Postulation of seedling leaf rust resistance genes in 84 Chinese winter wheat cultivars

Journal of Integrative Agriculture 2015, 14(10): 1992–2001 Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

Postulation of seedling leaf rust resistance genes in 84 Chinese winter wheat cultivars REN Xiao-li, LIU Tai-guo, LIU Bo, GAO Li, CHEN Wan-quan State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, P.R.China

Abstract Wheat leaf rust (caused by Puccinia triticina) is one of the most important fungal diseases in China. There are tens of winter wheat cultivars which are approved to be released by the government at a national level and more than 100 wheat cultivars at the provincial level. But there is no information about leaf rust (Lr) genes in these cultivars, which makes it difficult for farmers and breeders to select which cultivars they should plant in their fields and use in their breeding programs. The objective of this paper was to identify the leaf rust resistant genes at seedling stage present in the 84 commercial wheat cultivars from China that have been released in the past few years. A set of 20 near isogenic lines with Thatcher background and 6 lines with known Lr genes were used to test the virulence of 12 races of P. triticina (Pt). By comparing the infection types (ITs) produced on the 84 cultivars by the 12 Pt races with the ITs on the differential sets, the Lr genes were postulated. In addition, 8 molecular markers of Lr genes such as Lr9, Lr10, Lr19, Lr20, Lr21, Lr24, Lr26 and Lr29, which are closely linked to or co-segregated with the Lr gene, were used for further validation of the genes in the 84 Chinese winter wheat cultivars. Twelve Lr genes, including Lr1, Lr3, (Lr3bg), (Lr3ka), Lr11, Lr13, Lr14a, Lr16, Lr26, Lr27, Lr30 and Lr31 were postulated to be present either singly or in combinations in these Chinese wheat cultivars. Lr3 and Lr26 were detected most often in the tested cultivars, with frequencies of 51.2 and 38.1%, respectively. No wheat Lr genes were detected in 16 cultivars, and 4 cultivars may carry unknown Lr genes other than those used in this study. Lr9, Lr20, Lr21, Lr24, Lr25 and Lr29 were not present in any of the 84 tested accessions. Keywords: gene postulation, molecular marker, Puccinia triticina, wheat leaf rust

of the most important cereal diseases in the world, with

1. Introduction Wheat leaf rust, caused by Puccinia triticina Eriks., is one

widespread and regular occurrence on wheat. It caused severe losses in 1969, 1973, 1975 and 1979. In China, normally it affects about 15 million ha of wheat annually, and the disease causes frequent epidemics in the southwest and northwest areas, the middle and lower Yangtze River Valley, and the southern Huang-Huai-Hai region (Yellow

Received 29 October, 2014 Accepted 6 March, 2015 Correspondence LIU Tai-guo, E-mail: [email protected]; CHEN Wan-quan, E-mail: [email protected] © 2015, CAAS. All rights reserved. Published by Elsevier Ltd. doi: 10.1016/S2095-3119(14)61002-9

River, Huai River, and Hai River regions) (Huerta-Espino et al. 2011; Liu and Chen 2012). In the last two years, it has been detected in all wheat growing areas with higher prevalence and severity, suggesting the potential for new leaf rust disease epidemics. Based the control experience,

