- Email: [email protected]
HA in a sheep model
Tissue and Cell 46 (2014) 152–158
Contents lists available at ScienceDirect
Tissue and Cell journal homepage: www.elsevier.com/locate/tice
Posterolateral spinal fusion with ostegenesis induced BMSC seeded TCP/HA in a sheep model B.S. Shamsul a , K.K. Tan b , H.C. Chen c , B.S. Aminuddin d,a , B.H.I. Ruszymah a,e,∗ a
Tissue Engineering Centre, Universiti Kebangsaan Malaysia Medical Centre, Malaysia Orthopedic and Spinal Surgery Consultant Clinic, Johor Specialist Hospital, Malaysia Faculty of Veterinary Medicine, Universiti Putra Malaysia, Malaysia d Ear, Nose & Throat Consultant Clinic, Ampang Puteri Specialist Hospital, Malaysia e Department of Physiology, Medical Faculty Universiti Kebangsaan Malaysia, Malaysia b c
a r t i c l e
i n f o
Article history: Received 8 April 2013 Received in revised form 6 February 2014 Accepted 6 February 2014 Available online 12 February 2014 Keywords: Bone tissue engineering Hydroxyapatite Tricalcium phosphate Spinal fusion Fibrin
a b s t r a c t Autogenous bone graft is the gold standard for fusion procedure. However, pain at donor site and inconsistent outcome have left a surgeon to venture into some other technique for spinal fusion. The objective of this study was to determine whether osteogenesis induced bone marrow stem cells with the combination of ceramics granules (HA or TCP/HA), and fibrin could serve as an alternative to generate spinal fusion. The sheep’s bone marrow mesenchymal stem cells (BMSCs) were aspirated form iliac crest and cultured for several passages until confluence. BMSCs were trypsinized and seeded on hydroxyapatite scaffold (HA) and tricalcium phosphate/hydroxyapatite (TCP/HA) for further osteogenic differentiation in the osteogenic medium one week before implantation. Six adult sheep underwent three-level, bilateral, posterolateral intertransverse process fusions at L1–L6. Three fusion sites in each animal were assigned to three treatments: (a) HA constructs group/L1–L2, (b) TCP/HA constructs group/L2–L3, and (c) autogenous bone graft group/L5–L6. The spinal fusion segments were evaluated using radiography, manual palpation, histological analysis and scanning electron microscopy (SEM) 12 weeks post implantation. The TCP/HA constructs achieved superior lumbar intertransverse fusion compared to HA construct but autogenous bone graft still produced the best fusion among all. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Posterolateral spinal fusion is used in the treatment of degenerative spinal disorders. Autogenous bone is the most effective graft material for spinal fusion; however, donor site morbidity is a major limitation of clinical use (Fernyhough et al., 1992). To avoid this limitation, there is an increasing trend toward the use of synthetic bone graft substitutes. An ideal bone graft substitute should be biocompatible and mimic the native characteristics of autogenous bone grafts, which serve as reservoirs of cells that are capable of differentiating into osteoblasts and provide bioresorbable osteoconductive matrices that function as scaffolds for vascular ingress, and cell infiltration and attachment (Kruyt et al., 2004a,b,c). Many studies have demonstrated the ability of bone
∗ Corresponding author at: Tissue Engineering Centre, Universiti Kebangsaan Malaysia Medical Centre, Jalan Yaacob Latiff, Cheras, Kuala Lumpur 56000, Malaysia. Tel.: +60 3 91457670; fax: +60 3 91457678. E-mail addresses: [email protected], [email protected] (B.H.I. Ruszymah). http://dx.doi.org/10.1016/j.tice.2014.02.001 0040-8166/© 2014 Elsevier Ltd. All rights reserved.
marrow-derived mesenchymal stem cells (BMSCs) to differentiate into bone, cartilage, muscle, tendon, and other tissues (Pittenger et al., 1999; Krebsbach et al., 1998; Frederic Shapiro, 2008). BMSCs have been shown to augment the process of bone healing, and some authors have reported that MSC and porous ceramic composites enhance bone healing when compared with those comprising porous ceramics alone (Bruder et al., 1998; Cinotti et al., 2004). An BMSC-loaded scaffold may provide both osteoinductive stimulants and osteoconductive properties. BMSCs combined with appropriate scaffolding material can provide an alternative to autogenous bone grafting (Bruder et al., 1998) and various types of scaffolding materials have been used for MSCs carrier. Our group (Angela et al., 2005, 2008; Chowdhury et al., 2012; Tan et al., 2005) and many others have explored the use of bone graft substitutes and graft extenders using a number of animal models (Schliephake et al., 2001a,b; Wang et al., 2005; Torigoe et al., 2009; Sulaiman et al., 2013). The rate of resorption of a bone graft substitute is important for successful and robust fusion. Material that is not resorbed or resorbed over a prolonged time would result in less space for the fusion mass to form and hence weaken the fusion for any given volume. On the other hand, a
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
graft material that is designed to resorb in a coordinated manner with new bone formation would be beneficial. In other words, as new bone is formed on the scaffold, the scaffold would be taken away as the new bone is formed o the scaffold. The successful use of calcium phosphate either alone or in combination with other materials had been demonstrated in well-vascularised regions with surrounding periosteum, such as long bone defects, the calvaria and the mandible (Schliephake et al., 2001a,b). Tang et al. (2003) and Wilson et al. (2006) showed that porous ceramics combined with BMSCs achieved lumbar interbody fusion superior to cell-free ceramic grafts and autogenous bone grafts. In this study we aimed to evaluate the bone tissue formation in TCP/HA and HA granules, utilizing BMSC as a cell source and fibrin as a cell transplantation matrix, after implanted in sheep. Fibrin, clinically applied as fibrin glue, is a natural polymer that forms during blood coagulation. Fibrin has been widely used for cartilage and bone reconstruction purposes (Munirah et al., 2007; Angela et al., 2008). Our previous results have shown that fibrin was an ideal cell transplantation matrix and remarkably enhanced the cell growth (Seet et al., 2012). Endres et al. (2007) showed that the 3D arrangement of human articular chondrocytes in human fibrin glue and resorbable polyglycolic acid (PGA) scaffolds, cultured in the presence of human serum, is an excellent system for the maturation of cartilage grafts in articular cartilage regeneration. This study developed a composite made of a commercially available porous hydroxyapatite (HA) or tricalcium phosphate/hydroxyapatite (TCP/HA) together with autologous fibrin as a BMSCs carrier. We propose the use of these materials in the development of BMSC-loaded HA or TCP/HA scaffold for osteogenesis and demonstrated the use of this bone substitute for posterolateral spinal fusion in a sheep model. 2. Materials and methods 2.1. Experimental design Six healthy male sheep (age, 6–12 months), weighing between 25 and 28 kg, were used. All animal procedures were performed in accordance to the guidelines of the Universiti Kebangsaan Malaysia Animal Ethical Committee (UKMAEC) with the approval number ORTHO/2003/TAN/22-SEPTEMBER/122. Each animal underwent three level, bilateral, posterolateral intertransverse process fusions at L1–L2 and L3–L4 and L5–L6 and each segment were assigned to three treatments: (a) HA constructs group/L1–L2, (b) TCP/HA constructs group/L3–L4 and (c) autogenous bone graft group/L5–L6. Six animals were used and each treatment modality had six segments. 2.2. Quantitative gene expression of sheep BMSCs in a monolayer culture Gene expression for BMSC extracellular matrix components (type I collagen and Osteopontin) was quantitatively analyzed with a real-time PCR technique. The expression level of each targeted gene was normalized to GAPDH. Primers for sheep GAPDH (forward 5 CTGGTGCTGAGTACGTGGTG3 , reverse 5 CGTCAGCAGAAGGTGCAGAG3 ), type I collagen (forward 5 CGGCTCCTGCTCCTCTTAG3 , reverse 5 CTGTACGCAGGTGACTGGTG3 ) and osteopontin (forward 5 GTCCAGATGCCACAGAGGAG3, reverse 5 GGCCTTTGGCGTGAGTTC3 ) were designed with Primer3 software (Citation) and searched against sequences in GenBank database to obtain primers with high specificity. The efficiency and specificity of each primer set was confirmed with a standard curve (Ct value versus serial dilution of total RNA) and melting profile evaluation. Real-time PCR was performed with 100 ng of total RNA, 400 nM of each primer and iScript One-Step RT-PCR kit with
153
