Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP)

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 Nitric Oxide xxx (2013) xxx–xxx 1

Contents lists available at SciVerse ScienceDirect

Nitric Oxide journal homepage: www.elsevier.com/locate/yniox 6 7

Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP)

3 4 5 8 9 10 11 12 1 6 4 2 15 16 17 18 19 20 21 22 23 24 25

Q1

Ingrid Casper 1, Sebastian Nowag 1, Kathrin Koch, Thomas Hubrich, Franziska Bollmann, Jenny Henke, Katja Schmitz, Hartmut Kleinert ⇑,2, Andrea Pautz ⇑,2 Department of Pharmacology, University Medical Center of the Johannes Gutenberg University Mainz, D 55101 Mainz, Germany

a r t i c l e

i n f o

Article history: Received 24 October 2012 Revised 14 May 2013 Available online xxxx Keywords: iNOS PABP UTR mRNA stability siRNA

a b s t r a c t Affinity purification using the 30 -untranslated region (30 -UTR) of the human inducible nitric oxide synthase (iNOS) mRNA identified the cytosolic poly(A)-binding protein (PABP) as a protein interacting with the human iNOS 30 -UTR. Downregulation of PABP expression by RNA interference resulted in a marked reduction of cytokine-induced iNOS mRNA expression without changes in the expression of mRNAs coding for the major subunit of the RNA polymerase II (Pol 2A) or b2-microglobuline (b2M). Along with the mRNA also iNOS protein expression was reduced by siPABP-treatment, whereas in the same cells protein expression of STAT-1a, NF-jB p65, or GAPDH was not altered. Reporter gene analyses showed no change of the inducibility of the human 16 kb iNOS promoter in siPABP cells. In contrast, the siPABP-mediated decline of iNOS expression correlated with a reduction in the stability of the iNOS mRNA. As the stability of the Pol 2A and b2M mRNA was not changed, siPABP-treatment seems to have a specific effect on iNOS mRNA decay. UV-crosslinking experiments revealed that PABP interacts with one binding site in the 50 -UTR and two different binding sites in the 30 -UTR of the human iNOS mRNA. Mutation or deletion of the binding site in the 50 -UTR but not in the 30 -UTR reduced luciferase expression in DLD-1 cells transfected with iNOS-50 -UTR or iNOS-30 -UTR luciferase reporter constructs. In summary, our data demonstrate that PABP by binding to specific sequence elements in the 50 -UTR post-transcriptionally enhances human iNOS mRNA stability and thereby iNOS expression. Ó 2013 Published by Elsevier Inc.

27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

46

Abbreviations: 30 -UTR, 30 -untranslated region; 50 -UTR, 50 -untranslated region; AUF1, AU-rich element RNA binding protein 1; ARE, AU-rich element; ARE-BP, ARE binding protein; b2M, b2-microglobulin; b-tub., b-tubulin; cds, coding sequence; CM, cytokine mixture; Co, control cells; DRB, 6-dichloro-1-ribofuranosylbenzimidazole; EGFP, enhanced green fluorescence protein; ELAV, embryonic lethal abnormal vision; eRF3, eukaryotic release factor 3; FACS, fluorescent activated cell sorting; GST, glutathione S-transferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hnRNP, heteronuclear ribonucleoprotein; HuR, human antigen R; IFN-c, interferon-c; IL-1b, interleukin-1b; IP, immunoprecipitation; KSRP, KH-type splicing regulatory protein; Luc, luciferase; NO, nitric oxide; iNOS, inducible NOsynthase; PABP, poly(A)binding protein; Pol 2A, RNA polymerase II great subunit; qRT-PCR, quantitative reverse transcription polymerase chain reaction; siRNA, small interfering RNA; shRNA, small hairpin RNA; TNF-a, tumor necrosis factor-a; TTP, tristetraprolin; WB, Western blot; YB-1, Y box factor-1. ⇑ Corresponding authors. Address: Department of Pharmacology, University Medical Center of the Johannes Gutenberg University, Obere Zahlbacher Str. 67, D55101 Mainz, Germany. Fax: +49 (6131) 179042. E-mail addresses: [email protected] (H. Kleinert), [email protected] (A. Pautz). 1 These authors contributed equally to this work. 2 These authors share the correspondence authorship.

Introduction

47

The high amounts of nitric oxide (NO) produced by the inducible isoform of nitric oxide synthase (iNOS) have beneficial microbicidal, antiviral, antiparasital and antitumoral effects [1]. Aberrant iNOS induction is critically involved in the pathophysiology of multiple human diseases such as asthma, arthritis, colitis, tumor development, transplant rejection or septic shock [2]. The induction of iNOS expression in human cells needs a complex cytokine mixture including interferon-c (IFN-c), interleukin1b (IL-1b), and tumor necrosis factor-a (TNF-a) [3]. Activation of the mitogen activated protein kinase (MAPK) pathways (p42/44 MAPK, p38MAPK, JNK), the janus kinase 2-signal transducer, and activator of transcription-1a (JAK2-STAT-1a) pathway and the nuclear factor-jB (NF-jB) pathway are important for iNOS expression [3]. In human DLD-1, A549, or AKN cells, all known to be inducible for iNOS expression [3], no basal iNOS mRNA could be detected, whereas cytokine induction resulted in a marked expression (over 50-fold) of iNOS mRNA. In contrast, nuclear run-on experiments

48

1089-8603/$ - see front matter Ó 2013 Published by Elsevier Inc. http://dx.doi.org/10.1016/j.niox.2013.05.002

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 2 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131

I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

demonstrated a significant basal activity of the promoter in these cells that was only induced 2–5-fold by cytokines [4]. Additionally, the activity of a 16 kb human iNOS promoter fragment was not altered by p38MAPK-inhibition, whereas iNOS mRNA expression was blocked [5]. These data indicate the importance of post-transcriptional mechanisms for the regulation of human iNOS expression. In transfection experiments with human A549 or DLD-1 cells, the 30 -UTR of the human iNOS mRNA destabilized the mRNA of a luciferase reporter gene [4]. Sequence analyses revealed five AUsequence motifs (AUUUA or AUUUUA) in this 30 -UTR. Such AU-rich elements (ARE) have been shown to be binding sites of different ARE binding proteins (ARE-BPs, like AUF1, HuR, KSRP or TTP, see below). Further they mediate destabilization of mRNAs coding for pro-inflammatory proteins or oncogenes [6]. In the last years several RNA-binding proteins (RNA-BP, see below) and the miRNA-939 [7] have been shown to be involved in the post-transcriptional regulation of human iNOS expression. As shown by IP-qRT-PCR experiments cytokine induction resulted in enhanced intra-cellular binding of HuR to the iNOS mRNA and thus leads to iNOS mRNA stabilization [8]. By affinity purification Linker et al. isolated the KH-type splicing regulatory protein (KSRP) as a human iNOS 30 -UTR binding protein. Modulation of KSRP expression changed cytokine-induced iNOS expression in human A549 and DLD-1 cells. We provide evidence that KSRP has an important destabilizing effect on human iNOS mRNA expression [8]. The zincfinger protein tristetraprolin (TTP) does not bind to human iNOS 30 UTR but regulates iNOS mRNA expression indirect via an interaction with KSRP. Cytokine induction enhanced TTP-KSRP interaction and this resulted in reduced intracellular binding of KSRP to the human iNOS mRNA (as shown by IP-qRT-PCR). This in turn enables enhanced binding of HuR to iNOS 30 -UTR and this increases iNOS mRNA stability and iNOS protein expression [8]. In addition to HuR, KSRP, and TTP the RNA-BP PTB augments human iNOS expression by enhancement of iNOS mRNA-stability [9], whereas all four isoforms of the ARE/poly(U)-binding/degradation factor 1 (AUF1) negatively regulate human iNOS expression by destabilization of the mRNA [10]. The prototypical member of the family of poly(A)-binding proteins is the cytosolic poly(A)-BP (PABPC1, PABP1, referred to PABP in this manuscript), a multifunctional protein with multiple roles in mRNA translation, -stability, and miRNA-mediated gene regulation [11,12]. In addition to PAPB, vertebrates express other cytosolic poly(A)-BPs (PABP4, ePABP, tPABP and PABP5) [12]. Besides cytosolic poly(A)-BPs there is an evolutionarily conserved nuclear poly(A)-BP (PABPN1) with essential roles in mRNA polyadenylation [13]. ePABP2 is structurally related to nuclear PABP (PABPN1) but it is predominantly localized in the cytoplasm in vertebrates [14]. Although initiation of translation occurs at the 50 -end of the mRNA, it is stimulated by PABP bound to the 30 -poly(A) tail [12]. PABP interacts with several important regulatory translation factors bound to the 50 -UTR, (e.g. eIF4G, eIF4B, DDX3) and thereby it modulates the initiation of translation [15–17]. These interactions result in a close proximity of both mRNA ends [12]. Additionally, PABP has been shown to increase 60S joining [18] and also interacts with the termination factor eRF3 [19]. This interaction is important in translational termination [20], but may also aid the recycling of ribosomal subunits for subsequent rounds of initiation. In addition the PABP/eRF3 interaction has been described to weaken the binding of PABP to the poly(A) tail and thereby to enhance the shortening of the poly(A) tail resulting in decreased mRNA stability [21]. As an initiation factor PABP plays a global role in the translation of all polyadenylated mRNAs. In addition it also influences the translation of specific mRNAs. As shown for the regulation of YB-1 or insulin expression, PABP can promote translation by