REN Xiao-li et al. Journal of Integrative Agriculture 2015, 14(10): 1992–2001

cultivating and breeding resistant cultivars is one of the most effective, environmentally sound and economical methods (Chen and Wang 1997). Currently, 74 formal leaf rust (Lr) resistance genes from Lr1 to Lr74 were designated and many other Lr genes, e.g., LrBi16, LrFun, LrGam6, etc., have been temporarily designated (McIntosh et al. 2014). Nearly all the Lr genes interact on a gene-for-gene basis with P. triticina (McIntosh et al. 1995, 2003). Although the numbers of designated and temporarily designated Lr genes are increasing annually, new Lr race with new virulence(s) which can overcome some of these Lr genes will likely occur. Thus, new sources of Lr resistance must be identified and deployed in order to satisfy the constant need. Loss of Lr resistance is a persistent problem for breeders and growers. This can clearly be seen from the history of breeding resistance into wheat. Soon after a rust-resistant cultivar was developed and released, over a time frame typically ranging from 3 to 5 years, up to as many as seven or eight years, its original resistance is gradually lost, until it must finally be replaced with a new resistant cultivar (Yang et al. 1994). In the 1970s, the 1BL.1RS translocation with high yield capacity was introduced into Chinese wheat breeding programs for stripe rust control, resulting in over deployment. As examples, Aurora, Kavkaz and Lovrin lines, representative lines with the 1BL.1RS translocation, with resistance to Yr9, Pm8, Lr26 and Sr31 (Mago et al. 2002), were incorporated into Chinese wheat lines in order to improve the resistance of wheat against yellow rust 40 years ago. It is estimated that the parents of 90% of the commercial wheat cultivars in northern China were from the Lovrin background at the end of the 1980s, which resulted in the loss of leaf rust resistance once again (Zhuang 2003). A lot of work has been documented determining Lr genes of wheat in China and abroad from 1991 to 2007, involving about 650 cultivars and lines (Yuan et al. 2007). By 2010, over 100 Lr genes had been found in wheat, 72 of which have been located and mapped to chromosomes, and 67 of which have been designated according to McIntosh (20). Thirty-nine wheat Lr genes have been linked to molecular markers (McIntosh et al. 2010). In order to improve the accuracy and efficiency of identifying Lr genes, recently developed molecular marker techniques such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP) and random amplification of polymorphic DNA (RAPD), etc., have been used to locate Lr genes on the genome. Some molecular markers have also been converted into sequence-tagged site (STS) markers, sequence characterized amplified region (SCAR) markers, or cleaved amplified polymorphic sequence (CAPS) markers. The following leaf rust resistance genes can be differentiated by STS, SCAR or CAPS markers: Lr9 (Schachermayr et al. 1994; Gupta et al. 2005), Lr10 (Scha-

1993

chermayr et al. 1997), Lr19 (Prins et al. 2001; Gupta et al. 2006a), Lr20 (Neu et al. 2002), Lr21 (Huang and Gill 2001), Lr24 (Schachermayr et al. 1995; Gupta et al. 2006b), Lr26 (Froidmont 1998; Mago et al. 2002; Chai et al. 2006), Lr28 (Cherukuri et al. 2005) and Lr29 (Tar et al. 2002). In China, more information on resistance genes is required, and lack of knowledge about resistance genes in particular cultivars made it difficult to utilize resistant cultivars in order to manage leaf rust. Our objective was to identify the all-stage Lr resistance genes of commercial wheat cultivars in China based on gene postulation and molecular marker detection. Such information will be of importance in guiding the reasonable utilization and distribution of varieties, and providing Lr gene resources for breeding and control.

2. Results 2.1. Resistance genes identified from seedling reactions Variations in the infection types (ITs) on the 20 Lr near isogenic lines (NILs) and 6 single-gene lines inoculated with 12 P. triticina races (Table 1) indicated the possibility of identifying the 17 Lr genes (or gene combination). Table 2 shows the IT patterns of the 84 tested lines after inoculation with the same 12 races of P. triticina. Twelve resistance genes against some of tested leaf rust races, including Lr1, Lr3, (Lr3bg), (Lr3ka), Lr11, Lr13, Lr14a, Lr16, Lr26, Lr27, Lr30 and Lr31, were present either singly or in combinations in 58 cultivars (or lines), while 19 cultivars (or lines) did not possess any Lr genes and 7 cultivars had unknown Lr genes other than those included in this study (Table 2). It was not possible to identify genes Lr2c, Lr10 and Lr17 with the 12 races used due to the high infection types recorded with all the tested races. Lr2a, Lr9, Lr20, Lr25 and Lr29, which were effective against all P. triticina races tested, could not be detected in any cultivars (or lines), each of which was susceptible to several races. Among the 12 leaf rust resistance genes identified in the 84 wheat cultivars, Lr3 and Lr26 were the most common, with frequencies of 51.2 and 38.1%, respectively. In most cultivars, Lr13 could not be detected because the IT pattern showed reactions (IT=X) incompatible with PHP/BM cultures, even it may be epistatic based the IT (; to ;12) with race DGD/BM. In most cases, Lr3 was found in combination with Lr26, at a frequency of 38.1%. Lr27+31, (Lr3bg), and Lr16 were detected separately in 13, 13, and 8 cultivars at frequencies of 15.5, 15.5, and 9.5%, respectively. Some Lr genes such as Lr1, (Lr3ka), Lr11, Lr14a, Lr30 were present only a single cultivar. Among the 84 identified wheat cultivars, 32 cultivars contained both Lr3 and Lr26, which could be postulated