SYBR Green (Bio-Rad) according to the manufacturer’s instruction. Reactions were run using a Bio-Rad iCycler using the following conditions: cDNA synthesis for 30 min at 50 ◦ C; pre-denaturation for 2 min at 94 ◦ C; PCR amplification for 38 cycles with 30 s at 94 ◦ C, 30 s at 60 ◦ C and 30 s at 72 ◦ C. This series of cycles was followed by a melting curve analysis to check the reaction specificity. The expression level of each targeted gene was normalized to GAPDH and then analyzed for statistical analysis. The data for BMSC gene expression of Collagen type I and Osteopontin genes relative to housekeeping gene, GAPDH, in each medium at every passage (P0, P1, P2 and P3) were obtained (n = 6). Values are presented as the mean (±0.05) – standard error of mean (SEM). The student’s t-test was used to compare data between groups. Differences at 5% level were considered significant. The same procedure was applied to the in vitro and in vivo constructs as well. 2.3. Preparation of engineered bone constructs Bone marrow was obtained by iliac crest aspiration from the six sheep 15 days before the implantation procedure. The animals were anesthetized under sterile conditions, and a 16-gauge Jamshidi needle (Cardinal Health, Dublin, OH) was used to aspirate 12–15 mL of bone marrow. This marrow aspirate was collected into two 20-mL syringes, each containing 1.5 mL of heparinised (250 units/mL) saline solution. The syringes were detached and inverted several times to ensure complete mixing. The suspension was centrifuged at 1000 rpm (180 × g) for 5 min and the supernatant was removed. The bone marrow was then resuspended in culture medium and seeded in two 75-cm2 culture flasks (Orange Scientific, Belgium). The osteogenic medium consisted of highglucose Dulbecco’s modified Eagle’s medium (high-glucose DMEM) (GIBCO Laboratories, Grand Island, NY) supplemented with 10% fetal bovine serum (HyClone, Logan, UT), glutamine (1 mM), penicillin G (100 U/mL), streptomycin sulphate (100 g/mL), 10–8 M dexamethasone (Sigma, St. Louis, MO), 10 mM sodium -glycerol phosphate (Sigma) and l-ascorbic acid (50 g/mL; Sigma). Threefourths of the culture medium was changed after five days, and non-adherent cells were removed along with the culture medium. Medium was then replaced twice weekly. When cultures became almost confluent, the cells were detached and serially sub-cultured. After 14 days of cell culture, the adherent MSCs were defined as osteoblast-like cells by the determination of osteoblast markers (production of mineralized matrix, collagen I, and osteopontin expression) (6). Passage 1 autologous sheep MSCs in culture flask were then rinsed twice with phosphate buffer saline solution, trypsinized with 2 mL of 0.2% trypsin, concentrated by centrifugation at 1000 rpm (180 × g) for 10 min, and diluted to 1 mL of cell suspension (3 × 106 cells/mL) in autologous sheep plasma for seeding into ceramic grafts. The commercial HA and TCP/HA used in this study has the following characteristics: HA: derived from natural sources with average granule size of 1.8-3.0mmTCP/HA: synthetic with 80% TCP and 20% HA and an average granule size of 1.5–3.0 mm. HA and TCP/HA granules were first pre-wetted with sheep plasma. A total of 5–6 × 107 MSCs were then mixed with 6 ml of sheep plasma and dropped onto the pre-wetted granules. These mixtures were then placed into a 25 cm3 flask, which acted as the mold in order to shape the construct 2 × 5 × 0.4 cm3 size. Polymerization of fibrin in the plasma was initiated by addition of 25 l 250 mM CaCl2 . The polymerized cell-seeded granules were immersed further in osteogenic medium to induce osteogenic differentiation a week before implantation. 2.4. Preparation of autologous plasma For preparation of autologous plasma, whole blood was collected into a sterile tube containing citrate phosphate dextrose
154
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
(CPD) solution (2.63% sodium citrate, 0.32% citric acid, 2.32% dextrose, and 0.25% sodium dihydrogen phosphate) with one-ninth volume of the collected blood as an anti-coagulant. The blood was centrifuged at 800 × g for 10 min, and the upper layer, including plasma and the buffy coat (mostly white blood cells and platelets) was transferred to another tube. This tube was further centrifuged at 1500 × g for 10 min to pellet the buffy coat and the upper layer was filtered into a new tube using a 0.2-m syringe filter. 2.5. Surgical procedure The sheep were anesthetized intravenously with 10 mg/kg ketamine hydrochloride and 0.1 mg/kg medetomidine hydrochloride followed by general anesthesia using halothane and oxygen to control ventilation. Orthopedic and veterinary surgeons performed the surgical procedure. After placing in a prone position, the animals were shaved, prepped with Povidone-iodine, habitant spirit and draped. Each animal received antibiotic (Betamox) and NSAID (meloxican) preoperatively. Under a midline incision through the skin and lumbodorsal fascia, bilateral subperiosteal dissection was performed to expose the spine from L1 to L6 bilaterally up to the transverse process. The transverse processes were then decorticated using the rongeur, and the engineered constructs were placed directly across the exposed transverse process. Each animal received three treatments at the L1–L2, L3–L4 and L5–L6 disk spaces, and the L2–L3 and L4–L5 disk remained intact. Approximately 1.5–2.0 cm3 of corticocancellous iliac crest bone graft, which is the autogenous bone graft, was harvested from the left anterior iliac crest previously. The engineered constructs or autogenous bone graft was then inserted with finger pressure or gentle impaction. Bone constructs were placed along the spinal cord and across transverse process. Segments were immobilized together using triple wiring technique, where necessary and performed on the affected spinal process. K wire was use to tighten up the involved spinal process (L1–L2, L3–L4 and L5–L6). Homeostasis was secured and the wound was closed without drainage. 2.6. Post-operative care Sheep were placed in the intensive care ward for seven days, and temperature, pulse and respiration (TPR) and appetite, bowel, urine (ABU) were monitored closely. During this time, a seven-day course of antibiotics, anti-inflammatory and analgesic drugs were administered. Upon discharge from the intensive care ward, TPR and ABU were monitored weekly. Sheep were euthanized at the end of 12 weeks, and the appropriate vertebrae were harvested for analysis. 2.7. Radiographic analysis Fusion of the grafted areas of all sheep was evaluated radiographically at 12 weeks after surgery. The following parameters were used in obtaining the radiographs: the distance of tube to Medical Imaging film (MI-NP 30; Fujifilm Co., Tokyo, Japan) was 110 cm, the radiograph exposure was 55 kV, 20 mA, and 0.4 s. The fusion was evaluated as solid or not solid by 2 blinded observers, based on the presence of a continuous trabecular pattern within the intertransverse fusion mass. They were graded as solid only when both observers agreed.
Fig. 1. Collagen type 1 was highly expressed at P0 (2.21 ± 1.02) and P1 (2.60 ± 0.94), but decreased at P2 (0.47 ± 0.28), p < 0.05 compared to P1 and at P3 (0.70 ± 0.34), p < 0.05 compared to P1. Osteopontin expression was highest at P1 (0.22 ± 0.14) and significant (p < 0.05) compared to P0 (0.05 ± 0.03), P2 (0.04 ± 0.02) and P3 (0.06 ± 0.04).
serially in xylol, and embedded in paraffin. Sections of approximately 5 m were then stained with Alizarin Red. NIS-Element microscope imaging software was used to calculate the percentage of new bone formation in both constructs. The calculation was done according to this equation: New bone area in the image × 100 = % of new bone formation Total bone area in the image 2.9. Scanning electron microscopy Constructs were harvested at 12 weeks post-implantation. For SEM analysis, samples were randomly chosen in every part of the construct. Samples were cut into 1-cm3 slices, which were immediately transferred into small vials and immersed in 2.5% glutaraldehyde. The tubes were incubated at 4 ◦ C for at least 24 h (overnight). This was followed by three changes of 0.1 M sodium cacodylate for 10 minutes each. The samples were then post-fixed with 1% osmium tetraoxide for 2 h at 4 ◦ C. Next, the samples were dehydrated in a gradually increasing gradient of acetone (35%, 50%, 75%, 95% for 10 min each and 3 changes of 100% for 15 min). Once dehydrated, the samples were transferred into a specimen basket immersed in 100% acetone and dried in a critical point dryer (Baltec 030 CPD) for approximately 30 min. 3. Result 3.1. Quantitative gene expression of sheep BMSCs Gene expression analysis on cells after 14 days of monolayer culture showed that P1 have the highest gene expression for collagen type 1 and osteopontin genes compared to P0, P2 and P3. As shown in Fig. 2, differentiation process after a few passages affected cell phenotypes. The mRNA expression level decreased in proportion to the number of subcultures performed. The expression of collagen type 1 was found to be higher at P0 (2.21 ± 1.02) and P1 (2.60 ± 0.94). However, its expression level significantly decreased (p < 0.05) at P2 (0.47 ± 0.28) and P3 (0.70 ± 0.34), which were approximately 82% and 73% lower than that at P1 In case of osteopontin, the expression was higher at P1 (0.22 ± 0.14) and significantly higher (p < 0.05) compared to P0 (0.05 ± 0.03), P2 (0.04 ± 0.02) and P3 (0.06 ± 0.04).