binding to internal poly(A) stretches in the 30 -UTR of the YB-1 mRNA [22] or to the 50 -UTR of the insulin mRNA [23]. Conversely, PABP mediates translational repression by binding to an A-rich segment in the 50 -UTR of its own mRNA resulting in an reduction of PABP expression [11]. PABP participates in general mRNA turnover and stability [11,12]. Removal of the poly(A)-tail is the initial step in many mRNA-turnover pathways and PABP-mediated end-to-end initiation complexes generally protect the poly(A)-tail from deadenylases and block decapping. PABP also covers mRNA-specific roles in stability and turnover, including the regulation of microRNAbound mRNAs [24] and translationally coupled turnover of c-fos mRNA [25]. Recent data show that miRNA dependent translational repression or mRNA degradation depends on the interaction of PABP with GW182 proteins which are central components of the miRNA silencing complexes in animals [26–28]. In addition to binding to the poly(A)-tail PABP binds specifically to AU-rich sequences (in the 50 - or 30 -UTR) of mRNAs (b-casein-, MKK2-, PABP- or osk-mRNA) and thereby regulates mRNA translation and stability [29–33]. Interestingly, depending on the cell type analyzed, autoregulation of PABP expression includes destabilization of the PABP mRNA [34]. In our current study we identified PABP as another important RNA-BP interacting with the 50 - and 30 -UTR of human iNOS mRNA. Downregulation of PABP expression by siRNA reduced cytokine-induced iNOS expression in human DLD-1 cells by destabilization of the iNOS mRNA without changing the inducibility of the human iNOS promoter.

132

Materials and methods

160

Materials

161

Materials are described in supplementary data.

133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159

162

Plasmid constructs

163

Plasmid constructs are described in detail in supplementary data.

164

Cell culture, cytokine treatment and RNA isolation

166

Human epithelial colon carcinoma DLD-1 cells (ATCC, #CCL221) were used for this study. These cells have been demonstrated to be inducible for human iNOS expression by incubation with cytokines [35]. The cells were grown in DMEM with 10% inactivated fetal bovine serum, 2 mM L-glutamine, penicillin and streptomycin. Sixteen hours before cytokine induction, the cells were washed with PBS and incubated with DMEM containing 2 mM L-glutamine in the absence of serum and phenol red. iNOS expression in DLD-1 cells was induced using a cytokine mixture (CM) containing IFN-c (100 U/ml), IL-1b (50 U/ml) and TNF-a (10 ng/ ml) for different time periods depending on the experiment. Supernatant of the cells (500 ll) was used to measure NO 2 by the Sievers Nitric Oxide Analyzer (ADInstruments, Spechbach, Germany) and cells were processed for RNA isolation by guanidinium thiocyanate/phenol/chloroform extraction as described [36,37] or for protein extraction as described below.

167

Quantitative reverse transcription / polymerase chain reaction (qRTPCR)

183

Gene expression was quantified in a two-step qRT-PCR as described before [38]. The oligonucleotides listed below served as

185

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

165

168 169 170 171 172 173 174 175 176 177 178 179 180 181 182

184

186

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx 187 188 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228

sense and antisense primers as well as Taqman hybridization probes. iNOS Sense Antisense Probe

50 -TGCAGACACGTGCGTTACTCC-30 50 -GGTAGCCAGCATAGCGGATG-30 50 -TGGCAAGCACGACTTCCGGGTG-30

PABP Sense Antisense Probe

50 -GCTCAGGGTGCCAGACCTC-30 50 -GGAGCAGCTGGGCGG-30 50 -TCCATTCCAAAATATGCCCGGTGCTA-30

Pol 2A Sense Antisense Probe

5 -GCACCACGTCCAATGACAT-3 50 -GTGCGGCTGCTTCCATAA-30 50 -TACCACGTCATCTCCTTTGATGGCTCCTAT-30

GAPDH Sense Antisense Probe

50 -CCCATGTTCGTCATGGGTGT-30 50 -TGGTCATGAGTCCTTCCACGATA-30 50 -CTGCACCACCAACTGCTTAGCACCC-30

b2M Sense Antisense Probe

0

0

50 -AGCGTACTCCAAAGATTCAGGTT-30 50 -ATGATGCTGCTTACATGTCTCGAT-30 50 -TCCATCCGACATTGAAGTTGACTTACTG-30

229

236

To calculate the relative expression of iNOS-, Pol 2A-, b2M- or PABP mRNA in DLD-1 cells the 2(DDC(T)) method [39] was used. According to this method the C(T) values for iNOS-, Pol 2A-, b2Mor PABP mRNA expression in each sample were normalized to the C(T) values of GAPDH-mRNA in the same sample. Then the values of the CM-treated cell samples were set 100% and the percentage of iNOS-, Pol 2A-, b2M-or PABP mRNA expression was calculated.

237

Western blot experiments

238

247

To study the expression of GAPDH, PABP, iNOS, NF-jB, p38MAPK, STAT-1a or for normalization b-tubulin protein in DLD-1 cells total cellular protein (10–50 lg protein) was separated on SDS polyacrylamide gels and transferred to nitrocellulose membranes by semi-dry electroblotting. All further steps were performed as described previously [4]. For detection of iNOS, PABP, GAPDH, STAT-1a, NF-jB p65 and b-tubulin the antibodies listed in Materials and methods were used. The immunoreactive proteins on the blots were visualized by the enhanced chemiluminescence detection system (ECL, PerkinElmer, Rodgau, Germany).

248

Streptavidin-biotin RNA-affinity chromatography/pull-down assays

249

257

To generate biotinylated RNA sense probes (without a poly(A) tail) for the affinity purification (pull-down) 1 lg of the linearized plasmids pCR-iNOS-30 -UTR [4], pCR-iNOS-30 -UTR-non-AU [4], pCRiNOS-50 -UTR, pCR-iNOS-50 -UTR-delPABP, pCR-iNOS-30 -UTR-fragA, pCR-iNOS-30 -UTR-mut-fragA, and pCR-iNOS-30 -UTR-fragB and pCR-iNOS-30 -UTR-mut-fragB were in-vitro transcribed using the biotin RNA labeling mix (Roche Diagnostics, Mannheim, Germany) as described by the manufacturer. Purification and identification of the proteins were performed as described before [8].

258

Purification of GST or GST-PABP proteins

259

To generate a plasmid for bacterial expression of a GST-PABP fusion protein the plasmid pFLAG-PABP [34] was used as template for a PCR reaction using the oligonucleotides GST-FLAG-PABP-5P (CCGGATCCGACTACAAAGACGA-TGACGACAAG; BamH1 site under-

230 231 232 233 234 235

239 240 241 242 243 244 245 246

250 251 252 253 254 255 256

260 261 262

3

lined) and GST-FLAG-PABP-3P (CCGGATCCTCTAGAG-TCGACTGGTACCGATATTTAAG; BamHI site underlined) as primers for the reaction. The resulting PCR fragment was cloned into pGEX2T. The DNA sequence of pGEX2T-PABP was controlled using the dideoxy chain termination method (Genterprise, Mainz, Germany). Purified GST or GST-PABP-fusion proteins were prepared using the plasmids pGEX2T or pGEX2T-PABP as described [4].

263

UV-crosslinking experiments

270

To generate radiolabeled 50 -UTR-, cds- or 30 -UTR sequence probes (without a poly(A) tail) for RNA binding experiments 0.5– 1 lg of DNA (linearized pCR-constructs described above) were invitro transcribed as described before in the presence of aP32-UTP [5,40]. Radiolabeled transcripts were analyzed by urea-denaturing electrophoresis in order to estimate the yield and the specific activity. Incorporated radioactivity in transcripts was usually higher than 80% and the specific activity ranged from 0.2–0.5 lCi/pmol. UV-crosslinking experiments were performed as described [5,40].

271

Establishment of cell lines expressing anti-PABP shRNAs

280

To generate plasmids enabling the intracellular expression of shRNAs against PABP and luciferase as control the plasmid pTEREGFP [41] was digested with Bgl II and Hind III. Into this vector double stranded oligonucleotides with matching 50 -protruding ends were ligated generating the plasmids pTER-EGFP-shPABP or pTER-EGFP-shLuc. The following oligonucleotides were used:

281

shPABP

264 265 266 267 268 269

272 273 274 275 276 277 278 279

282 283 284 285 286

GATCCCCCCGCACCGTTCCACAGTATAACTCTAGAG ATTATACTGTGGAACGGTGCGGTTTTTGGAAAAGCT

shLuc

GATCCCCCGTACGCGGAATACTTCGATTCTAGAGATCGA AGTATTCCGCGTACGTTTTTGGAAAAGCT

(protruding ends are underlined; siRNA sequences are bold) DNA sequences of all clones were controlled using the dideoxy chain termination method (Genterprise, Mainz, Germany). To generate DLD-1 cells expressing the shPABP or shLuc RNAs, cells plated on a 10 cm plate were transfected with 5 lg of pTEREGFP-shPABP or pTER-EGFP-shLuc with GeneJuice according to the manufacturer’s recommendations. As control DLD-1 cells stably transfected with pTER-EGFP were generated also. Pools of stable transfectants from one plate (usually >30) were selected with Zeocin (0.2 mg/ml). As the pTER-EGFP constructs code for an EGFP protein the Zeocin-resistant cell pools were selected for EGFP expression by fluorescence activated cell sorting.