1994

REN Xiao-li et al. Journal of Integrative Agriculture 2015, 14(10): 1992–2001

Table 1 Infection types expressed by the 12 races of Puccinia triticina on seedlings of 21 Lr near isogenic lines (NILs) and 6 known Lr gene lines1) Tester RL6003 RL6016 RL6019 RL6047 RL6002 RL6042 RL6007 RL6010 RL6004 W976 Manitou RL6013 RL6032 RL6005 RL6008 RL6009 RL6040 W203 RL6012 RL6064 Awned RL6078 Gatcher CM2D-2M RL6080 RL6049 1)

Lr gene FGN/RP PHJ/SR PHT/SM FHN/QP PHP/MP DJD/BM FHT/QP PHT/RT PHK/QP PHJ/GP PCR/QM FHJ/SB Lr1 ;2 3+ 3+ ; 3+ ; ; 3+ 4 3 4 3– Lr2a ; ; ;1 ; ;1 ;1 ;2+ ;1 ;1 ;1 ;1 ;1 Lr2b 3+ 3+ 3+ 3+ 3+ ;1 3+ 3+ 3– ;12 ;2 2 Lr2c 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 4 3 Lr3 3+ 3+ 3+ 3+ 3+ ; 3+ 3+ 3+ 3+ 4 3 Lr3bg 3+ 3+ 3+ 3+ 3+ ; 3+ 3+ 3 ; 4 3 Lr3ka 3 ;1 3+ 3+ 3+ ; 3 3 2 ;1 4 ;2 Lr9 0; 0; 0 0 0 0 0 0 0 0 0; 0 Lr10 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3 Lr11 ; 3+ 3+ ;1 ; ; 3+ 3+ 3 3+ 3 3 Lr13 3+ 3+ 3+ 3+ X ;12 3+ 3+ 3+ 3+ 3 3 Lr14a 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3 ;1 Lr15 ; 3+ 3+ ;2+ ; ; ; ; ;1 ;12+ ;2 3 Lr16 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 ;2 3 Lr17 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3 3 3 Lr18 3 ; ;12 3– 3 ;1 2+ 3+ ;1 ;1 3– 3 Lr19 ; ; 0; ; 0; 0; 0; ; ; 0; 0 0; Lr20 ; ; ; ; ;1 ; ;1– ; ;1 ; 2+ ; Lr23 3+ ; ;12+ 3 3+ ; 3+ 3 3+ 3 ;1 ;1 Lr24 ; ; ;+ ; ; 3+ 0; 0; ; ; ; 0; Lr25 0; 0; 0; 0; 0 0; 0; 0 0; 0; 0 0 Lr26 ; 3+ 3+ 3+ 3+ ; 3+ 3+ 3 3+ 4 3 Lr27+31 3+ 3 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 4 2 Lr28 ; 0 0 ; 3 3+ 0; 0; 0; ; 0 0 Lr29 ;+ ;+ ;+ ; ; ; ; ; ;1 ;1 2– ;1 Lr30 ;1 ;2+ 3 ; 3+ ; 3+ 3 3 ; 3 3–

0, no visible symptoms; ;, hypersensitive necrotic or chlorotic flecks; 1, small uredia surrounded by necrosis; 2, medium uredia surrounded by necrosis or chlorosis; 3, medium uredia without necrosis or chlorosis; 4, arge uredia without necrosis or chlorosis; +, uredia somewhat larger than normal; –, uredia somewhat smaller than normal; X, heterogeneous infection type. A range of infection type is indicated by more than one infection type, with the predominant infection type listed first. The same as in Table 2.