2.8. Histology 3.2. Gross and radiograph view About 1.0 cm3 of the engineered bone constructs were cut for histological examination. All samples were fixed in 10% phosphate buffer formalin. Samples were decalcified by immersion in 10% EDTA solution, dehydrated with a graded series of ethanol, soaked
The gross view of the harvested segments (L1–L6) showed that the TCP/HA constructs had better bone formation compared to HA construct. Approximately 10% to 20% initial seeded granules can
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
155
55.8% of new bone formation was generated (Fig. 4D). There was no sign of inflammation or giant cell reaction. There was direct contact between the TCP-HA implant and surrounding bone tissue. No fibrous tissue was observed between the implant area and the original bone. Autogenous bone graft showed homogenous bone formation, which completely fused with the native bone (Fig. 4). 3.4. Scanning electron microscopy
Fig. 2. The engineered bone constructs (TCP/HA with induced BMSC and HA induced BMSC) and autogenous bone graft were placed along the spinal cord and across the transverse process. Segments were immobilized together using triple wiring technique.
be seen in the TCP/HA constructs (Fig. 3B) Fig. 3 compared to HA construct (Fig. 3C) that was about 80% granules. In autogenous bone graft group, solid bone fusion was observed (Fig. 3A). Radiograph revealed complete fusion in the autogenous bone graft group (Fig. 3D). Some form of trabecular formation was seen in TCP/HA constructs and HA constructs (Fig. 3E and F). The fusion rates were 1 of 6 sheep in the HA construct group and 5 of 6 sheep in the TCP/HA construct group. 3.3. Histological analysis Histological sections revealed a larger area of bone formation with embedded lacunae-like cells for the TCP/HA construct, which stained homogeneously for Alizarin Red (red), compared to HA constructs. By using the NIS-Element microscope imaging software, we calculated the percentage of new bone formation for both construct. Results have showed that, 42.7% of new bone was discovered in TCP/HA constructs and 10.7% was counted for HA constructs. However, in autogenous bone group showed that
SEM analysis showed the formation of thick collagen fibers encapsulating TCP-HA construct (Fig. 5A). It is suspected that the calcification had commenced with the formation of thick collagen fibers, which phenomenon was not found in HA constructs, as shown in Fig. 5B. In the toluidine blue staining large area of ceramics residue was observed in HA construct with minimal formation of bone development (Fig. 5E). For TCP/HA construct, bone development had taken place all over the construct (Fig. 5D). Autogenous bone graft completely resemble like native bone with osteocytes occurrence (Fig. 5C and F). 4. Discussion Spinal fusion is usually performed using autogenous bone grafts taken from the ilium. The cancellous bone of the ilium has rich blood supply and high cellularity, making it very useful for bone reconstructive procedures such as spinal fusion. In this study, we used cancellous bone graft as a gold standard in order to justify whether TCP/HA or HA together with fibrin and osteogenesis induced BMSCs could achieve spinal fusion. Favorable results were obtained in TCP/HA as compared to HA for fusion mass formation. This success is attributed to the used of osteogenic induced BMSC and fibrin as the cells carrier. The in vitro expansion of BMSC cells is an important aspect of tissue engineering as this allows the generation of a large number of cells from minimal starting materials. However, the key problem is that cells dedifferentiate
Fig. 3. Radiographs and gross view 12 weeks after lumbar intertransverse process arthrodesis in six sheep (A and D) in the autogenous bone graft (B and E), HA construct and (C and F) TCP/HA construct. Radiographs in each example show a continuous trabecular fusion mass pattern in the intertransverse area. The autogenous bone graft achieved full fusion. TCP/HA construct achieved fusion in five groups and HA construct achieved fusion only in one group. The ceramics granule can still be seen at TCP/HA and HA fusion site.
156
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
Fig. 4. Histological interface between implanted area (new bone formation/NB) and vertebral/V body in sheep (A) TCP/HA construct, (B) HA construct and (C) Autogenous bone graft. The implant showed direct contact to vertebral trabeculae without any sign of inflammation or giant cell reaction in both HA and TCP/HA construct. Fusion is complete in the autogenous bone group, no demarcation was seen between the vertebrae and new bone. 55.8% of new bone was spotted in autogenous bone group, followed by TCP/HA group 42.7% and 10.7% for HA group (D). Direct contact of new bone and natural bone is shown by the black arrow (→).
and age during in vitro expansion, leading to the loss of their native phenotype (Fischgrund et al., 2009; Smucker et al., 2008a; Szpalski et al., 2012). After 14 days of cell expansion in monolayer culture, passage 1 gene expression for collagen type 1 and ostepontin were significantly higher compared to the other passages as shown
in Fig. 1. Therefore P1 cells are ideal candidates to create a bone construct. In in vivo level after 12 weeks of post implantation, TCP/HA construct demonstrated better bone formation compared to HA construct. The autogenous bone graft formed rigid fusion.
Fig. 5. SEM analysis in TCP/HA (A), HA (B) construct and autogenous bone graft (C) followed by the light micrographs of semi thin sections stained in toluidine blue for TCP/HA (D) HA (E) construct and autogenous bone graft (F). Minimal bone regeneration can be seen in HA construct when compared with TCP/HA construct. Ceramics residue was still intact in both construct but minimal in TCP/HA construct. Collagen fiber appeared in TCP/HA construct but not in HA construct. Autogenous bone graft completely resemble like native bone with osteocytes occurrence.
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
However, autogenous bone grafts can result in donor site morbidity such a severe pain at the donor site. The ilium has rich blood supply therefore, graft collection causes considerable bleeding and careful hemostasis is necessary to prevent protracted postoperative hemorrhage (Wilson et al., 2006). The ilium is more susceptible to fracture after graft collection, and a fall after surgery may cause pelvic fracture or stress fracture (Kruyt et al., 2004a,b,c). During graft collection, the femoral cutaneous nerve may be damaged near the iliac crest, leading to meralgia (Ahlmann et al., 2000). For that, bone tissue engineering has emerged as a better alternative in treating patients. Reconstruction using tissue-engineered bone is free from the problems accompanying graft collection. It only involves the minimally invasive procedure of bone marrow aspiration and is less burdensome for patients. For the surgeon, the method has the advantage of shortening the operating time because there is no need for graft collection. Postoperative pain is reduced dramatically and the time needed for rehabilitation is shortened, leading to early discharge from intensive care. The results from this study indicated that both HA and TCP/HA with osteogenically induced BMSCs with fibrin can improve the osteogenic potential of porous ceramics. This is consistent with the observations of previous studies (Kruyt et al., 2004a,b,c; Chan et al., 2010), which showed that cultured BMSCs loaded on to porous ceramic forms more new bone tissue especially for TCP/HA construct compared to the HA construct. This engineered bone can heal critical-sized osseous defects and achieve spinal fusion in various animals, such as rabbits (Smucker et al., 2008b), goat (Kruyt et al., 2004a,b,c) and rhesus monkeys (Wang et al., 2005). More ceramic residues are found in the HA construct group compared to TCP/HA construct group due to the higher biodegradation rate of ceramics for TCP/HA granules compared to HA granules. In radiography analysis, the result has shown that there are visible granules of HA and TCP/HA on the transverse process. However, TCP/HA construct has formed better bone at 12 weeks after implantation. Numerous cells were found within the central area of the graft bed in the MSCs group. This newly formed bone may be facilitated through the biodegradation of ceramics via body fluidmediated and cell mediated mechanisms as suggested by Niehoff et al. (2008) while new matrix was laid by the implanted cells. The mechanism of bone formation in TCP/HA bone constructs involved a process known as collagen calcification, albeit in a disoriented manner (Zimmermann et al., 1991). Previous studies reported that development of osteoblasts along the osteogenic pathway progresses with the development of the extracellular matrix through three phases: cell proliferation with ECM secretion, ECM maturation and ECM mineralization. The mechanism of calcification in HA constructs differed in a few ways. Flattened cells were seen to gradually transform into mineralized sheets (Phang et al., 2004). Angela et al. made a similar observation in 2005 wherein various calcified accretions were formed from these mineralized sheets, which then broke off to fuse with other nodules to produce the overall bone-like matrix. However, this phenomenon occurred within a small region of the HA constructs. In our SEM observation, thick collagen fibers were found encapsulating TCP-HA constructs, a phenomenon not found in HA constructs. Moreover, the sheep fibrin prepared in our laboratory is a suitable cell carrier and acts as a temporary scaffold for the formation of stable constructs in bone tissue engineering. It fulfills the criteria of being biocompatible, osteoinductive and resorbable (Angela et al., 2005, 2008). Due to its lack of mechanical strength, its usage may be limited to non-load bearing or minor bone defects. Torigoe et al., 2009 investigated the effect of autologous fibrin and bone marrow on -tricalcium phosphate on a monkey ectopic bone formation model. They found autologous plasma efficiently promotes osteogenesis. Our laboratory has developed a system that eliminates the addition of bovine thrombin as used in other studies (Schliephake