287

Analysis of human iNOS promoter activity in stably transfected cells

299

In order to investigate the effect of the siRNA-mediated downregulation of PABP on cytokine-induced iNOS promoter activity, DLD-1-pTER-EGFP-shPABP- or DLD-1-pTER-EGFP-cells were transiently transfected with pNOS2(16)Luc [42] (containing a 16 kb fragment of the human iNOS promoter cloned in front of a firefly luciferase reporter gene) by lipofection with GeneJuice according to the manufacturer’s recommendations. All further steps were performed as described [9].

300

Effects of mutation or deletion of the putative PABP binding sites on luciferase activity and -mRNA expression

308

In order to investigate the effects of mutation or deletion of putative PABP binding sites in the 50 -UTR or 30 -UTR of the human

310

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

288 289 290 291 292 293 294 295 296 297 298

301 302 303 304 305 306 307

309

311

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 4 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337

I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

iNOS mRNA on luciferase activity, DLD-1 cells were transiently transfected with either pGL3-control-iNOS-50 -UTR, pGL3-controliNOS-50 -UTR-mutPABP, pGL3-control-iNOS-50 -UTR-delPABP, 0 pGL3-control-iNOS-3 -UTR, pGL3-control-iNOS-30 -UTR-mutA, pGL3-control-iNOS-30 -UTR-mutB, and pEF-1a-RL (for normalization) by lipofection with GeneJuice according to the manufacturer’s recommendations. All further steps were performed as described [9]. To analyze the effects of mutation or deletion of the PABP binding site in exon 2 of the human iNOS mRNA on luciferase mRNA expression DLD-1 cells were transiently transfected with the constructs pcDNA4/TO-Ex1-In1-Ex-Luc, pcDNA4/TO-Ex1-In1-Ex2mutPABP-Luc, pcDNA4/TO-Ex1-In1-Ex2-delPABP-luc, and pRHCglo ([43], normalization for RNA analyses) or pEF-1a-RL (normalization for luciferase activity). Integration of the intron 1 of the human iNOS gene in pcDNA4/TO-Ex1-In1-Ex2-luc enables a clear discrimination between the transfected DNA and the mRNA transcribed from these plasmids by qRT-PCR assays (see Fig. S4). After transfection cells were treated with or without CM as described above. For determination of luciferase and renilla activity protein extracts were prepared as mentioned before. For analysis of luciferase- and RHCglo-mRNA RNA was isolated and mRNA expression was determined by qRT-PCR as described [10] using the oligonucleotide listed below. To discriminate between transfected DNA and mRNA expressed from the plasmid constructs we designed oligonucleotides which detected the mRNA only (see Fig. S4).

339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354

Luciferase (in pcDNA4/TO-Ex1-In1-Ex2-luc-constructs) Ex1-luc-sense 50 -CACAGGTCTCTTCCTGGTTTG-30 Ex1-luc-antisense 50 -TCTTCCAGCGGATAGAATGG-30 Ex1-luc probe 50 -CAGCTGCAAGCCCCACAGTGAAG-30 RHCglobin RHCglo-sense RHCglo-antisense RHCglo-probe

50 -CATTCACCACATTGGTGTGC-30 50 -GGAACCTACAAGATTGCTGGAG-30 50 -AGCTCCGGACTCGGGATCCATCTAC-30

355 356 357 358 359 360 361 362 363

To calculate the relative expression of the luciferase mRNA in the transfected DLD-1 cells the 2(DDC(T)) method [39] was used. The C(T) values for the luciferase mRNA expression in each sample were normalized to the C(T) values of the RHCglo-mRNA in the same sample. Then the values of the cells treated with the wildtype Ex1-In1-Ex2 construct (each Co or CM) were set 100% and the percentage of luciferase mRNA expression in Ex1_In1_Ex2-mutPABP or -delPABP treated cells were calculated.

364

DRB experiments

365

376

To examine the influence of siPABP on iNOS mRNA stability, DLD-1-pTER-EGFP-siPABP or DLD-1-pTER-EGFP-siLuc cells were incubated as indicated, and iNOS expression was induced by cytokines for 4 h. Then 25 lg/ml 6-dichloro-1-ribofuranosylbenzimidazole (DRB, Sigma) was added, and RNAs were prepared 0, 2, 4, and 6 h thereafter. Relative iNOS-, b2M-, Pol 2A-, and GAPDH mRNA amounts were determined by qRT-PCR. iNOS-, Pol 2A-, and b2M mRNA was normalized to GAPDH mRNA. The relative amount of iNOS-, Pol 2A- or b2M mRNA at 0h DRB was set at 100%. Curve fittings of the resulting DRB time curves were performed by non-linear regression using Graph-Pad Prism 5.0d (GraphPad Software, San Diego, CA).

377

Statistics

378

Data represent means ± SEM. Statistical differences were determined by factorial analysis of variance followed by ‘‘Tukey’s’’ or

366 367 368 369 370 371 372 373 374 375

379

‘‘Dunnett’s’’ multiple comparison test. In the case of two means classical t-test analyses were used. All statistical analyses were performed using Graphpad Prism 5.0d.

380

Results

383

Purification and identification of iNOS 30 -UTR-RNA-binding proteins

384

In order to purify proteins binding to the 30 -UTR of the human iNOS mRNA we performed affinity chromatographies using in-vitro transcribed, biotinylated iNOS 30 -UTR-RNA without a poly(A) tail, with or without the AU-rich sequences and extracts from cytokine-induced DLD-1 cells [8,31,44]. After several washing steps the RNA-binding proteins were eluted by incubation with 2 M KCl, separated on SDS polyacrylamide gels and identified by peptide mass fingerprinting (Toplab, München, Germany). This analysis resulted in the identification of KSRP, PABP and hnRNP E1 as proteins interacting with the human iNOS mRNA 30 -UTR (see supplemental Fig. S1).

385

Downregulation of PABP expression reduces cytokine-induced iNOS expression

396

To analyze the effects of PABP on iNOS expression, we used the RNA interference technique to downregulate PABP expression. Therefore, we established DLD-1 cells expressing intracellular shRNAs directed against the PABP coding region (siPABP). As a control, we also generated stably transfected DLD-1 cells expressing shRNAs against the GL2-luciferase coding region (siLuc). Both cell lines were pretreated with medium without FCS for 16h and further incubated in the presence or absence of the cytokine mixture (CM) for 6h. Then PABP-, iNOS-, GAPDH-, Pol 2A-, and b2M mRNA expression were measured by qRT-PCR. For analysis of protein expression Western blots using specific antibodies were performed. Additionally, the iNOS-related NO-production in these cells was analyzed by the Sievers NO-analyzer. We detected reduced PABP mRNA (Fig. S2A)- and protein expression (Fig. 1A), in DLD-1 cells stably transfected with pTEREGFP-shPABP (siPABP) compared to cells transfected with pTER-EGFP-shLuc (siLuc). In the same RNA samples iNOS mRNA (Fig. 1B) expression was significantly downregulated in siPABP cells compared to control cells. In contrast, Pol 2A – (Fig. S2B) and b2M – (Fig. S2C), mRNA expression was not changed by the shRNA-mediated downregulation of PABP. Analyses of protein expression in extracts from these cells showed that iNOS protein was also reduced in DLD-1-pTEREGFP-shPABP (siPABP) cells compared to DLD-1-pTER-EGFP-shLuc (siLuc) cells (see Fig. 1C). Western blot analyses with the same extracts revealed that the protein expression of STAT-1a NF-jB p65and GAPDH remained unchanged (see Fig. 1D). Finally, as shown in Fig. S3 downregulation of PABP expression resulted in a significant reduction of iNOS-related NO-production. These data imply that PABP is specifically involved in the posttranscriptional regulation of human iNOS expression

398

Downregulation of PABP expression does not change cytokinedependent induction of the human iNOS promoter

429

To analyze the effects of PABP on human iNOS promoter activity, DLD-1-pTER-EGFP-shPABP- or DLD-1-pTER-EGFP cells were transiently transfected with pNOS2(16)Luc [42], a plasmid containing a 16 kb fragment of the human iNOS promoter cloned in front of a luciferase reporter gene. 48h after transfection cells were incubated for 16 h with medium without FCS. Afterwards the cells were treated with CM for 6 h. Then cells were lyzed and the lucif-

431

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

381 382

386 387 388 389 390 391 392 393 394 395

397

399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428

430

432 433 434 435 436 437

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

5

Fig. 1. Downregulation of PABP expression resulted in reduced iNOS mRNA and protein expression but did not change the protein expression of STAT-1a NF-jB or GAPDH. DLD-1 cells stably transfected with the constructs pTER-EGFP-shPABP (siPABP) or pTER-EGFP-shLuc (control, siLuc) were preincubated for 16 h in medium without FCS and phenol red. Then the cells were incubated with a cytokine mixture (CM) or without (Co) for 6 h (RNA) or 8 h (protein). iNOS- and GAPDH (normalization) mRNA expression was determined by qRT-PCR. iNOS, PABP-, STAT-1a, NF-jB p65-, GAPDH-, and b-tubulin protein expression was analyzed by Western blots using specific antibodies. bTubulin protein expression was used for normalization. Panel A: Western blot using specific anti-PABP- and anti-b-tubulin antibodies with extracts from the stable transfected DLD-1 cell pools. The blot is representative for four other blots showing similar results. The positions of PABP and b-tubulin (b-tub.) are indicated. Panel B: A summary of 8 qRT-PCR analyses is shown using RNAs from DLD1-pTER-EGFP-shPABP (siPABP) or DLD-1-pTER-EGFP-shLuc (siLuc) cells. Data (means ± SEM) represent relative iNOS levels normalized to the GAPDH mRNA expression (⁄⁄⁄p < 0.001, ⁄⁄p < 0.01, vs. CM-treated siLuc cells, Anova). Panel C: The extracts from untreated and CM-treated cells were analyzed for iNOS and b-tub. protein expression. The positions of iNOS and b-tub. are indicated. The blots are representative for three other blots showing similar results. Panel D: The extracts from untreated (left four lanes) or CM-treated (right four lanes; CM) cells from panel C were probed for STAT-1a, NF-jB p65, and GAPDH protein expression. Each blot shown is representative for two other blots showing similar results. The positions of STAT-1a, NF-jB p65, GAPDH, and b-tub. are indicated.