based on the low IT “;” with the FGN/RP and DJD/BM races. Lr27+31 were postulated in 13 wheat cultivars according to the low IT “2” with race FHJ/SB, and Lr3bg probably in 13 cultivars according to the IT “;”, “0”, “0;” and “;1” with PHJ/ GP. Eight cultivars possessed Lr16, resistant to PCR/QM (IT “;2”). Lantian 10 (line 1) was postulated to possess Lr3, (Lr3bg), (Lr3ka), Lr26, Lr27+31, and Lr30 based on the ITs displayed by races FGN/RP, PHJ/SR, FHN/QP, DJD/BM, PHJ/GP, and FHJ/SB, and an unknown Lr gene resistant to PHK/QP (IT “2”). Similarly, Lr1, Lr3 (Lr3bg), Lr11, Lr13, Lr26 and an unidentified Lr gene were postulated in 04 Zhong 3604. Lr1 can be differentiated from other known Lr genes based on its same low IT “;” with FHN/QP and FHT/QP, and Lr11 on the low ITs “;1” and “;” with FHN/QP and PHP/MP, respectively. Zhoumai 17 may contain Lr3, Lr26, Lr27 and Lr31 based on the ITs “;” and “2” with FGN/RP, DJD/BM and FHJ/SB. A large group including 29 cultivars, i.e., lines 4 to 32 may carry Lr3 and Lr26. Apart from those 2 Lr genes, lines 6 to 11 and line 32 may probably possess Lr3bg based on their low IT patterns with DJD/BM and PHJ/GP. Lines 1, 3, 33, 45 to 52, 6 and 65 have Lr27 and Lr31 according to their IT “2” with FHJ/SB (Table 2).

Gene Lr16 may be present in Xiangmai 986 (L26), Yanzhan 4110 (L43), Yumai 41 (L57), Luohan 2 (L63), Yangmai 11 (L64), Mianyang 28 (L69), and Xiaoyan 22 (L70), which displayed low ITs with PCR/QM that lacks virulence for Lr16 (Table 2). In Xiangmai 986 (L26) and Yanzhan 4110 (L43), the Lr16 may be heritable from Yumai 18 (Aizao 781), which possesses Lr16 (Singh et al. 1999). Zhengyin 4 (St2422/464) may provide the Lr16 for the derivatives of Zhengzhou 761, which was the provider of Luohan 2 (L63) and Yumai 41 (L57) (Zhuang 2003). Also, Xiaoyan 22 (L70) inherited Lr16 resistance from Xiaoyan 6. In addition, Aizao 781 and Xiaoyan 6 were also derivatives of St2422/464, which was postulated to have Lr16 (Chen and Wang 1997). Yangmai 11 (L64) and Mianyang 28 (L69) may have inherited Lr16 from Yangmai 5 and Mianyang 11, which were derivatives of Funo (Zhuang 2003), and confer resistance against Lr16 (Chen and Wang 1997).

2.2. Resistance genes identified from molecular markers A set of wheat lines (20 Lr NILs and 6 single-gene lines) were

1995

REN Xiao-li et al. Journal of Integrative Agriculture 2015, 14(10): 1992–2001

Table 2 infection types expressed by the 12 races of P. triticina on 84 tested cultivars (or lines) No.

Cultivar

FGN/ PHJ/ PHT/ FHN/ PHP/ DJD/ FHT/ PHT/ RP SR SM QP MP BM QP RT

PCR for PHK/ PHJ/ PCR/ FHJ/ Postulated Lr specific QP GP QM SB gene1) gene 2 0 3 2 Lr26 3, (3bg), (3ka), 26, 27, 30, 31, + 3+ ; 3 3 Lr26 1, 3, (3bg), 11, 13, 26, + 3 3– 3+ 2 Lr26 3, 26, 27, 31 3 3+ 4 3 Lr26 3, 13, 26 3+ 3+ 4 3– Lr26 3, 26 3+ ;1 3 3 Lr26 3, (3bg), 26 0 0 4 3 Lr26 3, (3bg), 26 3+ ; 3 3+ Lr26 3, (3bg), 26 3+ 0 4 3– Lr26 3, (3bg), 26 3 0; 3+ 3+ Lr26 3, (3bg), 26

1

Liantian 10

;