157
et al., 2001a,b). This reduces the risk of immune rejection after transplantation and the risk of contamination. 5. Conclusion Posterolateral spinal fusion can be achieved better with TCP/HA granule mixed with osteogenically induced MSCs with fibrin compared to HA. However, autogenous bone graft produced the best fusion among all. Conflict of interest The authors declare no conflicts of interest. Acknowledgements This study was funded by grants from the Ministry of Science Technology and Innovation of Malaysia 06-02-02-0059-EA292 and 06-02-02-003 BTK/ER/022. References Ahlmann, E., Patzakis, M., Roidis, N., Shepherd, L., Holtom, P., 2000. Comparison of anterior and posterior iliac crest bone grafts in terms of harvest-site morbidity and functional outcomes. J. Bone Joint Surg. Am. 84A, 716–720. Angela, Ng M.H., Aminuddin, B.S., Tan, K.K., Tan, G.H., Sabarul Afian, M., Fauziah, O., Ruszymah, B.H.I., 2005. Comparison of bioengineered human bone construct from four sources of osteogenic cells. J. Orthop. Sci. 10, 192–199. Angela, Ng M.H., Tan, K.K., Phang, M.Y., Aziyati, O., Tan, G.H., Isa, M.R., Naseem, M., Fauziah, O., Aminuddin, B.S., Ruszymah, B.H.I., 2008. Differential osteogenic activity of osteoprogenitor cells on HA and TCP/HA scaffold engineered bone. Biomed. Mater. Res. 85A, 301–312. Bruder, S.P., Jaiswal, N., Ricalton, N.S., Mosca, J.D., Kraus, K.H., Kadiyala, S., 1998. Mesenchymal stem cells in osteo-biology and applied bone regeneration. Clin. Orthop. Relat. Res. 355S, S247–S256. Chan, B.P., Hui, T.Y., Wong, M.Y., Yip, K.H.K., Chan, G.C.F., 2010. Mesenchymal stem cell-encapsulated collagen microspheres for BTE. Tissue Eng. C Methods 16, 225. Chowdhury, S.R., Ng, M.H., Hassan, N.S.A., Aminuddin, B.S., Ruszymah, B.H.I., 2012. Identification of suitable culture condition for expansion and osteogenic differentiation of human bone marrow stem cells. Hum. Cells 25 (3), 69–77. Cinotti, G., Patti, A.M., Vulcano, A., Della Rocca, C., Polveroni, G., Giannicola, G., Postacchini, F., 2004. Experimental posterolateral spinal fusion with porous ceramics and mesenchymal stem cells. J. Bone Joint Surg. Br. 86, 135–142. Fernyhough, J.C., Schimandle, J.H., Weigel, M.C., Edwards, C.C., Levine, A.M., 1992. Chronic donor site pain complicating bone graft harvesting from the posterior iliac crest for spinal fusion. Spine 17, 1474–1480. Fischgrund, J.S., James, S.B., Chabot, M.C., et al., 2009. The use of bone morphogenic protein in lumbar spine surgery. Instruct. Course Lect. 58, 677–688. Frederic Shapiro, 2008. Bone development and its relation to fracture repair. The role of mesenchymal osteoblast and surface osteoblast. Eur. Cells Mater. 15, 53–76. Krebsbach, P.H., Mankani, M.H., Satomuta, K., Kuznetsov, S.A., Robey, P.G., 1998. Repair of craniotomy defects using bone marrow stromal cells. Transplantation 66, 1272–1278. Kruyt, M.C., De Bruijn, J.D., Yuan, H., Van Blitterswijk, C.A., Verbout, A.J., Oner, F.C., Dhert, W.J., 2004a. Optimization of bone tissue engineering in goats: a peroperative seeding method using cryopreserved cells and localized bone formation in calcium phosphate scaffolds. Transplantation 77, 359–365. Kruyt, M.C., Dhert, W.J., Yuan, H., Wilson, C.E., van Blitterswijk, C.A., Verbout, A.J., de Bruijn, J.D., 2004b. Bone tissue engineering in a critical size defect compared to ectopic implantations in the goat. J. Orthop. Res. 22, 544–551. Kruyt, M.C., Gaalen, S.M.V., Oner, F.C., Verbout, A.J., de Bruijn, J.D., Dhert, W.J., 2004c. Bone tissue engineering and spinal fusion: the potential of hybrid constructs by combining osteoprogenitor cells and scaffolds. Biomaterials 25, 1463–1473. Munirah, S., Samsudin, O.C., Chen, H.C., Sharifah Salmah, S.H., Aminuddin, B.S., Ruszymah, B.H.I., 2007. Articular cartilage restoration in load-bearing osteochondral defects by implantation of autologous chondrocyte-fibrin constructs. An Experimental Study in Sheep. J Bone Joint Surg [Br]. 89-B, 1099–1109. Niehoff, P., Springer, I.N., Ac¸il, Y., Lange, A., Matthias, M.J., Roldán, C.J., Köppe, K., Warnke, P.H., Bernhard, K., Wiltfang, J., 2008. HDR brachytherapy irradiation of the jaw—as a new experimental model of radiogenic bone damage. J. CranioMaxillofac. Surg. 36, 203–209. Phang, M.Y., Angela Ng, M.H., Fuzina, H., Aminuddin, B.S., Ruszymah, B.H.I., Fauziah, O., 2004. Looking into the microstructure of biomaterials and its inhabitants in engineered bone tissue. J. Electron Microsc. Malays. 1, 73–79. Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W., Craig, S., Marshak, D.R., 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284, 143–147. Schliephake, H., Knebel, J.W., Aufderheide, M., Tauscher, M., 2001a. Use of cultivated osteoprogenitor cells to increase bone formation in segmental mandibular
158
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
defects: an experimental pilot study in sheep. Int. J. Oral Maxillofac. Surg. 30, 531–537. Schliephake, H., Knebel, J.W., Aufderheide, M., Tauscher, M., 2001b. Use of cultivated osteoprogenitor cells to increase bone formation in segmental mandibular defects: an experimental pilot study in sheep. Int. J. Oral Maxillofac. Surg. 30 (6), 531–537. Seet, W.T., Maarof, M., Khairul Anuar, K., Chua, K.-H., Ahmad Irfan, A.W., Ng, M.H., Aminuddin, B.S., Ruszymah, B.H.I., 2012. Shelf-life evaluation of bilayered human skin equivalent, MyDermTM . PLoS ONE 7 (8), e40978, http://dx.doi.org/10.1371/journal.pone.0040978. Smucker, J.D., Bobst, J.A., Petersen, E.B., Nepola, J.V., Fredericks, D.C., 2008a. B2a Peptide on ceramic granules enhance posterolateral spinal fusion in rabbits compared with autograft. Spine (Philadelphia, PA) 33, 1324–1329. Smucker, J.D., Bobst, J.A., Petersen, E.B., Nepola, J.V., Fredericks, D.C., 2008b. B2a peptide on ceramic granules enhance posterolateral spinal fusion in rabbits compared with autograft. Spine (Philadelphia, PA) 33 (12), 1324–1329. Sulaiman, S.B., Keong, T.K., Cheng, C.H., Saim, A.B., Idrus, R.B.H., 2013. Tricalcium phosphate/hydroxyapatite (TCP-HA) bone scaffold as potential candidate for the formation of tissue engineered bone. Indian J. Med. Res. 137 (June), 1093–1101. Szpalski, C., Barbaro, M., Sagebin, F., Warren, S.M., 2012. Bone tissue engineering: current strategies and techniques—part II: cell types. Tissue Eng. B 18 (4), http://dx.doi.org/10.1089/ten.teb.2011.0440.
Tan, K.K., Shamsul, B.S., Aminuddin, B.S., Tan, G.H., Angela Ng, M.H., Loqman, M.Y., Chua, K.H., Ruszymah, B.H.I., 2005. Bone graft substitute using hydroxyapatite scaffold seeded with tissue engineered autologous osteoprogenitor cells in spinal fusion: early result in a sheep model. Med. J. Malays. 60 (Suppl. C), 53–58. Tang, K., Guo, S.Q., Dang, G.T., 2003. In vivo evaluation of bone marrow stromalderived osteoblasts porous calcium phosphate ceramic composites as bone graft substitute for lumbar intervertebral spinal fusion. Spine 1 (28), 1653–1658. Torigoe, I., Sotome, S., Tsuchiya, A., Yoshii, T., Maehara, H., Sugata, Y., Ichinose, S., Shinomiya, K., Okawa, A., 2009. Bone regeneration with autologous plasma, bone marrow stromal cells, and porous b-tricalcium phosphate in nonhuman primates. Tissue Eng. A 15, 1489–1499. Wang, T., Dang, G., Guo, Z., Yang, M., 2005. Evaluation of autologous bone marrow mesenchymal stem cells–calcium phosphate ceramic composite for lumbar fusion in rhesus monkey interbody fusion model. Tissue Eng. 11, 1159–1167. Wilson, C.E., Kruyt, M.C., de Bruijn, J.D., van Blitterswijk, C.A., Oner, F.C., Verbout, A.J., Dhert, W.J., 2006. A new in vivo screening model for posterior spinal bone formation: comparison of ten calcium phosphate ceramic material treatments. Biomaterials 27, 302–314. Zimmermann, B., Wachtel, H.C., Noppe, C., 1991. Patterns of mineralization in vitro. Cell Tissue Res. 263 (3), 483–493.