438 439 440 441 442 443 444

erase activity was measured. As shown in Fig. 2 downregulation of PABP (siPABP) did not change the inducibility of the human 16 kb iNOS promoter compared to DLD-1-pTER-EGFP cells (EGFP). These data show that siPABP-mediated down-regulation of iNOS mRNA expression is promoter-independent. Downregulation of PABP expression reduces human iNOS mRNA stability

459

To analyze the effects of reduced PABP expression on human iNOS-, Pol 2A- or b2M mRNA stability, DLD-1-pTER-EGFP-shPABPor DLD-1-pTER-EGFP-shLuc cells were preincubated with medium without FCS for 16 h and further treated with CM for 4 h. Then DRB was added to inhibit RNA polymerase II dependent transcription. After additional 2–6 h RNA was purified and iNOS-, Pol 2A-, b2M, and GAPDH mRNA expression was analyzed by qRT-PCR. The iNOS-, Pol 2A-, and b2M mRNA expression was normalized to GAPDH mRNA expression and the mRNA expression levels at 0 h DRB were set to 100%. As shown in Fig. 3 downregulation of PABP (siPABP) reduced the stability of iNOS mRNA (t1/2 in siLuc cells: 5.8 ± 1.3 h; t1/2 in siPABP cells: 3.6 ± 0.7 h; see Fig. 3A) but has no effect on the decay of Pol 2A- (Fig. 3B) or b2M (Fig. 3C) mRNA. These data imply that PABP is specifically involved in the regulation of human iNOS mRNA stability.

460

Identification of PABP binding sites in the iNOS mRNA

461

Comparison of the PABP binding site in the 50 -UTR of the human PABP mRNA (50 -AAAAAATCCAAAAAAAATCTAAAAAAATCTTTTAAA AAACCCCAAAAAAATTTACAAAAA-30 , positions 72–131 of NM_002568, [11]) to the human iNOS mRNA identified two sites

445 446 447 448 449 450 451 452 453 454 455 456 457 458

462 463 464

with high homology. One site was located in the 50 -UTR (positions 178–242 of NM_000625.4) and the other site in the 30 -UTR (positions 3995–4056 NM_000625.4). To characterize these putative

Fig. 2. Downregulation of PABP did not change the activity of the human 16 kB iNOS promoter. DLD1-pTER-EGFP-shPABP (siPABP) or DLD-1-pTER-EGFP (EGFP) transiently transfected with pNOS2(16)Luc and pEF-1a-RL (for normalization) were preincubated for 16 h in medium without FCS and phenol red. Subsequently cells were incubated with or without (Co) a cytokine mixture (CM) for 6 h. Cell extracts were prepared and firefly and renilla luciferase activities were determined. The firefly luciferase activity was normalized to the renilla luciferase activity and the relative firefly luciferase activity in control EGFP cells was set to 100%. Data (means ± SEM) represent the relative firefly-luciferase activity in EGFP or siPABP transfected cells (⁄⁄⁄p < 0.001 vs. untreated cells, t-test; ns = not significant vs. EGFP cells, t-test).

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

465 466 467

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 6

I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

Fig. 3. Downregulation of PABP reduced the stability of the human iNOS mRNA. DLD1-pTER-EGFP-shPABP (siPABP, filled squares) or DLD-1-pTER-EGFP-shLuc (siLuc, filled circles) cells were preincubated for 16 h in medium without FCS and phenol red. Subsequently cells were incubated with a cytokine mixture for 4 h. Then 25 lg/ml 6dichloro-1-ribofuranosylbenzimidazole (DRB) was added, and RNA was prepared 0, 2, 4, and, 6 h after DRB treatment. Relative iNOS, Pol 2A, b2M, and GAPDH mRNA amounts were determined by qRT-PCR. iNOS (Panel A), Pol 2A (Panel B), and b2M (Panel C) mRNA was normalized to GAPDH mRNA. The relative amounts of iNOS, Pol 2A, or b2M mRNA at 0 h DRB were set at 100%. Curve fittings of the resulting DRB time curves were performed by non-linear regression using Graph-Pad Prism 5.0d. A summary of 4 qRTPCR (for each mRNA tested) analyses is shown. Data (means ± SEM) represent relative iNOS (Panel A), Pol 2A (Panel B), and b2M (Panel C) mRNA levels in DLD1-pTER-EGFPshPABP (siPABP, filled squares) or DLD-1-pTER-EGFP-shLuc (siLuc, filled circles) cells (⁄p < 0.05; ⁄⁄p < 0.01; ns = not significant vs. siLuc cells, t-test). 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496

binding sites of PABP in the human iNOS mRNA, recombinant GSTPABP fusion protein was incubated with different 32P-labeled transcripts (see Fig 4A) and PABP/RNA complex formation was assayed by UV-crosslinking experiments. As shown in Fig. 4B, decent complex formation was detected for the 50 and the 30 -UTR of the human iNOS mRNA. To characterize the PABP binding site in the 50 -UTR in more detail this fragment was dissected into two subfragments, one encoding the exon1 (Ex1) and the other the exon 2 (Ex2, containing the putative PABP binding site) sequence of the human iNOS mRNA. The GST-PABP protein interacted only with the subfragment of exon 2, which contains the putative PABP binding site. No interaction with the GST-protein was seen (Fig. 4C). To characterize the PABP binding sites in the 30 -UTR the region was first dissected into two subfragments, one without AU-repeats (non-AU) and the other containing these putative regulatory elements (AU) and the putative PABP binding site. Only the AU-subfragment interacted with the GST-PABP protein. No interaction with the GST-protein was detectable (Fig. 4D). Subsequently, the AU-fragment was dissected into three subfragments: subfragment A (no AU-repeats, one putative PABP binding site), subfragment B (three AUUUA-motifs), and subfragment C (one AUUUA and an AUUUUA element). As shown in Fig. 4E, significant PABP binding was only found for subfragments A and B (no binding of GST detected). Therefore PABP seems to bind to the PABP binding site (fragment A) and to the AU-rich elements in the fragment B of the 30 -UTR of the human iNOS mRNA. In summary, we detected PABP binding in one fragment of the human iNOS 50 -UTR and to two different fragments of the human

iNOS 30 -UTR. PABP binding to fragment B in the 30 -UTR is likely to result from interaction with AU-rich elements.

497

Mutation or deletion of the PABP binding sequences in the 50 -or 30 -UTR reduces binding of cellular PABP

499

To verify that the sequences identified by the UV-crosslinking experiments are involved in the PABP-iNOS mRNA interaction we performed pull-down experiments using in-vitro transcribed biotinylated RNAs (without a poly(A) tail) containing deleted or mutated PABP binding sequences (see Fig. 6A) and extracts from cytokine-induced DLD-1 cells. As shown in Fig. 5A deletion of the PABP binding site in the 50 -UTR of the human iNOS mRNA (50 -UTR-delPABP) resulted in marked reduction of PABP binding compared to the wildtype sequence (50 -UTRwt). Also mutation of the PABP binding site in fragment A (mutA) and all there AU-rich elements in fragment B (mutB) of the human iNOS 30 -UTR resulted in marked reduction of PABP binding compared to the respective wildtype sequences (fragA and fragB, see Fig. 5B).