;

3+

;

3+

;

3+

3+

2

04 Zhong 3604

;

3+

3+

;

;

;

;

3+

3 4 5 6 7 8 9 10

Zhoumai 17 Xu 856 Shi 4185 Weimai 8 Heng 95 Guan 26 Zhoumai 18 Shannong 664 Zhoumai 16 GS Zhengmai 004 Han 4564 Jingdong 8 Huaimai 20 Lumai 1 Wanmai 369 Jimai 21 Heng 5229 Lianmai 2 Fanmai 5 Bainong AK 58 Hedong TX-006 Lunxuan 987 Shijiazhuang 8 Huapei 5 Xiangmai 986 Zhengmai 9694 Han 6172 Zhengmai 98 Miannong 4 Luomai 21 Shaan 229 Xinmai 18 Jimai 19 Jinmai 47 Chang 4640 Yumai 18 Yunong 949 Xinmai 11 Zimai 12 Chuanmai 107 Wanmai 48 Yanzhan 4110 Wanmai 38 Ping’an 6 Zhengmai 9023 Yumai 34 Yangmai 158 Yumai 69 Jinan 17 Yangmai 17 Xinong 979

; ; ; ; ; ; ; ;

3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+

3+ 3+ 3+ 3+ 3+ 3+; 3+ 3

3+ 3+ ; 3+ 3+ 3+ 3+ 3+

3+ 3– 3+ 3+ 3+ 3+ 3+ 3+

; ; ; ; ; ; ; ;

3 3+ 3+ 3+ 3+ 3+ 3+ ;

3+ 3+ 3+ 3+ 3+ 3– 3+ 3+

;

3+

3+

3+

3+

;

3

3+

0

0;

3

3

Lr26

3, (3bg), 26

; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 ; 3 3 3+ 3+ 3+ 3+ 3+

3+ 3 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3– 3–

3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ ; 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3

3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ ; 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ ; 3+ 3+ 3+ 3+ 3+ 3+ 3+

3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3+

; ; ; ; ; ; ; ; ; ; 0; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; 3– 3+ 3+ 3 3+ 3+ 3 3+ 3–

3+ 3+ 3+ 3+ 3 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3– 3+ 3+ 3 3+ 3+ 3 3+ 3+ 3 3 3– 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+

3+ 3+ 3+ 3 2+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 0 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3 3+ 3+ 3

3 3+ 3+ 3+ 0 4 3+ 3 3 3+ 3 3 3 3 3 3 3+ 4 3+ 3+ 3+ 3+ 0 3+ 3+ 3 2+ 3+ 3+ 3+ 3 3+ 3+ 3 3+ 2+ 3 4 3 3+ 3

3+ 3– 3 3+ 2+ 3 3 3 3 3 3 3+ 3 2+ 3 2+ 3+ 3+ 3+ 3 0; 2+ ; ; ;1 3 2+ 2+ 2+ 3 3 3– ; 2+ ;1 3 3+; ;2 3– 3 3

3 3 3 3 3 3 3 3 3 3 3 3 4 3 ;2 3 3 4 4– 3 3 3 3+ 3 3+ 2 3– 3 3 3 3 2+ 3 3 4 3 3 3 3 3+ 3

3+ 3 3 3 3 3 3 3 4 3 3 3 3 3 3 3 3– 3– 3– 3– 3 2 3 3 3 3 3+ 3+ 3– 3– 3– 3+ 3 ;1 2 2 2 2 2 2 2

Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 Lr26 – – – – – – – – – – – – – – – – – – – –

3, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, 16, 26 3, 26 3, 26 3, 26 3, 26 3, 26 3, (3bg), 26 3, 27, 31 3, (3bg) 3, (3bg) 3, (3bg) 3, 16 3 3 3 3 3 3, 16 3bg 14a, 27, 31, + 27, 31 27, 31 27, 31 27, 31, + 27, 31 27, 31 27, 31

11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

(Continued on next page)

1996

REN Xiao-li et al. Journal of Integrative Agriculture 2015, 14(10): 1992–2001

Table 2 (Continued from preceding page) No.