Contents lists available at ScienceDirect
Tissue and Cell journal homepage: www.elsevier.com/locate/tice
Posterolateral spinal fusion with ostegenesis induced BMSC seeded TCP/HA in a sheep model B.S. Shamsul a , K.K. Tan b , H.C. Chen c , B.S. Aminuddin d,a , B.H.I. Ruszymah a,e,∗ a
Tissue Engineering Centre, Universiti Kebangsaan Malaysia Medical Centre, Malaysia Orthopedic and Spinal Surgery Consultant Clinic, Johor Specialist Hospital, Malaysia Faculty of Veterinary Medicine, Universiti Putra Malaysia, Malaysia d Ear, Nose & Throat Consultant Clinic, Ampang Puteri Specialist Hospital, Malaysia e Department of Physiology, Medical Faculty Universiti Kebangsaan Malaysia, Malaysia b c
a r t i c l e
i n f o
Article history: Received 8 April 2013 Received in revised form 6 February 2014 Accepted 6 February 2014 Available online 12 February 2014 Keywords: Bone tissue engineering Hydroxyapatite Tricalcium phosphate Spinal fusion Fibrin
a b s t r a c t Autogenous bone graft is the gold standard for fusion procedure. However, pain at donor site and inconsistent outcome have left a surgeon to venture into some other technique for spinal fusion. The objective of this study was to determine whether osteogenesis induced bone marrow stem cells with the combination of ceramics granules (HA or TCP/HA), and fibrin could serve as an alternative to generate spinal fusion. The sheep’s bone marrow mesenchymal stem cells (BMSCs) were aspirated form iliac crest and cultured for several passages until confluence. BMSCs were trypsinized and seeded on hydroxyapatite scaffold (HA) and tricalcium phosphate/hydroxyapatite (TCP/HA) for further osteogenic differentiation in the osteogenic medium one week before implantation. Six adult sheep underwent three-level, bilateral, posterolateral intertransverse process fusions at L1–L6. Three fusion sites in each animal were assigned to three treatments: (a) HA constructs group/L1–L2, (b) TCP/HA constructs group/L2–L3, and (c) autogenous bone graft group/L5–L6. The spinal fusion segments were evaluated using radiography, manual palpation, histological analysis and scanning electron microscopy (SEM) 12 weeks post implantation. The TCP/HA constructs achieved superior lumbar intertransverse fusion compared to HA construct but autogenous bone graft still produced the best fusion among all. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Posterolateral spinal fusion is used in the treatment of degenerative spinal disorders. Autogenous bone is the most effective graft material for spinal fusion; however, donor site morbidity is a major limitation of clinical use (Fernyhough et al., 1992). To avoid this limitation, there is an increasing trend toward the use of synthetic bone graft substitutes. An ideal bone graft substitute should be biocompatible and mimic the native characteristics of autogenous bone grafts, which serve as reservoirs of cells that are capable of differentiating into osteoblasts and provide bioresorbable osteoconductive matrices that function as scaffolds for vascular ingress, and cell infiltration and attachment (Kruyt et al., 2004a,b,c). Many studies have demonstrated the ability of bone
∗ Corresponding author at: Tissue Engineering Centre, Universiti Kebangsaan Malaysia Medical Centre, Jalan Yaacob Latiff, Cheras, Kuala Lumpur 56000, Malaysia. Tel.: +60 3 91457670; fax: +60 3 91457678. E-mail addresses: [email protected], [email protected] (B.H.I. Ruszymah). http://dx.doi.org/10.1016/j.tice.2014.02.001 0040-8166/© 2014 Elsevier Ltd. All rights reserved.
marrow-derived mesenchymal stem cells (BMSCs) to differentiate into bone, cartilage, muscle, tendon, and other tissues (Pittenger et al., 1999; Krebsbach et al., 1998; Frederic Shapiro, 2008). BMSCs have been shown to augment the process of bone healing, and some authors have reported that MSC and porous ceramic composites enhance bone healing when compared with those comprising porous ceramics alone (Bruder et al., 1998; Cinotti et al., 2004). An BMSC-loaded scaffold may provide both osteoinductive stimulants and osteoconductive properties. BMSCs combined with appropriate scaffolding material can provide an alternative to autogenous bone grafting (Bruder et al., 1998) and various types of scaffolding materials have been used for MSCs carrier. Our group (Angela et al., 2005, 2008; Chowdhury et al., 2012; Tan et al., 2005) and many others have explored the use of bone graft substitutes and graft extenders using a number of animal models (Schliephake et al., 2001a,b; Wang et al., 2005; Torigoe et al., 2009; Sulaiman et al., 2013). The rate of resorption of a bone graft substitute is important for successful and robust fusion. Material that is not resorbed or resorbed over a prolonged time would result in less space for the fusion mass to form and hence weaken the fusion for any given volume. On the other hand, a
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
graft material that is designed to resorb in a coordinated manner with new bone formation would be beneficial. In other words, as new bone is formed on the scaffold, the scaffold would be taken away as the new bone is formed o the scaffold. The successful use of calcium phosphate either alone or in combination with other materials had been demonstrated in well-vascularised regions with surrounding periosteum, such as long bone defects, the calvaria and the mandible (Schliephake et al., 2001a,b). Tang et al. (2003) and Wilson et al. (2006) showed that porous ceramics combined with BMSCs achieved lumbar interbody fusion superior to cell-free ceramic grafts and autogenous bone grafts. In this study we aimed to evaluate the bone tissue formation in TCP/HA and HA granules, utilizing BMSC as a cell source and fibrin as a cell transplantation matrix, after implanted in sheep. Fibrin, clinically applied as fibrin glue, is a natural polymer that forms during blood coagulation. Fibrin has been widely used for cartilage and bone reconstruction purposes (Munirah et al., 2007; Angela et al., 2008). Our previous results have shown that fibrin was an ideal cell transplantation matrix and remarkably enhanced the cell growth (Seet et al., 2012). Endres et al. (2007) showed that the 3D arrangement of human articular chondrocytes in human fibrin glue and resorbable polyglycolic acid (PGA) scaffolds, cultured in the presence of human serum, is an excellent system for the maturation of cartilage grafts in articular cartilage regeneration. This study developed a composite made of a commercially available porous hydroxyapatite (HA) or tricalcium phosphate/hydroxyapatite (TCP/HA) together with autologous fibrin as a BMSCs carrier. We propose the use of these materials in the development of BMSC-loaded HA or TCP/HA scaffold for osteogenesis and demonstrated the use of this bone substitute for posterolateral spinal fusion in a sheep model. 2. Materials and methods 2.1. Experimental design Six healthy male sheep (age, 6–12 months), weighing between 25 and 28 kg, were used. All animal procedures were performed in accordance to the guidelines of the Universiti Kebangsaan Malaysia Animal Ethical Committee (UKMAEC) with the approval number ORTHO/2003/TAN/22-SEPTEMBER/122. Each animal underwent three level, bilateral, posterolateral intertransverse process fusions at L1–L2 and L3–L4 and L5–L6 and each segment were assigned to three treatments: (a) HA constructs group/L1–L2, (b) TCP/HA constructs group/L3–L4 and (c) autogenous bone graft group/L5–L6. Six animals were used and each treatment modality had six segments. 2.2. Quantitative gene expression of sheep BMSCs in a monolayer culture Gene expression for BMSC extracellular matrix components (type I collagen and Osteopontin) was quantitatively analyzed with a real-time PCR technique. The expression level of each targeted gene was normalized to GAPDH. Primers for sheep GAPDH (forward 5 CTGGTGCTGAGTACGTGGTG3 , reverse 5 CGTCAGCAGAAGGTGCAGAG3 ), type I collagen (forward 5 CGGCTCCTGCTCCTCTTAG3 , reverse 5 CTGTACGCAGGTGACTGGTG3 ) and osteopontin (forward 5 GTCCAGATGCCACAGAGGAG3, reverse 5 GGCCTTTGGCGTGAGTTC3 ) were designed with Primer3 software (Citation) and searched against sequences in GenBank database to obtain primers with high specificity. The efficiency and specificity of each primer set was confirmed with a standard curve (Ct value versus serial dilution of total RNA) and melting profile evaluation. Real-time PCR was performed with 100 ng of total RNA, 400 nM of each primer and iScript One-Step RT-PCR kit with
153