501

Mutation or deletion of the PABP binding site in the 50 -UTR reduces luciferase reportergene expression

514

To analyze whether the PABP binding sites in the 50 - or 30 -UTR of the human iNOS mRNA modulate mRNA expression these regions were cloned in front of or behind a luciferase reporter gene in the plasmid pGL3-control (pGL3-control-iNOS-5UTR and 3UTR). In addition also 50 - or 30 -UTR constructs with mutated or deleted PABP binding sites (same deletions or mutations as used

516

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

498

500

502 503 504 505 506 507 508 509 510 511 512 513

515

517 518 519 520 521

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

7

Fig. 4. Analysis of the PABP binding sites in the human iNOS mRNA. Purified glutathione-S-transferase (GST) or GST-PABP fusion protein were incubated with different radiolabeled RNAs generated by in vitro transcription using the different iNOS mRNA fragments shown in panel A. After binding, proteins were UV cross-linked to the RNA and the complexes were digested with RNase. RNA–protein complexes were separated on SDS polyacrylamide gels. Panel A: Shown is a scheme of the human iNOS mRNA and the transcripts (50 -UTR, cds, 30 -UTR, Ex1, Ex2, non-AU, AU, A, B, C) used in RNA binding studies. 50 -UTR and 30 -UTR indicates the 50 - and 30 -untranslated of the human iNOS mRNA whereas cds indicate the coding region. The 50 cap structure and the poly A tail are indicated. The location of exon 1 (Ex1) and the exon 2 part (Ex2) of the 50 -UTR are shown. The location of the putative PABP binding sites in the human iNOS 50 - and 30 -UTR is shown by a double arrow. The positions of the AUUUA and AUUUUA repeats are indicated by triangles. Panel B: 32P-radiolabeled 50 -UTR, cds, and 30 -UTR subfragments of the human iNOS mRNA were incubated with GST or GST-PABP fusion-protein. The positions of RNA/protein complexes are indicated. The autoradiographs shown are representative of four other experiments showing similar results. Panel C: 32P-radiolabeled Ex1 and Ex2 subfragments of the human iNOS 50 -UTR were incubated with GST or GST-PABP fusion-protein. The positions of RNA/protein complexes are indicated. The autoradiographs shown are representative of three other experiments showing similar results. Panel D: 32P-radiolabeled AU or nonAU subfragments of the 30 -UTR were incubated with GST or GST-PABP fusion-protein. The positions of RNA/protein complexes are indicated. The autoradiographs shown are representative of two other experiments showing similar results. Panel E: 32P-radiolabeled 30 -UTR, subfragment A (232–319; A), subfragment B (317–420; B) or subfragment C (387–477; C) were incubated with GST or GST-PABP protein. The positions of RNA/protein complexes are indicated. The autoradiographs shown are representative of three other experiments showing similar results.

522 523 524 525

above) were generated (pGl3-control-iNOS-50 -UTR-mutPABP, pGl3-control-iNOS-50 -UTR-delPABP, pGL3-control-iNOS-30 -UTR0 mutA, and pGL3-control-iNOS-3 -UTR-mutB (for sequences of the different constructs see Fig. 6A).

To analyze the effects of the mutations or deletions on luciferase expression these plasmids were transiently transfected into DLD-1 cells. For control of transfection efficiency the renilla expression plasmid pRL-EF-1a was cotransfected. After 24 h the

Fig. 5. Mutation or deletion of the PABP binding sites in the 50 - or 30 -UTR of the human iNOS mRNA reduces PABP binding. In vitro transcribed biotinylated RNAs (without a poly(A) tail) containing the wildtype, mutated or deleted 50 - or 30 -UTR sequences were incubated with whole cell extracts from cytokine-induced DLD-1 cells. After several washing steps the bound proteins were eluted with high salt (2 M KCl). The eluted proteins were separated in SDS–PAGE. PABP was identified by Western blotting using specific polyclonal anti-PABP antibodies. Panel A: Western blot using specific anti-PABP antibodies with the eluates from the affinity purification using biotinylated RNAs containing the wildtype 30 -UTR or 50 -UTR sequences or 50 -UTR sequences with deleted PABP binding site (50 -UTRdelPABP). The blot is representative of four other blots showing similar results. Panel B: Western blot using specific anti-PABP antibodies with the eluates from the affinity purification using biotinylated RNAs containing the wildtype 30 -UTR, non-AU fragment, fragment A (fragA) or fragment B (fragB) sequences. Also the eluates of purifications using fragment A with mutated PABP binding site (mutA) or fragment B with all AREs mutated (mutB) were analyzed by Western blotting. The blot is representative of three other blots showing similar results.

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

526 527 528 529

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 8 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544

I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

cells were treated with medium without serum for 16 h and then with or without CM for additional 6 h. Then cells were lyzed and luciferase activity was measured. As shown in Fig. 6B there was no difference (neither in untreated nor in CM-treated cells) in the luciferase expression in cells transfected with the vector pGL3-control (pGL3-con) or pGL3-control-50 -UTR (5UTR) containing the 50 -UTR of the human iNOS mRNA in front of the luciferase reporter gene. As published before [4,10] cloning of the human iNOS 30 -UTR (3UTR) sequence behind the luciferase in the plasmid pGL3-control resulted in a marked reduction of luciferase expression in the transfected cells (see Fig 6B). The above data indicate, that the wildtype 50 -UTR of the human iNOS mRNA seems not to modulate reporter gene expression. However, as we found a specific interaction of PABP with this sequence, we analyzed whether mutation or deletion of this PABP

binding site modulates reporter gene expression. As seen in Fig. 6C mutation or deletion of the PABP binding site in the 50 -UTR of the human iNOS mRNA (mutPABP, delPABP) markedly reduced (about 50% reduction) luciferase expression compared to the wildtype 50 -UTR (wt) construct, both in cells treated with or without CM. In contrast, mutation of the putative PABP binding site in fragment A (mutA) or mutation of all AU-rich elements in fragment B (mutB) of the 30 -UTR did enhance but not decrease luciferase activity (see Fig. 6D). To verify that the decrease in luciferase activity observed with pGl3-control-iNOS-50 -UTR-mutPABP or pGl3-control-iNOS-50 -UTRdelPABP resulted from reduced luciferase mRNA expression pcDNA4/TO-Ex1-In1-Ex2-luc constructs were generated. As these constructs contain the first intron of the human iNOS gene they allow to distinguish between transfected DNA and mRNA

Fig. 6. Effects of mutation or deletion of the PABP binding sites in the 50 -UTR or 30 -UTR on luciferase expression. DLD1-1 cells were transiently transfected ith pGL3-control constructs and pEF-1a-RL for normalization. Then the transfected cells were preincubated for 16 h in medium without FCS and phenol red. Subsequently cells were incubated with or without (Co) a cytokine mixture (CM) for 6 h. Cell extracts were prepared and firefly and renilla luciferase activities were determined. Panel A: Shown are parts of the sequences of the 50 -UTR or 30 -UTR constructs used for the transient transfection experiments. The location of the mutated or deleted sequences and the putative PABP binding sites as well as the AU-rich elements (ARE) are indicated. Exon 1 (Ex1) and the exon 2 part (Ex2) of the 50 -UTR are shown. The location of the putative PABP binding sites in the human iNOS 50 - and 30 -UTR as well as the positions of the AUUUA and AUUUUA repeats are shown by double arrows. Panel B: DLD-1 cells were transiently transfected with pGL3-control (pGL3-con), pGL3-control-iNOS-5UTR (5UTR) and pGL3-control-iNOS-3UTR (3UTR) and pEF-1a-RL for normalization. A summary of 4 transfection assays (n = 12 each) is shown. Data (means ± SEM) represent relative luciferase activities. Relative luciferase activities in cells treated with (CM) or without (Co) cytokines and transfected with pGL3-control- were set to 100%. (⁄⁄⁄p < 0.001, ns = not significant vs. pGL3-control transfected cells, Anova). Panel C: DLD-1 cells were transiently transfected with pGL3-control-iNOS-5UTR (wt), pGL3-control-iNOS-5UTR-mutPABP (mutPABP) pGL3-control-iNOS-5UTR-delPABP (delPABP) and pEF-1a-RL for normalization. A summary of 4 transfection assays (n = 12 each) is shown. Data (means ± SEM) represent relative luciferase activities. Relative luciferase activities in cells treated with (CM) or without (Co) cytokines and transfected with pGL3-control-iNOS-5UTR were set to 100%. (⁄⁄⁄p < 0.001 vs. pGL3-control-iNOS-5UTR transfected cells, Anova). Panel D: DLD-1 cells were transiently transfected with pGL3-control-iNOS-3UTR (wt), pGL3-control-iNOS-3UTR-mutA (mutA), pGL3-control-iNOS-3UTR-mutB (mutB), and pEF-1a-RL for normalization. A summary of 6 transfection assays (n = 12 each) is shown. Data (means ± SEM) represent relative luciferase activities. Relative luciferase activities in cells treated with (CM) or without (Co) cytokines and transfected with pGL3-control-iNOS-3UTR were set to 100% (⁄⁄p < 0.01, ⁄p < 0.05, ns = not significant vs. pGL3-control-iNOS3UTR transfected cells, Anova).

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

545 546 547 548 549 550 551 552 553 554 555 556 557 558 559

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

581

transcribed from the constructs in transfection/qRT-PCR experiments (see Fig. S4). We transiently transfected DLD-1 cells with the constructs pcDNA4/TO-Ex1-In1-Ex2-Luc (wildtype exon 2 sequence), pcDNA4/TO-Ex1-In1-Ex2-mutPABP-Luc (PABP binding site mutated) and pcDNA4/TO-Ex1-In1-Ex2-delPABP-luc (PABP binding site deleted). For normalization of transfection efficiency we either used pEF-1a-RL (luciferase activity) or pRHCglo ([43], luciferase mRNA expression). After 24 h the cells were treated with medium without serum for 16 h and then with or without CM for additional 6 h. Then cells were lyzed, protein extracts or RNA was isolated and luciferase-activity or -mRNA expression was determined. As shown in Fig. S5 also in the pcDNA4/TO-Ex1-In1-Ex2luc constructs mutation or deletion of the PABP binding site in exon 2 resulted in markedly reduced luciferase activity. More important, mutation or deletion of the PABP binding site in exon 2 also markedly reduced luciferase mRNA expression (see Fig. 7). These results showed that the reduced luciferase activity observed with the 50 -UTR-mutPABP or -delPABP constructs resulted from reduced luc mRNA expression. In summary, these data show that the PABP binding site in the 50 -UTR (exon2) of the human iNOS mRNA is involved in the posttranscriptional regulation of human iNOS expression.