Cultivar

53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84

Lumai 23 Yannong 19 Jimai 20 Gaomai 8901-11 Yumai 41 Zhengnong 16 Chuanmai 39 Chuannong 19 Pumai 9 Fumai 936 Luohan 2 Yangmai 11 Yangmai 15 Yumai 47 Mianyang 26 Wanmai 19 Mianyang 28 Xiaoyan 22 Gaoyou 9409 Taishan 22 Wanmai 50 Wanmai 53 Yumai 58 Jinmai 54 Jing 9428 Chuanmai 42 Changhan 58 Qinnong 142 Yunhan 22-33 Chang 6878 Nongda 135 Taikong 6

FGN/ PHJ/ PHT/ FHN/ PHP/ DJD/ FHT/ PHT/ RP SR SM QP MP BM QP RT 3 3 X 3+ ; 3+ ; ; 3 3 ;2+ 3+ 3+ ; 3+ 3+ 3+ 3+ 3+ 3+ 3 3 3+ 3+ 3+ 3+ 3+ 3– 3 3+ NT NT

3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3+ 3 3+ 3+ 3+ 3+ 3+ 3+ NT 3+

3+ 3+ 3+ 3+ 3+ 3+ ;2+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+; 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ NT 3+

3+ ; 3+; ; ; 3+ ; ; 2+ 3 3+ 3+ 3+ ; 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ NT 3+

3+ 3 3+; 3+ 3+; 3+ 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ NT 3+

3 3 3 3 3– 3+ 3– 3+ 3+ 3+ 3+ 3+ 3+ 2+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ NT 3+

3 3+ 3– 3– 3+ 3– 3 3+ 3– 3 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3– 3– 3– 3 3+ 3+ 3+ 3+ 3+ 3+ 3+ 3+ NT 3+

3 3+ 3+; ;1 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3 3+ 3+ 3+ 3+ 3+ 3+ 3 3 3+ 3+ 3+ 3+ 3+ 3 3+ 3+ NT 3+

PCR for PHK/ PHJ/ PCR/ FHJ/ specific QP GP QM SB gene 2+ 3 3 3– – 3+ 3+ 4 3+ – 3+ ; 3 3 – 3+ 3+ 3 3 – 4 3+ 2 3 – 2+ 3 3 3 – 3+ 3– 3+ 3 – 3+ 3+ 3 3 – 3+ 3 3 3C – 3– 3– 3 3C – 3+ 3+ 2C 3C – 4 3 2+ 2 – 3+ 3+ 3 2 – 3+ 3– 3+ 3– – 3+ 3+ 4 3– – 33+ 3– 3+ 3 – 4 3+ 2 3 – 3 3 2 3 – 3+ 3+ 3 4 – 3+ 3 3 3 – 3 3– 3 3 – 3 3– 3 3 – 3+ 3+ 3+ 3 – 3 3 3+ 3 – 4 3+ 3 3 – 3+ 3 4 3 – 3+ 3 3 3 – 3+ 3 3 3+ – 3+ 3 3 3 – 3 3 3 3 – 3 3 3 3 – 3+ 3 3 3 –

Postulated Lr gene1) + + + + 16, + + + + + N 16, + 16, 27, 31 27, 31 + N N 16 16 N N N N N N N N N N N N N N

1) Lr gene in bracket means it could be postulated due to the infection types by comparison with that on NILs lines. N, no resistance detected; NT, not tested; –, no data.

used to verify the specificity of the STS and SCAR markers linked to Lr9, Lr10, Lr19, Lr20, Lr21, Lr24, Lr26 and Lr29. The results showed that they were specific and robust for these differentiated Lr genes and available for molecular breeding of wheat (Ren et al. 2012). In addition, they were used to test the 84 Chinese commercial wheat cultivars and advanced breeding lines in order to confirm the postulated Lr genes. All 32 cultivars postulated to possess Lr26 showed marker alleles indicative of the predicted corresponding Lr gene. Lr9, Lr10, Lr19, Lr20, Lr21, Lr24 and Lr29 were not present in the tested 84 accessions (Table 2).