SYBR Green (Bio-Rad) according to the manufacturer’s instruction. Reactions were run using a Bio-Rad iCycler using the following conditions: cDNA synthesis for 30 min at 50 ◦ C; pre-denaturation for 2 min at 94 ◦ C; PCR amplification for 38 cycles with 30 s at 94 ◦ C, 30 s at 60 ◦ C and 30 s at 72 ◦ C. This series of cycles was followed by a melting curve analysis to check the reaction specificity. The expression level of each targeted gene was normalized to GAPDH and then analyzed for statistical analysis. The data for BMSC gene expression of Collagen type I and Osteopontin genes relative to housekeeping gene, GAPDH, in each medium at every passage (P0, P1, P2 and P3) were obtained (n = 6). Values are presented as the mean (±0.05) – standard error of mean (SEM). The student’s t-test was used to compare data between groups. Differences at 5% level were considered significant. The same procedure was applied to the in vitro and in vivo constructs as well. 2.3. Preparation of engineered bone constructs Bone marrow was obtained by iliac crest aspiration from the six sheep 15 days before the implantation procedure. The animals were anesthetized under sterile conditions, and a 16-gauge Jamshidi needle (Cardinal Health, Dublin, OH) was used to aspirate 12–15 mL of bone marrow. This marrow aspirate was collected into two 20-mL syringes, each containing 1.5 mL of heparinised (250 units/mL) saline solution. The syringes were detached and inverted several times to ensure complete mixing. The suspension was centrifuged at 1000 rpm (180 × g) for 5 min and the supernatant was removed. The bone marrow was then resuspended in culture medium and seeded in two 75-cm2 culture flasks (Orange Scientific, Belgium). The osteogenic medium consisted of highglucose Dulbecco’s modified Eagle’s medium (high-glucose DMEM) (GIBCO Laboratories, Grand Island, NY) supplemented with 10% fetal bovine serum (HyClone, Logan, UT), glutamine (1 mM), penicillin G (100 U/mL), streptomycin sulphate (100 g/mL), 10–8 M dexamethasone (Sigma, St. Louis, MO), 10 mM sodium -glycerol phosphate (Sigma) and l-ascorbic acid (50 g/mL; Sigma). Threefourths of the culture medium was changed after five days, and non-adherent cells were removed along with the culture medium. Medium was then replaced twice weekly. When cultures became almost confluent, the cells were detached and serially sub-cultured. After 14 days of cell culture, the adherent MSCs were defined as osteoblast-like cells by the determination of osteoblast markers (production of mineralized matrix, collagen I, and osteopontin expression) (6). Passage 1 autologous sheep MSCs in culture flask were then rinsed twice with phosphate buffer saline solution, trypsinized with 2 mL of 0.2% trypsin, concentrated by centrifugation at 1000 rpm (180 × g) for 10 min, and diluted to 1 mL of cell suspension (3 × 106 cells/mL) in autologous sheep plasma for seeding into ceramic grafts. The commercial HA and TCP/HA used in this study has the following characteristics: HA: derived from natural sources with average granule size of 1.8-3.0mmTCP/HA: synthetic with 80% TCP and 20% HA and an average granule size of 1.5–3.0 mm. HA and TCP/HA granules were first pre-wetted with sheep plasma. A total of 5–6 × 107 MSCs were then mixed with 6 ml of sheep plasma and dropped onto the pre-wetted granules. These mixtures were then placed into a 25 cm3 flask, which acted as the mold in order to shape the construct 2 × 5 × 0.4 cm3 size. Polymerization of fibrin in the plasma was initiated by addition of 25 l 250 mM CaCl2 . The polymerized cell-seeded granules were immersed further in osteogenic medium to induce osteogenic differentiation a week before implantation. 2.4. Preparation of autologous plasma For preparation of autologous plasma, whole blood was collected into a sterile tube containing citrate phosphate dextrose
154
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
(CPD) solution (2.63% sodium citrate, 0.32% citric acid, 2.32% dextrose, and 0.25% sodium dihydrogen phosphate) with one-ninth volume of the collected blood as an anti-coagulant. The blood was centrifuged at 800 × g for 10 min, and the upper layer, including plasma and the buffy coat (mostly white blood cells and platelets) was transferred to another tube. This tube was further centrifuged at 1500 × g for 10 min to pellet the buffy coat and the upper layer was filtered into a new tube using a 0.2-m syringe filter. 2.5. Surgical procedure The sheep were anesthetized intravenously with 10 mg/kg ketamine hydrochloride and 0.1 mg/kg medetomidine hydrochloride followed by general anesthesia using halothane and oxygen to control ventilation. Orthopedic and veterinary surgeons performed the surgical procedure. After placing in a prone position, the animals were shaved, prepped with Povidone-iodine, habitant spirit and draped. Each animal received antibiotic (Betamox) and NSAID (meloxican) preoperatively. Under a midline incision through the skin and lumbodorsal fascia, bilateral subperiosteal dissection was performed to expose the spine from L1 to L6 bilaterally up to the transverse process. The transverse processes were then decorticated using the rongeur, and the engineered constructs were placed directly across the exposed transverse process. Each animal received three treatments at the L1–L2, L3–L4 and L5–L6 disk spaces, and the L2–L3 and L4–L5 disk remained intact. Approximately 1.5–2.0 cm3 of corticocancellous iliac crest bone graft, which is the autogenous bone graft, was harvested from the left anterior iliac crest previously. The engineered constructs or autogenous bone graft was then inserted with finger pressure or gentle impaction. Bone constructs were placed along the spinal cord and across transverse process. Segments were immobilized together using triple wiring technique, where necessary and performed on the affected spinal process. K wire was use to tighten up the involved spinal process (L1–L2, L3–L4 and L5–L6). Homeostasis was secured and the wound was closed without drainage. 2.6. Post-operative care Sheep were placed in the intensive care ward for seven days, and temperature, pulse and respiration (TPR) and appetite, bowel, urine (ABU) were monitored closely. During this time, a seven-day course of antibiotics, anti-inflammatory and analgesic drugs were administered. Upon discharge from the intensive care ward, TPR and ABU were monitored weekly. Sheep were euthanized at the end of 12 weeks, and the appropriate vertebrae were harvested for analysis. 2.7. Radiographic analysis Fusion of the grafted areas of all sheep was evaluated radiographically at 12 weeks after surgery. The following parameters were used in obtaining the radiographs: the distance of tube to Medical Imaging film (MI-NP 30; Fujifilm Co., Tokyo, Japan) was 110 cm, the radiograph exposure was 55 kV, 20 mA, and 0.4 s. The fusion was evaluated as solid or not solid by 2 blinded observers, based on the presence of a continuous trabecular pattern within the intertransverse fusion mass. They were graded as solid only when both observers agreed.
Fig. 1. Collagen type 1 was highly expressed at P0 (2.21 ± 1.02) and P1 (2.60 ± 0.94), but decreased at P2 (0.47 ± 0.28), p < 0.05 compared to P1 and at P3 (0.70 ± 0.34), p < 0.05 compared to P1. Osteopontin expression was highest at P1 (0.22 ± 0.14) and significant (p < 0.05) compared to P0 (0.05 ± 0.03), P2 (0.04 ± 0.02) and P3 (0.06 ± 0.04).
serially in xylol, and embedded in paraffin. Sections of approximately 5 m were then stained with Alizarin Red. NIS-Element microscope imaging software was used to calculate the percentage of new bone formation in both constructs. The calculation was done according to this equation: New bone area in the image × 100 = % of new bone formation Total bone area in the image 2.9. Scanning electron microscopy Constructs were harvested at 12 weeks post-implantation. For SEM analysis, samples were randomly chosen in every part of the construct. Samples were cut into 1-cm3 slices, which were immediately transferred into small vials and immersed in 2.5% glutaraldehyde. The tubes were incubated at 4 ◦ C for at least 24 h (overnight). This was followed by three changes of 0.1 M sodium cacodylate for 10 minutes each. The samples were then post-fixed with 1% osmium tetraoxide for 2 h at 4 ◦ C. Next, the samples were dehydrated in a gradually increasing gradient of acetone (35%, 50%, 75%, 95% for 10 min each and 3 changes of 100% for 15 min). Once dehydrated, the samples were transferred into a specimen basket immersed in 100% acetone and dried in a critical point dryer (Baltec 030 CPD) for approximately 30 min. 3. Result 3.1. Quantitative gene expression of sheep BMSCs Gene expression analysis on cells after 14 days of monolayer culture showed that P1 have the highest gene expression for collagen type 1 and osteopontin genes compared to P0, P2 and P3. As shown in Fig. 2, differentiation process after a few passages affected cell phenotypes. The mRNA expression level decreased in proportion to the number of subcultures performed. The expression of collagen type 1 was found to be higher at P0 (2.21 ± 1.02) and P1 (2.60 ± 0.94). However, its expression level significantly decreased (p < 0.05) at P2 (0.47 ± 0.28) and P3 (0.70 ± 0.34), which were approximately 82% and 73% lower than that at P1 In case of osteopontin, the expression was higher at P1 (0.22 ± 0.14) and significantly higher (p < 0.05) compared to P0 (0.05 ± 0.03), P2 (0.04 ± 0.02) and P3 (0.06 ± 0.04).