582

Cytokine incubation does not change PABP expression in DLD-1 cells

583

In order to gain further insight into the mechanism of PABPmediated destabilization of iNOS mRNA we studied the expression of PABP in DLD-1 cells. Cells were incubated with or without CM for 2 up to 24 h and RNA and protein were isolated. Cytokine treatment showed neither an influence on PABP mRNA (see Fig. S6A) nor protein (Fig. S6B) expression. Thus, no cytokine-mediated changes of PABP expression were detectable.

560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580

584 585 586 587 588 589

0

Fig. 7. Effects of mutation or deletion of the PABP binding site in the 5 -UTR on luciferase mRNA expression. DLD-1 cells were transiently transfected with pcDNA4/ TO-Ex1-In1-Ex2-Luc (wt), pcDNA4/TO-Ex1-In1-Ex2-Luc-mutPABP (mutPABP), pcDNA4/TO-Ex1-In1-Ex2-Luc-delPABP (delPABP), and pRHCglo for normalization. After 48 h cells were preincubated for 16 h in medium without FCS and phenol red. Subsequently cells were incubated with or without (Co) a cytokine mixture (CM) for 6 h. RNA was prepared and luciferase- and RHCglo mRNA expression were determined by mRNA specific qRT-PCR reactions (see Fig. S4). A summary of 8 qRT-PCR analyses is shown using RNAs from transfected DLD-1 cells. Data (means ± SEM) represent relative luciferase mRNA levels normalized to the RHCglo mRNA expression. Relative luciferase mRNA levels in pcDNA4/TO-Ex1-In1-Ex2-Luc transfected cells treated with (CM) or without (Co) cytokines were set to 100% (⁄⁄⁄p < 0.001 vs. Co or CM-treated pcDNA4/TO-Ex1-In1-Ex2-luc transfected cells, Anova).

9

Discussion

590

Modulation of mRNA-stability is one of the central mechanisms to regulate human iNOS expression [3]. The rate of mRNA decay and translation is determined by cis-acting sequences within the mRNA, which are recognized by trans-acting factors. The bestcharacterized cis-acting sequences responsible for mRNA decay in mammalian cells are the AREs present within the 30 -UTRs of short-lived mRNAs, whose expression has to be regulated tightly [45,46]. These AREs are involved in deadenylation and subsequent degradation of mRNAs [47,48] and have also been found to stimulate 50 -decapping [49]. Five AREs are present in the 30 -UTR of the human iNOS mRNA. Furthermore, transfection experiments showed destabilization in the mRNA of a heterologous reporter gene by the human iNOS 30 -UTR [4]. More than 15 proteins are known to bind to AREs [50] but only few of them have been shown to regulate mRNA stability. These include AUF1 [51], the ELAV proteins, especially HuR [52], KSRP [53], and the TTP family of zinc-finger RNA binding proteins [54]. All of these RNA-BP have been shown to be involved in the regulation of human iNOS expression [4,5,8,10]. In an attempt to isolate proteins interacting with the 30 -UTR of the human iNOS mRNA, we performed RNA-affinity purifications [8]. This method resulted in the identification of KSRP, hnRNP-E1 and the cytoplasmic poly(A) binding protein 1 (PABP) as a RNA-binding protein interacting with the human iNOS mRNA (see Fig. S1). As we have already analyzed the effects of KSRP [8] and hnRNP E1 (data not shown) on human iNOS expression, we concentrated on the effects of PABP in the current study. PABP binds to the poly(A)-tail of all mRNAs and is important for general mRNA translation and -stability [11,12]. However, recent data indicate that PABP also specifically regulates the stability or translation of different mRNAs (like PABP itself, MK-2, c-fos, osk, insulin) by binding to their 50 -UTR, cds or 30 -UTR. [11,23,25,31,33, 34,44]. For example, PABP binds to an A-rich sequence in the 50 -UTR of its own mRNA and thereby, depending on the cellular background analyzed, reduces the translation or stability in an autoregulatory manner [11,34]. In contrast, PABP binding to the 50 -UTR is involved in the glucose induced enhancement of insulin mRNA translation [23]. In the current publication we identified PABP as a RNA-BP specifically binding to the 50 and 30 -UTR of the human iNOS mRNA. Therefore we wanted to analyze whether siRNA-mediated downregulation of PABP expression affects cytokine-induced iNOS expression. Analysis of the PABP expression in siPABP cells (see Fig. 1A and S2A) revealed downregulation (around 50% reduction) of PABP mRNA and protein expression compared to siLuc cells. In the same RNA samples we showed that siRNA-mediated downregulation of PABP markedly reduced cytokine-induced iNOS mRNA expression (see Fig. 1B) but not the expression of the Pol 2A- and b2M-mRNA (Fig. S2B and C). Accordingly, the downregulation of PABP expression achieved in the siPABP cells seems not to have general effects on mRNA expression. Along with the reduction of iNOS mRNA expression we observed a significant reduction in iNOS protein expression (see Fig. 1C) and iNOS dependent NO-production (Fig. S3) in siPABP cells. As the protein expression of STAT-1a, NF-jB p65 and GAPDH (see Fig. 1D) was not changed in siPABP cells, the decrease of iNOS protein expression is unlikely a result of a global inhibition of translation in these cells. Furthermore, we demonstrated that PABP enhances iNOS expression by modulation of mRNA-stability (see Fig. 3) without changing the cytokine-mediated induction of the human iNOS promoter (Fig. 2). As the stability of the Pol 2A- (Fig. 3B) and the

591

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 10 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719

I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

b2M- (Fig. 3C) mRNA remained unaffected, the modulation of iNOS mRNA stability seems to be a specific PABP effect. Comparison of the known PABP binding sequence in the 50 -UTR of the human PABP mRNA [11,34] with the sequence of the human iNOS mRNA revealed two regions of high homology (in exon 2 part of the 50 -UTR and in fragment A of the 30 -UTR, see Fig. 4A). UVcrosslinking experiments demonstrated binding of purified PABP to these two sequences. (Fig. 4C and E). In addition, strong interaction of PABP with fragment B of the iNOS 30 -UTR, which contains three AREs, was detected (see Fig 4E). Pull-down experiments (see Fig. 5) using in-vitro transcribed RNA containing mutations or deletion in these PABP sequences (see Fig. 6A) verified the UV-crosslinking data. As bacterially expressed proteins may not contain all post-translational modifications needed for proper regulation pull-down experiments were performed using total extracts from DLD-1 cells. To analyze whether binding of PABP to the 50 - and 30 -UTR of the human iNOS mRNA is involved in the regulation of human iNOS expression we performed transient transfection experiments in DLD-1 cells using luciferase reporter gene constructs containing the 50 - or 30 -UTR (containing wildtype or mutated/deleted PABP binding sites) of the human iNOS mRNA cloned in front or behind the luciferase cds (see Fig. 6 and 7). No differences in luciferase activity could be detected in extracts from cells transfected with pGL3-control or pGL3-control-5UTR (see Fig 6B pGL3-con vs. 5UTR). Therefore the wildtype 50 -UTR sequence of the human iNOS mRNA seems not modulate luciferase expression. One the other hand we cannot exclude that an effect of the wildtype 50 -UTR on reporter gene expression becomes apparent in the presence of the destabilizing 30 -UTR. This has to be evaluated in further experiments. However mutation or deletion of the PABP binding site in exon 2 of this 50 -UTR sequence (mutPABP, delPABP) markedly (roughly 50%) reduced luciferase activity and mRNA expression independently of cytokine stimulation (Fig. 6C and Fig. 7). Close inspection of the iNOS 50 -UTR sequence revealed the presence of a small upstream open reading frame (lORF) in exon 1 [3]. Such lORF have been described to regulate the translation of the major coding region of the mRNAs [55]. Also the mutation of the PABP binding site in exon 1 (mutPABP) unfortunately introduced another ATG into the 50 -UTR sequence. Therefore the effects of the mutation or deletion of the PABP binding site in the 50 -UTR on luciferase expression may be explained by repressive effects of these lORF/ATG on the luciferase translation. However analyses using luciferase reportergene constructs containing either the wild-type 50 -UTR sequence or a 50 -UTR sequence with mutated ATG of the lORF showed that transient transfections of both constructs resulted in nearly the same luciferase activity in extracts prepared from these cells (data not shown). Therefore the lORF seems not to regulate human iNOS expression by modifying the translation of the main open reading frame. In addition luciferase mRNA expression analyses (see Fig. 7) revealed reduced mRNA expression both for the mutPABP and delPABP construct. Thus the PABP binding site in the 50 -UTR of the human iNOS mRNA is very likely to be involved in the post-transcriptional enhancement of iNOS mRNA stability by PABP. As no CM effect was detectable, this PABP related effect seems to operate on a basal level. As shown in transfection experiments, cloning of the 30 -UTR of the human iNOS mRNA behind the luciferase cds resulted in a marked reduction of luciferase expression (Fig. 6B). We already published this destabilizing activity of the wildtype human iNOS 30 -UTR sequence using different vector systems [4,9,10]. In contrast to the data obtained with the 50 -UTR constructs, mutation of the PABP binding site in fragment A (mutA) or of all AREs in fragment B (mutB) of the 30 -UTR did not reduce the luciferase expression in transfected cells. We even detected increased luciferase activity in these experiments (see Fig. 6D). We already have