3. Discussion 3.1. Seedling tests for leaf rust response According to the data in this study, 13 known Lr genes as well as some other unidentified genes were present in

84 Chinese wheat cultivars. In total, there were 32 lines containing Lr26 (Table 2) based on gene postulation and/ or molecular marker PCR amplification, making it the most frequent (38.1%), in combination with Lr3. From pedigree analysis, Lr26 in Jimai 21 (L17), Heng 5229 (L18) and Fanmai 5 (L20) is probably derived from Ji 5418 (Yuan et al. 2007; Li et al. 2010). Lr26 in Bainong AK 58 (L21) might be derived from Zhoumai 11. Zhou 8425B inherited Lr26 from Predgronaia, which was supposed to be the 1BL.1RS line (Li et al. 2010). Lr26 in Shi 4185 (L5), Jingdong 8 (L13), Lumai 1 (L15), and Zhoumai 17 (L3) might be derived from Lr26 carriers such as Lovrin 10, Neuzucht and Predgornaia 2, respectively. The presence of Lr26 in Shi 4185 (L5), Zhoumai 16 (L10), Zhoumai 18 (L8) and Bainong AK 58 (L21) agrees with Li et al. (2010). Fumai 936 (L62) probably carries Lr26 from Ji 5418 based on its pedigree, but this could not be postulated based on the IT patterns of the 12 races. Yang (2000) reported

REN Xiao-li et al. Journal of Integrative Agriculture 2015, 14(10): 1992–2001

that Han 4564 (L19) carried Lr26 (Yang 2000). Based on the data in this study, Han 4564 possesses Lr3 and Lr26. The pedigrees of 4 lines, Jimai 19 (L34), Jinan 17 (L50), Jimai 20 (L55), and Taishan 22 (L72) (Fang 1994) indicate that Lovrin 13 was the donor parent of Lr26. Similarly, the presence of Lr26 in Yumai 34 (L47) is probably derived from Neuzucht, and Jing 9428 (L77) is derived from Lovrin 10, Lumai 23 (L53) is derived from Lumai 8 with the pedigree of Neuzucht (Qi et al. 2001). Although some cultivars are derivatives of 1BL.1RS lines, such as Lovrin 13, Lovrin 10, Neuzucht and Predgornaia 2, the Lr26 gene was probably not inherited due to breakage of the genetic linkage when they were randomly selected for high yield or good quality.

3.2. The gene determination and molecular marker analysis In the early 1970s, with the increase in international cooperation, Lovrin 10, Lovrin 13, Predgornaia 2, Kavkaz and Neuzucht, etc., which were derivatives of 1BL.1RS translocated with Yr9, Lr26, Sr31 and Pm8, were introduced into China to control yellow, brown, and black rust and powdery mildew, which resulted in a high frequency of Lr26 in Chinese wheat cultivars and lines (He et al. 2001). In this study, the frequency of Lr26 was 38.1% out of 84 tested wheat lines by seedling gene postulation. The Lr genes were determined at the seedling stage according to the gene-for-gene law. However, there were obvious limitations in this study due to our inability to identify all the Lr genes (Boroujeni et al. 2011). Yang (2003) found that there were inconsistencies between gene postulation and molecular identification, the consistency between the two methods was about 60% when molecular markers for Lr9, Lr19, Lr24, Lr35 and Lr38 were employed (Yang 2003). In this study, the consistency between Lr26 gene postulation and molecular detection was 100.0%, indicating the 12 races of P. triticina possess greater discriminability. However, it is inevitable that gene postulation will be affected by an uncontrolled environment and the high discriminability of a couple of strains. It is difficult to identify all leaf rust resistance genes at a time, especially when a single cultivar may contain many resistance genes. Therefore, when the specificity and stability are conjugated together for a molecular marker, the result will be much more reliable. With the development of more molecular markers, gene postulation will be complemented by marker-assisted selection to identify more resistance genes among wheat lines.

4. Conclusion In this study, we set up a methodology for postulating Lr genes in a cultivar, which could also be borrowed to other

1997

similar situation, such as, yellow rust and powdery mildew postulation. Some of the published molecular markers are vigorous and stable, but others cannot be used on the verification or confirmation for leaf rust postulatioin. In this case, we should develop much more effective molecular markers for marker assistant selection (MAS) for such huge wheat genome. As a potential technique, it is essential for plant pathologists to develop a fast and accurate method for MAS.