2.8. Histology 3.2. Gross and radiograph view About 1.0 cm3 of the engineered bone constructs were cut for histological examination. All samples were fixed in 10% phosphate buffer formalin. Samples were decalcified by immersion in 10% EDTA solution, dehydrated with a graded series of ethanol, soaked
The gross view of the harvested segments (L1–L6) showed that the TCP/HA constructs had better bone formation compared to HA construct. Approximately 10% to 20% initial seeded granules can
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
155
55.8% of new bone formation was generated (Fig. 4D). There was no sign of inflammation or giant cell reaction. There was direct contact between the TCP-HA implant and surrounding bone tissue. No fibrous tissue was observed between the implant area and the original bone. Autogenous bone graft showed homogenous bone formation, which completely fused with the native bone (Fig. 4). 3.4. Scanning electron microscopy
Fig. 2. The engineered bone constructs (TCP/HA with induced BMSC and HA induced BMSC) and autogenous bone graft were placed along the spinal cord and across the transverse process. Segments were immobilized together using triple wiring technique.
be seen in the TCP/HA constructs (Fig. 3B) Fig. 3 compared to HA construct (Fig. 3C) that was about 80% granules. In autogenous bone graft group, solid bone fusion was observed (Fig. 3A). Radiograph revealed complete fusion in the autogenous bone graft group (Fig. 3D). Some form of trabecular formation was seen in TCP/HA constructs and HA constructs (Fig. 3E and F). The fusion rates were 1 of 6 sheep in the HA construct group and 5 of 6 sheep in the TCP/HA construct group. 3.3. Histological analysis Histological sections revealed a larger area of bone formation with embedded lacunae-like cells for the TCP/HA construct, which stained homogeneously for Alizarin Red (red), compared to HA constructs. By using the NIS-Element microscope imaging software, we calculated the percentage of new bone formation for both construct. Results have showed that, 42.7% of new bone was discovered in TCP/HA constructs and 10.7% was counted for HA constructs. However, in autogenous bone group showed that
SEM analysis showed the formation of thick collagen fibers encapsulating TCP-HA construct (Fig. 5A). It is suspected that the calcification had commenced with the formation of thick collagen fibers, which phenomenon was not found in HA constructs, as shown in Fig. 5B. In the toluidine blue staining large area of ceramics residue was observed in HA construct with minimal formation of bone development (Fig. 5E). For TCP/HA construct, bone development had taken place all over the construct (Fig. 5D). Autogenous bone graft completely resemble like native bone with osteocytes occurrence (Fig. 5C and F). 4. Discussion Spinal fusion is usually performed using autogenous bone grafts taken from the ilium. The cancellous bone of the ilium has rich blood supply and high cellularity, making it very useful for bone reconstructive procedures such as spinal fusion. In this study, we used cancellous bone graft as a gold standard in order to justify whether TCP/HA or HA together with fibrin and osteogenesis induced BMSCs could achieve spinal fusion. Favorable results were obtained in TCP/HA as compared to HA for fusion mass formation. This success is attributed to the used of osteogenic induced BMSC and fibrin as the cells carrier. The in vitro expansion of BMSC cells is an important aspect of tissue engineering as this allows the generation of a large number of cells from minimal starting materials. However, the key problem is that cells dedifferentiate
Fig. 3. Radiographs and gross view 12 weeks after lumbar intertransverse process arthrodesis in six sheep (A and D) in the autogenous bone graft (B and E), HA construct and (C and F) TCP/HA construct. Radiographs in each example show a continuous trabecular fusion mass pattern in the intertransverse area. The autogenous bone graft achieved full fusion. TCP/HA construct achieved fusion in five groups and HA construct achieved fusion only in one group. The ceramics granule can still be seen at TCP/HA and HA fusion site.
156
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
Fig. 4. Histological interface between implanted area (new bone formation/NB) and vertebral/V body in sheep (A) TCP/HA construct, (B) HA construct and (C) Autogenous bone graft. The implant showed direct contact to vertebral trabeculae without any sign of inflammation or giant cell reaction in both HA and TCP/HA construct. Fusion is complete in the autogenous bone group, no demarcation was seen between the vertebrae and new bone. 55.8% of new bone was spotted in autogenous bone group, followed by TCP/HA group 42.7% and 10.7% for HA group (D). Direct contact of new bone and natural bone is shown by the black arrow (→).
and age during in vitro expansion, leading to the loss of their native phenotype (Fischgrund et al., 2009; Smucker et al., 2008a; Szpalski et al., 2012). After 14 days of cell expansion in monolayer culture, passage 1 gene expression for collagen type 1 and ostepontin were significantly higher compared to the other passages as shown
in Fig. 1. Therefore P1 cells are ideal candidates to create a bone construct. In in vivo level after 12 weeks of post implantation, TCP/HA construct demonstrated better bone formation compared to HA construct. The autogenous bone graft formed rigid fusion.
Fig. 5. SEM analysis in TCP/HA (A), HA (B) construct and autogenous bone graft (C) followed by the light micrographs of semi thin sections stained in toluidine blue for TCP/HA (D) HA (E) construct and autogenous bone graft (F). Minimal bone regeneration can be seen in HA construct when compared with TCP/HA construct. Ceramics residue was still intact in both construct but minimal in TCP/HA construct. Collagen fiber appeared in TCP/HA construct but not in HA construct. Autogenous bone graft completely resemble like native bone with osteocytes occurrence.
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
However, autogenous bone grafts can result in donor site morbidity such a severe pain at the donor site. The ilium has rich blood supply therefore, graft collection causes considerable bleeding and careful hemostasis is necessary to prevent protracted postoperative hemorrhage (Wilson et al., 2006). The ilium is more susceptible to fracture after graft collection, and a fall after surgery may cause pelvic fracture or stress fracture (Kruyt et al., 2004a,b,c). During graft collection, the femoral cutaneous nerve may be damaged near the iliac crest, leading to meralgia (Ahlmann et al., 2000). For that, bone tissue engineering has emerged as a better alternative in treating patients. Reconstruction using tissue-engineered bone is free from the problems accompanying graft collection. It only involves the minimally invasive procedure of bone marrow aspiration and is less burdensome for patients. For the surgeon, the method has the advantage of shortening the operating time because there is no need for graft collection. Postoperative pain is reduced dramatically and the time needed for rehabilitation is shortened, leading to early discharge from intensive care. The results from this study indicated that both HA and TCP/HA with osteogenically induced BMSCs with fibrin can improve the osteogenic potential of porous ceramics. This is consistent with the observations of previous studies (Kruyt et al., 2004a,b,c; Chan et al., 2010), which showed that cultured BMSCs loaded on to porous ceramic forms more new bone tissue especially for TCP/HA construct compared to the HA construct. This engineered bone can heal critical-sized osseous defects and achieve spinal fusion in various animals, such as rabbits (Smucker et al., 2008b), goat (Kruyt et al., 2004a,b,c) and rhesus monkeys (Wang et al., 2005). More ceramic residues are found in the HA construct group compared to TCP/HA construct group due to the higher biodegradation rate of ceramics for TCP/HA granules compared to HA granules. In radiography analysis, the result has shown that there are visible granules of HA and TCP/HA on the transverse process. However, TCP/HA construct has formed better bone at 12 weeks after implantation. Numerous cells were found within the central area of the graft bed in the MSCs group. This newly formed bone may be facilitated through the biodegradation of ceramics via body fluidmediated and cell mediated mechanisms as suggested by Niehoff et al. (2008) while new matrix was laid by the implanted cells. The mechanism of bone formation in TCP/HA bone constructs involved a process known as collagen calcification, albeit in a disoriented manner (Zimmermann et al., 1991). Previous studies reported that development of osteoblasts along the osteogenic pathway progresses with the development of the extracellular matrix through three phases: cell proliferation with ECM secretion, ECM maturation and ECM mineralization. The mechanism of calcification in HA constructs differed in a few ways. Flattened cells were seen to gradually transform into mineralized sheets (Phang et al., 2004). Angela et al. made a similar observation in 2005 wherein various calcified accretions were formed from these mineralized sheets, which then broke off to fuse with other nodules to produce the overall bone-like matrix. However, this phenomenon occurred within a small region of the HA constructs. In our SEM observation, thick collagen fibers were found encapsulating TCP-HA constructs, a phenomenon not found in HA constructs. Moreover, the sheep fibrin prepared in our laboratory is a suitable cell carrier and acts as a temporary scaffold for the formation of stable constructs in bone tissue engineering. It fulfills the criteria of being biocompatible, osteoinductive and resorbable (Angela et al., 2005, 2008). Due to its lack of mechanical strength, its usage may be limited to non-load bearing or minor bone defects. Torigoe et al., 2009 investigated the effect of autologous fibrin and bone marrow on -tricalcium phosphate on a monkey ectopic bone formation model. They found autologous plasma efficiently promotes osteogenesis. Our laboratory has developed a system that eliminates the addition of bovine thrombin as used in other studies (Schliephake
