2007
4. Toyoda, T., Seedhom, B. B., Yao, J. Q., Kirkham, J., Brookes, S., and Bonass, W. A.: Hydrostatic pressure modulates proteoglycan metabolism in chondrocytes seeded in agarose. Arthritis Rheum., 48, 2865–2872 (2003). 5. Hung, C. T., Henshaw, D. R., Wang, C. C., Mauck, R. L., Raia, F., Palmer, G., Chao, P. H., Mow, V. C., Ratcliffe, A., and Valhmu, W. B.: Mitogen-activated protein kinase signaling in bovine articular chondrocytes in response to fluid flow does not require calcium mobilization. J. Biomech., 33, 73– 80 (2000). 6. Sawada, Y., Nakamura, K., Doi, K., Takeda, K., Tobiume, K., Saitoh, M., Morita, K., Komuro, I., De Vos, K., Sheetz, M., and Ichijo, H.: Rap1 is involved in cell stretching modulation of p38 but not ERK or JNK MAP kinase. J. Cell Sci., 114, 1221–1227 (2001). 7. Shiratsuchi, H. and Basson, M. D.: Extracellular pressure stimulates macrophage phagocytosis by inhibiting a pathway involving FAK and ERK. Am. J. Physiol. Cell Physiol., 286, C1358–1366 (2004). 8. Bobick, B. E. and Kulyk, W. M.: The MEK-ERK signaling pathway is a negative regulator of cartilage-specific gene expression in embryonic limb mesenchyme. J. Biol. Chem., 279, 4588–4595 (2004). 9. Yoon, Y. M., Kim, S. J., Oh, C. D., Ju, J. W., Song, W. K., Yoo, Y. J., Huh, T. L., and Chun, J. S.: Maintenance of differentiated phenotype of articular chondrocytes by protein kinase C and extracellular signal-regulated protein kinase. J. Biol. Chem., 277, 8412–8420 (2002). 10. Zakany, R., Szijgyarto, Z., Matta, C., Juhasz, T., Csortos, C., Szucs, K., Czifra, G., Biro, T., Modis, L., and Gergely, P.: Hydrogen peroxide inhibits formation of cartilage in chicken micromass cultures and decreases the activity of calcineurin: implication of ERK1/2 and Sox9 pathways. Exp. Cell Res., 305, 190–199 (2005). 11. Schaeffer, H. J. and Weber, M. J.: Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol. Cell. Biol., 19, 2435–2444 (1999). 12. Johnson, G. L. and Lapadat, R.: Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science., 298, 1911–1912 (2002). 13. Murakami, S., Kan, M., McKeehan, W. L., and de Crombrugghe, B.: Up-regulation of the chondrogenic Sox9 gene by fibroblast growth factors is mediated by the mitogenactivated protein kinase pathway. Proc. Natl. Acad. Sci. USA, 97, 1113–1118 (2000). 14. Mizuno, S., Tateishi, T., Ushida, T., and Glowacki, J.: Hydrostatic fluid pressure enhances matrix synthesis and accumulation by bovine chondrocytes in three-dimensional culture. J. Cell. Physiol., 193, 319–327 (2002). 15. Toyoda, T., Seedhom, B. B., Kirkham, J., and Bonass, W. A.: Upregulation of aggrecan and type II collagen mRNA expression in bovine chondrocytes by the application of hydrostatic pressure. Biorheology, 40, 79–85 (2003). 16. Aydelotte, M. B., Greenhill, R. R., and Kuettner, K. E.: Differences between sub-populations of cultured bovine articular chondrocytes. II. Proteoglycan metabolism. Connect Tissue Res., 18, 223–234 (1988).
NOTES
509
17. Buschmann, M. D., Gluzband, Y. A., Grodzinsky, A. J., Kimura, J. H., and Hunziker, E. B.: Chondrocytes in agarose culture synthesize a mechanically functional extracellular matrix. J. Orthop. Res., 10, 745–758 (1992). 18. Lee, D. A. and Bader, D. L.: Compressive strains at physiological frequencies influence the metabolism of chondrocytes seeded in agarose. J. Orthop. Res., 15, 181–188 (1997). 19. Lefebvre, V., Huang, W., Harley, V., Goodfellow, P., and de Crombrugghe, B.: SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol. Cell. Biol., 17, 2336–2346 (1997). 20. Sekiya, I., Tsuji, K., Koopman, P., Watanabe, H., Yamada, Y., Shinomiya, K., Nifuji, A., and Noda, M.: SOX9 enhances aggrecan gene promoter/enhancer activity and is upregulated by retinoic acid in a cartilage-derived cell line, TC6. J. Biol. Chem., 275, 10738–10744 (2000). 21. Mio, K., Kirkham, J., and Bonass, W. A.: Tips for extracting total RNA from chondrocytes cultured in agarose gel using a silica-based membrane kit. Anal. Biochem., 351, 314–316 (2006). 22. Applied Biosystems: Applied Biosystems Bulletin 2. Applied Biosystems, Foster City, CA (1997). 23. Christenson, L. K., Stouffer, R. L., and Strauss, J. F., 3rd.: Quantitative analysis of the hormone-induced hyperacetylation of histone H3 associated with the steroidogenic acute regulatory protein gene promoter. J. Biol. Chem., 276, 27392– 27399 (2001). 24. Bobick, B. E. and Kulyk, W. M.: MEK-ERK signaling plays diverse roles in the regulation of facial chondrogenesis. Exp. Cell Res., 312, 1079–1092 (2006). 25. Jiang, G.-L., White, C. R., Stevens, H. Y., and Frangos, J. A.: Temporal gradients in shear stimulate osteoblastic proliferation via ERK1/2 and retinoblastoma protein. Am. J. Physiol. Endocrinol. Metab., 283, E383–389 (2002). 26. Tsuda, Y., Okazaki, M., Uezono, Y., Osajima, A., Kato, H., Okuda, H., Oishi, Y., Yashiro, A., and Nakashima, Y.: Activation of extracellular signal-regulated kinases is essential for pressure-induced proliferation of vascular smooth muscle cells. Europ. J. Pharmacol., 446, 15–24 (2002). 27. Wong, M., Siegrist, M., and Goodwin, K.: Cyclic tensile strain and cyclic hydrostatic pressure differentially regulate expression of hypertrophic markers in primary chondrocytes. Bone, 33, 685–693 (2003). 28. Torzilli, P. A., Grigiene, R., Huang, C., Friedman, S. M., Doty, S. B., Boskey, A. L., and Lust, G.: Characterization of cartilage metabolic response to static and dynamic stress using a mechanical explant test system. J. Biomech., 30, 1–9 (1997). 29. Larsson, T., Aspden, R. M., and Heinegard, D.: Effects of mechanical load on cartilage matrix biosynthesis in vitro. Matrix, 11, 388–394 (1991). 30. Takahashi, I., Nuckolls, G. H., Takahashi, K., Tanaka, O., Semba, I., Dashner, R., Shum, L., and Slavkin, H. C.: Compressive force promotes sox9, type II collagen and aggrecan and inhibits IL-1beta expression resulting in chondrogenesis in mouse embryonic limb bud mesenchymal cells. J. Cell Sci., 111(Pt 14), 2067–2076 (1998).