published enhancement of luciferase expression in luciferaseiNOS-30 -UTR constructs after deletion of the AREs in fragment B of the 30 -UTR [10]. These AREs are binding sites of AUF1, a RNA binding protein negatively regulating human iNOS expression by post-transcriptional mechanisms [10]. Therefore it is likely that increased luciferase activity seen after the mutation of the AREs in fragment B is due to blockade of AUF1 binding. This effect seems to overwhelm the negative effect of reduced PABP binding to these sequences. The exact molecular mechanisms by which PABP modulate iNOS mRNA stability remains to be elucidated. As shown for the PABP binding sites in the 50 -UTR of its own mRNA [34] binding of PABP to its sites in the 50 - and 30 -UTR of the human iNOS mRNA may interfere with RNA degradation processes. Through binding to classical AREs it may act in a similar way than other ARE-BP like HuR, TTP, or KSRP. Therefore, PABP may interfere with the classical exosome-mediated 30 to 50 degradation pathway [56] or the 50 to 30 decay initiated by decapping of the mRNA [57]. The results reported above indicate a direct positive effect of PABP on human iNOS expression. Since induction of iNOS expression in DLD-1 cells depends on a complex cytokine mixture (CM) we analyzed the effects of CM stimulation on endogenous PABP expression. As shown in Fig. S6, CM incubation of DLD-1 cells did not change endogenous PABP mRNA or protein expression. Also analyses of PABP phosphorylation revealed no changes in tyrosine or serine phosphorylation after cytokine treatment (data not shown). Therefore, the enhancement in iNOS mRNA expression measured after CM treatment does not seem to correlate with changes in cytokine-induced PABP expression or tyrosine or serine phosphorylation. However, whether other post-translational modifications described for PABP (glutamate, aspartate, lysine and arginine methylations as well as lysine acetylations, [58]) are involved in PABP mediated regulation of iNOS expression remains to be determined.

720

Conclusion

754

In summary, our data show that PABP specifically regulates iNOS mRNA stability in human DLD-1 cells by binding to different sites in the 50 - and 30 -UTR of the iNOS mRNA. Thus iNOS seems to belong to a group of genes (MKK-2, osk, insulin or PABP itself) regulated by PABP specific post-transcriptional mechanisms. Most mRNAs described to be regulated by specific non-poly(A)-dependent interactions with PABP contain A- or AU-rich sequences in their 50 - or 30 -UTRs. Therefore, further studies may demonstrate that PABP generally regulates the expression of ARE-containing mRNAs. Regarding to this effect PABP may have a key role in the pathogenesis of diseases like chronic-inflammation or cancer characterized by dysregulation of such transcripts.

755

Funding

767

This work was supported by Grant 1512-366261/758K and 961386261/917K from the Innovation Foundation of the State of Rhineland-Palatinate, by the Collaborative Research Center SFB 553 (Project A7 to HK) and the DFG grant LI 1759/1-1 (to HK). This study was partly supported by the Federal Ministry of Education and Research (BMBF 01EO1003). The authors are responsible for the contents of this publication.

768

Acknowledgments

775

We thank Dr. E. Bockamp (TRON, University Medical Center of the Johannes Gutenberg University Mainz, D-55101 Mainz, Germany) for providing the vector pTER-EGFP, Dr. T. Cooper (Baylor College of Medicine, Houston, TX, USA) for providing pRHCglo,

776

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753

756 757 758 759 760 761 762 763 764 765 766

769 770 771 772 773 774

777 778 779

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

782

and Dr. Meyuhas (Department of Biochemistry, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel) for providing the expression vector pFLAG-PABP.

783

Appendix A. Supplementary data

784 785

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.niox.2013.05.002.

786

References

787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858

[1] C. Bogdan, M. Rollinghoff, A. Diefenbach, Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity, Curr. Opin. Immunol. 12 (2000) 64–76. [2] K.D. Kroncke, K. Fehsel, V. Kolb-Bachofen, Inducible nitric oxide synthase in human diseases, Clin. Exp. Immunol. 113 (1998) 147–156. [3] A. Pautz, J. Art, S. Hahn, S. Nowag, C. Voss, H. Kleinert, Regulation of the expression of inducible nitric oxide synthase, Nitric Oxide 23 (2010) 75–93. [4] F. Rodriguez-Pascual, M. Hausding, I. Ihrig-Biedert, H. Furneaux, A.P. Levy, U. Förstermann, H. Kleinert, Complex contribution of the 30 -untranslated region to the expressional regulation of the human inducible nitric-oxide synthase gene. Involvement of the RNA-binding protein HuR, J. Biol. Chem. 275 (2000) 26040–26049. [5] M. Fechir, K. Linker, A. Pautz, T. Hubrich, U. Forstermann, F. Rodriguez-Pascual, H. Kleinert, Tristetraprolin regulates the expression of the human inducible nitric-oxide synthase gene, Mol. Pharmacol. 67 (2005) 2148–2161. [6] W. Eberhardt, A. Doller, S. Akool el, J. Pfeilschifter, Modulation of mRNA stability as a novel therapeutic approach, Pharmacol. Ther. 114 (2007) 56–73. [7] Z. Guo, L. Shao, L. Zheng, Q. Du, P. Li, B. John, D.A. Geller, MiRNA-939 regulates human inducible nitric oxide synthase posttranscriptional gene expression in human hepatocytes, Proc. Natl. Acad. Sci. USA 109 (2012) 5826–5831. [8] K. Linker, A. Pautz, M. Fechir, T. Hubrich, J. Greeve, H. Kleinert, Involvement of KSRP in the post-transcriptional regulation of human iNOS expressioncomplex interplay of KSRP with TTP and HuR, Nucleic Acids Res. 33 (2005) 4813–4827. [9] A. Pautz, K. Linker, T. Hubrich, R. Korhonen, S. Altenhofer, H. Kleinert, The polypyrimidine tract-binding protein (PTB) is involved in the posttranscriptional regulation of human inducible nitric oxide synthase expression, J. Biol. Chem. 281 (2006) 32294–32302. [10] A. Pautz, K. Linker, S. Altenhofer, S. Heil, N. Schmidt, J. Art, S. Knauer, R. Stauber, N. Sadri, A. Pont, R.J. Schneider, H. Kleinert, Similar regulation of human inducible nitric-oxide synthase expression by different isoforms of the RNAbinding protein AUF1, J. Biol. Chem. 284 (2009) 2755–2766. [11] J. Bag, R.B. Bhattacharjee, Multiple levels of post-transcriptional control of expression of the poy (A)-binding protein, RNA Biol. 7 (2010) 5–12. [12] R.W. Smith, N.K. Gray, Poly(A)-binding protein (PABP): a common viral target, Biochem. J. 426 (2010) 1–12. [13] U. Kuhn, E. Wahle, Structure and function of poly(A) binding proteins, Biochim. Biophys. Acta 1678 (2004) 67–84. [14] B. Gorgoni, N.K. Gray, The roles of cytoplasmic poly(A)-binding proteins in regulating gene expression: a developmental perspective, Brief. Funct. Genomic. Proteomic. 3 (2004) 125–141. [15] S. Cheng, D.R. Gallie, EIF4G, eIFiso4G, and eIF4B bind the poly(A)-binding protein through overlapping sites within the RNA recognition motif domains, J. Biol. Chem. 282 (2007) 25247–25258. [16] S. Ma, R.B. Bhattacharjee, J. Bag, Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells, FEBS J. 276 (2009) 552–570. [17] R. Soto-Rifo, P.S. Rubilar, T. Limousin, S. de Breyne, D. Decimo, T. Ohlmann, DEAD-box protein DDX3 associates with eIF4F to promote translation of selected mRNAs, EMBO J. 31 (2012) 3745–3756. [18] D.A. Mangus, M.C. Evans, A. Jacobson, Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression, Genome Biol. 4 (2003) 223. [19] S. Hoshino, M. Imai, T. Kobayashi, N. Uchida, T. Katada, The eukaryotic polypeptide chain releasing factor (eRF3/GSPT) carrying the translation termination signal to the 30 -poly(A) tail of mRNA. Direct association of erf3/ GSPT with polyadenylate-binding protein, J. Biol. Chem. 274 (1999) 16677– 16680. [20] N. Uchida, S. Hoshino, H. Imataka, N. Sonenberg, T. Katada, A novel role of the mammalian GSPT/eRF3 associating with poly(A)-binding protein in Cap/ Poly(A)-dependent translation, J. Biol. Chem. 277 (2002) 50286–50292. [21] S. Hoshino, N. Hosoda, Y. Araki, T. Kobayashi, N. Uchida, Y. Funakoshi, T. Katada, Novel function of the eukaryotic polypeptide-chain releasing factor 3 (eRF3/GSPT) in the mRNA degradation pathway, Biochemistry. Biokhimiia 64 (1999) 1367–1372. [22] O.V. Skabkina, M.A. Skabkin, N.V. Popova, D.N. Lyabin, L.O. Penalva, L.P. Ovchinnikov, Poly(A)-binding protein positively affects YB-1 mRNA translation through specific interaction with YB-1 mRNA, J. Biol. Chem. 278 (2003) 18191–18198. [23] S.D. Kulkarni, B. Muralidharan, A.C. Panda, B. Bakthavachalu, A. Vindu, V. Seshadri, Glucose-stimulated translation regulation of insulin by the 50 UTRbinding proteins, J. Biol. Chem. 286 (2011) 14146–14156.