157
et al., 2001a,b). This reduces the risk of immune rejection after transplantation and the risk of contamination. 5. Conclusion Posterolateral spinal fusion can be achieved better with TCP/HA granule mixed with osteogenically induced MSCs with fibrin compared to HA. However, autogenous bone graft produced the best fusion among all. Conflict of interest The authors declare no conflicts of interest. Acknowledgements This study was funded by grants from the Ministry of Science Technology and Innovation of Malaysia 06-02-02-0059-EA292 and 06-02-02-003 BTK/ER/022. References Ahlmann, E., Patzakis, M., Roidis, N., Shepherd, L., Holtom, P., 2000. Comparison of anterior and posterior iliac crest bone grafts in terms of harvest-site morbidity and functional outcomes. J. Bone Joint Surg. Am. 84A, 716–720. Angela, Ng M.H., Aminuddin, B.S., Tan, K.K., Tan, G.H., Sabarul Afian, M., Fauziah, O., Ruszymah, B.H.I., 2005. Comparison of bioengineered human bone construct from four sources of osteogenic cells. J. Orthop. Sci. 10, 192–199. Angela, Ng M.H., Tan, K.K., Phang, M.Y., Aziyati, O., Tan, G.H., Isa, M.R., Naseem, M., Fauziah, O., Aminuddin, B.S., Ruszymah, B.H.I., 2008. Differential osteogenic activity of osteoprogenitor cells on HA and TCP/HA scaffold engineered bone. Biomed. Mater. Res. 85A, 301–312. Bruder, S.P., Jaiswal, N., Ricalton, N.S., Mosca, J.D., Kraus, K.H., Kadiyala, S., 1998. Mesenchymal stem cells in osteo-biology and applied bone regeneration. Clin. Orthop. Relat. Res. 355S, S247–S256. Chan, B.P., Hui, T.Y., Wong, M.Y., Yip, K.H.K., Chan, G.C.F., 2010. Mesenchymal stem cell-encapsulated collagen microspheres for BTE. Tissue Eng. C Methods 16, 225. Chowdhury, S.R., Ng, M.H., Hassan, N.S.A., Aminuddin, B.S., Ruszymah, B.H.I., 2012. Identification of suitable culture condition for expansion and osteogenic differentiation of human bone marrow stem cells. Hum. Cells 25 (3), 69–77. Cinotti, G., Patti, A.M., Vulcano, A., Della Rocca, C., Polveroni, G., Giannicola, G., Postacchini, F., 2004. Experimental posterolateral spinal fusion with porous ceramics and mesenchymal stem cells. J. Bone Joint Surg. Br. 86, 135–142. Fernyhough, J.C., Schimandle, J.H., Weigel, M.C., Edwards, C.C., Levine, A.M., 1992. Chronic donor site pain complicating bone graft harvesting from the posterior iliac crest for spinal fusion. Spine 17, 1474–1480. Fischgrund, J.S., James, S.B., Chabot, M.C., et al., 2009. The use of bone morphogenic protein in lumbar spine surgery. Instruct. Course Lect. 58, 677–688. Frederic Shapiro, 2008. Bone development and its relation to fracture repair. The role of mesenchymal osteoblast and surface osteoblast. Eur. Cells Mater. 15, 53–76. Krebsbach, P.H., Mankani, M.H., Satomuta, K., Kuznetsov, S.A., Robey, P.G., 1998. Repair of craniotomy defects using bone marrow stromal cells. Transplantation 66, 1272–1278. Kruyt, M.C., De Bruijn, J.D., Yuan, H., Van Blitterswijk, C.A., Verbout, A.J., Oner, F.C., Dhert, W.J., 2004a. Optimization of bone tissue engineering in goats: a peroperative seeding method using cryopreserved cells and localized bone formation in calcium phosphate scaffolds. Transplantation 77, 359–365. Kruyt, M.C., Dhert, W.J., Yuan, H., Wilson, C.E., van Blitterswijk, C.A., Verbout, A.J., de Bruijn, J.D., 2004b. Bone tissue engineering in a critical size defect compared to ectopic implantations in the goat. J. Orthop. Res. 22, 544–551. Kruyt, M.C., Gaalen, S.M.V., Oner, F.C., Verbout, A.J., de Bruijn, J.D., Dhert, W.J., 2004c. Bone tissue engineering and spinal fusion: the potential of hybrid constructs by combining osteoprogenitor cells and scaffolds. Biomaterials 25, 1463–1473. Munirah, S., Samsudin, O.C., Chen, H.C., Sharifah Salmah, S.H., Aminuddin, B.S., Ruszymah, B.H.I., 2007. Articular cartilage restoration in load-bearing osteochondral defects by implantation of autologous chondrocyte-fibrin constructs. An Experimental Study in Sheep. J Bone Joint Surg [Br]. 89-B, 1099–1109. Niehoff, P., Springer, I.N., Ac¸il, Y., Lange, A., Matthias, M.J., Roldán, C.J., Köppe, K., Warnke, P.H., Bernhard, K., Wiltfang, J., 2008. HDR brachytherapy irradiation of the jaw—as a new experimental model of radiogenic bone damage. J. CranioMaxillofac. Surg. 36, 203–209. Phang, M.Y., Angela Ng, M.H., Fuzina, H., Aminuddin, B.S., Ruszymah, B.H.I., Fauziah, O., 2004. Looking into the microstructure of biomaterials and its inhabitants in engineered bone tissue. J. Electron Microsc. Malays. 1, 73–79. Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W., Craig, S., Marshak, D.R., 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284, 143–147. Schliephake, H., Knebel, J.W., Aufderheide, M., Tauscher, M., 2001a. Use of cultivated osteoprogenitor cells to increase bone formation in segmental mandibular
158
B.S. Shamsul et al. / Tissue and Cell 46 (2014) 152–158
defects: an experimental pilot study in sheep. Int. J. Oral Maxillofac. Surg. 30, 531–537. Schliephake, H., Knebel, J.W., Aufderheide, M., Tauscher, M., 2001b. Use of cultivated osteoprogenitor cells to increase bone formation in segmental mandibular defects: an experimental pilot study in sheep. Int. J. Oral Maxillofac. Surg. 30 (6), 531–537. Seet, W.T., Maarof, M., Khairul Anuar, K., Chua, K.-H., Ahmad Irfan, A.W., Ng, M.H., Aminuddin, B.S., Ruszymah, B.H.I., 2012. Shelf-life evaluation of bilayered human skin equivalent, MyDermTM . PLoS ONE 7 (8), e40978, http://dx.doi.org/10.1371/journal.pone.0040978. Smucker, J.D., Bobst, J.A., Petersen, E.B., Nepola, J.V., Fredericks, D.C., 2008a. B2a Peptide on ceramic granules enhance posterolateral spinal fusion in rabbits compared with autograft. Spine (Philadelphia, PA) 33, 1324–1329. Smucker, J.D., Bobst, J.A., Petersen, E.B., Nepola, J.V., Fredericks, D.C., 2008b. B2a peptide on ceramic granules enhance posterolateral spinal fusion in rabbits compared with autograft. Spine (Philadelphia, PA) 33 (12), 1324–1329. Sulaiman, S.B., Keong, T.K., Cheng, C.H., Saim, A.B., Idrus, R.B.H., 2013. Tricalcium phosphate/hydroxyapatite (TCP-HA) bone scaffold as potential candidate for the formation of tissue engineered bone. Indian J. Med. Res. 137 (June), 1093–1101. Szpalski, C., Barbaro, M., Sagebin, F., Warren, S.M., 2012. Bone tissue engineering: current strategies and techniques—part II: cell types. Tissue Eng. B 18 (4), http://dx.doi.org/10.1089/ten.teb.2011.0440.
Tan, K.K., Shamsul, B.S., Aminuddin, B.S., Tan, G.H., Angela Ng, M.H., Loqman, M.Y., Chua, K.H., Ruszymah, B.H.I., 2005. Bone graft substitute using hydroxyapatite scaffold seeded with tissue engineered autologous osteoprogenitor cells in spinal fusion: early result in a sheep model. Med. J. Malays. 60 (Suppl. C), 53–58. Tang, K., Guo, S.Q., Dang, G.T., 2003. In vivo evaluation of bone marrow stromalderived osteoblasts porous calcium phosphate ceramic composites as bone graft substitute for lumbar intervertebral spinal fusion. Spine 1 (28), 1653–1658. Torigoe, I., Sotome, S., Tsuchiya, A., Yoshii, T., Maehara, H., Sugata, Y., Ichinose, S., Shinomiya, K., Okawa, A., 2009. Bone regeneration with autologous plasma, bone marrow stromal cells, and porous b-tricalcium phosphate in nonhuman primates. Tissue Eng. A 15, 1489–1499. Wang, T., Dang, G., Guo, Z., Yang, M., 2005. Evaluation of autologous bone marrow mesenchymal stem cells–calcium phosphate ceramic composite for lumbar fusion in rhesus monkey interbody fusion model. Tissue Eng. 11, 1159–1167. Wilson, C.E., Kruyt, M.C., de Bruijn, J.D., van Blitterswijk, C.A., Oner, F.C., Verbout, A.J., Dhert, W.J., 2006. A new in vivo screening model for posterior spinal bone formation: comparison of ten calcium phosphate ceramic material treatments. Biomaterials 27, 302–314. Zimmermann, B., Wachtel, H.C., Noppe, C., 1991. Patterns of mineralization in vitro. Cell Tissue Res. 263 (3), 483–493.