780 781

11

[24] M.R. Fabian, G. Mathonnet, T. Sundermeier, H. Mathys, J.T. Zipprich, Y.V. Svitkin, F. Rivas, M. Jinek, J. Wohlschlegel, J.A. Doudna, C.Y. Chen, A.B. Shyu, J.R. Yates 3rd, G.J. Hannon, W. Filipowicz, T.F. Duchaine, N. Sonenberg, Mammalian miRNA RISC recruits CAF1 and PABP to affect PABP-dependent deadenylation, Mol. Cell 35 (2009) 868–880. [25] T.C. Chang, A. Yamashita, C.Y. Chen, Y. Yamashita, W. Zhu, S. Durdan, A. Kahvejian, N. Sonenberg, A.B. Shyu, UNR, a new partner of poly(A)-binding protein, plays a key role in translationally coupled mRNA turnover mediated by the c-fos major coding-region determinant, Genes Dev. 18 (2004) 2010– 2023. [26] F. Tritschler, E. Huntzinger, E. Izaurralde, Role of GW182 proteins and PABPC1 in the miRNA pathway: a sense of deja vu, Nat. Rev. Mol. Cell Biol. 11 (2010) 379–384. [27] R.W. Walters, S.S. Bradrick, M. Gromeier, Poly(A)-binding protein modulates mRNA susceptibility to cap-dependent miRNA-mediated repression, RNA 16 (2010) 239–250. [28] E. Huntzinger, D. Kuzuoglu-Ozturk, J.E. Braun, A. Eulalio, L. Wohlbold, E. Izaurralde, The interactions of GW182 proteins with PABP and deadenylases are required for both translational repression and degradation of miRNA targets, Nucleic Acids Res. 41 (2012) 978–994. [29] R.T. Sladic, C.A. Lagnado, C.J. Bagley, G.J. Goodall, Human PABP binds AU-rich RNA via RNA-binding domains 3 and 4, Eur J. Biochem./FEBS 271 (2004) 450– 457. [30] K. Nagaoka, T. Suzuki, T. Kawano, K. Imakawa, S. Sakai, Stability of casein mRNA is ensured by structural interactions between the 30 -untranslated region and poly(A) tail via the HuR and poly(A)-binding protein complex, Biochim. Biophys. Acta 1759 (2006) 132–140. [31] F. Bollig, R. Winzen, M. Gaestel, S. Kostka, K. Resch, H. Holtmann, Affinity purification of ARE-binding proteins identifies polyA-binding protein 1 as a potential substrate in MK2-induced mRNA stabilization, Biochem. Biophys. Res. Commun. 301 (2003) 665–670. [32] S. Ma, T. Musa, J. Bag, Reduced stability of mitogen-activated protein kinase kinase-2 mRNA and phosphorylation of poly(A)-binding protein (PABP) in cells overexpressing PABP, J. Biol. Chem. 281 (2006) 3145–3156. [33] P. Vazquez-Pianzola, H. Urlaub, B. Suter, Pabp binds to the osk 30 UTR and specifically contributes to osk mRNA stability and oocyte accumulation, Dev. Biol. 357 (2011) 404–418. [34] E. Hornstein, H. Harel, G. Levy, O. Meyuhas, Overexpression of poly(A)-binding protein down-regulates the translation or the abundance of its own mRNA, FEBS Lett. 457 (1999) 209–213. [35] H. Kleinert, C. Euchenhofer, G. Fritz, I. Ihrig-Biedert, U. Forstermann, Involvement of protein kinases in the induction of NO synthase II in human DLD-1 cells, Br. J. Pharmacol. 123 (1998) 1716–1722. [36] P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction, Anal. Biochem. 162 (1987) 156–159. [37] H. Kleinert, C. Euchenhofer, I. Ihrig Biedert, U. Forstermann, Glucocorticoids inhibit the induction of nitric oxide synthase II by down-regulating cytokineinduced activity of transcription factor nuclear factor-kB, Mol. Pharmacol. 49 (1996) 15–21. [38] N. Schmidt, A. Pautz, J. Art, P. Rauschkolb, M. Jung, G. Erkel, M.B. Goldring, H. Kleinert, Transcriptional and post-transcriptional regulation of iNOS expression in human chondrocytes, Biochem. Pharmacol. 79 (2010) 722–732. [39] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method, Methods 25 (2001) 402–408. [40] G.M. Wilson, G. Brewer, Identification and characterization of proteins binding A + U-rich elements, Methods 17 (1999) 74–83. [41] R. Windoffer, A. Kolsch, S. Woll, R.E. Leube, Focal adhesions are hotspots for keratin filament precursor formation, J. Cell Biol. 173 (2006) 341–348. [42] M.E. de Vera, R.A. Shapiro, A.K. Nüssler, J.S. Mudgett, R.L. Simmons, S.M. Morris Jr., T.R. Billiar, D.A. Geller, Transcriptional regulation of human inducible nitric oxide synthase (NOS2) gene by cytokines: initial analysis of the human NOS2 promoter, Proc. Natl. Acad. Sci. USA 93 (1996) 1054–1059. [43] G. Singh, T.A. Cooper, Minigene reporter for identification and analysis of cis elements and trans factors affecting pre-mRNA splicing, Biotechniques 41 (2006) 177–181. [44] C. Grosset, C.Y. Chen, N. Xu, N. Sonenberg, H. Jacquemin-Sablon, A.B. Shyu, A mechanism for translationally coupled mRNA turnover: interaction between the poly(A) tail and a c-fos RNA coding determinant via a protein complex, Cell 103 (2000) 29–40. [45] C.Y. Chen, A.B. Shyu, AU-rich elements: characterization and importance in mRNA degradation, Trends Biochem. Sci. 20 (1995) 465–470. [46] T. Bakheet, M. Frevel, B.R. Williams, W. Greer, K.S. Khabar, ARED: human AUrich element-containing mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins, Nucleic Acids Res. 29 (2001) 246– 254. [47] A.B. Shyu, J.G. Belasco, M.E. Greenberg, Two distinct destabilizing elements in the c-fos message trigger deadenylation as a first step in rapid mRNA decay, Genes Dev. 5 (1991) 221–231. [48] N. Xu, C.Y. Chen, A.B. Shyu, Modulation of the fate of cytoplasmic mRNA by AUrich elements: key sequence features controlling mRNA deadenylation and decay, Mol. Cell. Biol. 17 (1997) 4611–4621. [49] M. Gao, C.J. Wilusz, S.W. Peltz, J. Wilusz, A novel mRNA-decapping activity in HeLa cytoplasmic extracts is regulated by AU-rich elements, EMBO J. 20 (2001) 1134–1143.

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944

YNIOX 1290

No. of Pages 12, Model 5G

31 May 2013 12 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959

I. Casper et al. / Nitric Oxide xxx (2013) xxx–xxx

[50] E.M. Hollams, K.M. Giles, A.M. Thomson, P.J. Leedman, MRNA stability and the control of gene expression: implications for human disease, Neurochem. Res. 27 (2002) 957–980. [51] W. Zhang, B.J. Wagner, K. Ehrenman, A.W. Schaefer, C.T. DeMaria, D. Crater, K. DeHaven, L. Long, G. Brewer, Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1, Mol. Cell. Biol. 13 (1993) 7652–7665. [52] C.M. Brennan, J.A. Steitz, HuR and mRNA stability, Cell. Mol. Life Sci. 58 (2001) 266–277. [53] R. Gherzi, K.Y. Lee, P. Briata, D. Wegmuller, C. Moroni, M. Karin, C.Y. Chen, A KH domain RNA binding protein, KSRP, promotes ARE-directed mRNA turnover by recruiting the degradation machinery, Mol. Cell 14 (2004) 571–583. [54] G. Stoecklin, X.F. Ming, R. Looser, C. Moroni, Somatic mRNA turnover mutants implicate tristetraprolin in the interleukin-3 mRNA degradation pathway, Mol. Cell. Biol. 20 (2000) 3753–3763.

[55] H.A. Meijer, A.A. Thomas, Control of eukaryotic protein synthesis by upstream open reading frames in the 50 -untranslated region of an mRNA, Biochem. J. 367 (2002) 1–11. [56] M. Schmid, T.H. Jensen, The exosome: a multipurpose RNA-decay machine, Trends Biochem. Sci. 33 (2008) 501–510. [57] T.M. Franks, J. Lykke-Andersen, The control of mRNA decapping and P-body formation, Mol. Cell 32 (2008) 605–615. [58] M. Brook, L. McCracken, J.P. Reddington, Z.L. Lu, N.A. Morrice, N.K. Gray, The multifunctional poly(A)-binding protein (PABP) 1 is subject to extensive dynamic post-translational modification, which molecular modelling suggests plays an important role in co-ordinating its activities, Biochem. J. 441 (2012) 803–812.

Please cite this article in press as: I. Casper et al., Post-transcriptional regulation of the human inducible nitric oxide synthase (iNOS) expression by the cytosolic poly(A)-binding protein (PABP), Nitric Oxide (2013), http://dx.doi.org/10.1016/j.niox.2013.05.002

960 961 962 963 964 965 966 967 968 969 970 971 972