5. Materials and methods 5.1. Plant materials Eighty-four wheat varieties and advanced breeding lines (Table 3) were tested for their response to races of P. triticina. The lines Zhengzhou 5389 (winter habit) and Thatcher (spring habit) were used as susceptible controls. Differential sets containing 20 NILs in a Thatcher background and 6 single-gene lines used in many countries such as Australia, the United States, Iran, etc., were included in order to characterize races of P. triticina (Table 1). The NILs were provided by Dr. Robert Park, Plant Breeding Institute, The University of Sydney, Australia.

5.2. P. triticina races To identify Lr genes in Chinese wheat cultivars, the infection types of 12 Chinese P. triticina races on the 26 Lr genes were noted in order to compare their IT patterns. To obtain sufficient urediniospores for inoculation, single-pustule isolates were propagated on the susceptible line Zhengzhou 5389. Race nomenclature was based on the Prt code system from North American described by Long and Kolmer (1989).

5.3. Seedling testing A total of 84 wheat varieties and 20 NILs with Thatcher background and 6 single-gene lines such as W976, Manitou, W203, Awned, Gatcher, CS2D-2M were used in this study. 5 to 10 wheat seedlings per line were raised separately on a plastic tray (35 cm×24 cm) filled with a soil:peat (3:1) mixture. Zhengzhou 5389 was used as a susceptible control. 10-day-old seedlings were inoculated by spraying a suspension of 7–10 mg of fresh urediniospores in 0.5 mL of the light weight mineral oil Isopar L (Exxonmobile Chmeical Co. Ltd., Spring, USA) using an atomizer pressured by an air pump (20 kPa). After allowing the oil to evaporate for 60–90 min, the inoculated seedlings were put in a barrel in order to retain moisture at 16–20°C for 15–16 h in the dark, then transferred to the greenhouse at 16–20°C with 12–14 h light every day. The infection types were scored 12 to 15 dpi on a 0 to 4 scale as documented by Roelfs et al. (1984).

1998

REN Xiao-li et al. Journal of Integrative Agriculture 2015, 14(10): 1992–2001

Table 3 Pedigrees and origins of 84 Chinese wheat genotypes used in this study Line no. 1

Genotype Lantian 10

Pedigree

Origin

76-89-13/Xifeng 16 (Yan’an 11/Jinnong 106)

Gansu

2

04 Zhong 3604

3

Zhoumai 17

4

Xu 856

5

Shi 4185

Tal/Zhi 8094//Yumai 2/3/Jimai 26 (Aiganzao/Lovrin 10//Jinfeng 1)

6

Weimai 8

883069/Aus621106

Shandong

7

Heng 95 Guan 26

84 Guan749/87-263

Hebei

8

Zhoumai 18

Neixiang 185/Zhoumai 9

Henan

9

Shannong 664

520627/Nannong 871

10

Zhoumai 16

Yumai 21/Zhou 8425B

Henan

11

GS Zhengmai 004

Yumai 13/90m434//Shi 89-6021 (Jimai 38)

Henan

12

Han 4564

88-6012/Shi 5144

Hebei

13

Jingdong 8

Aurora /5238-016//Hongliang 4/3/You 7-Lovrin 10

Beijing

14

Huaimai 20

Yumai 13/Lumai 14

Jiangsu

15

Lumai 1

16

Wanmai 369

Bainong 64/Zhoumai 11

Henan

Aizao 781/Zhou 8425B//Zhoumai 9

Henan

Zhengzhou 8329/Xuzhou 86195-14-4-4-1

Jiangsu

Shandong

Aifeng 3//Mengxian 201//Neuzucht

Shandong

Tai 182(3)/Wankang 43//Tai 7107/Neixiang 182(4)

17

Jimai 21

18

Heng 5229

Ji 5418/Heng 5041

19

Lianmai 2

Jian 94(73)/Lumai 21

Hebei

Henan

865186/Chuannongda 84-1109//Ji 84-5418

Shandong Hebei Jiangsu

20

Fanmai 5

Ji 5418/Jingfan 309//Zhou 13

Henan

21

Bainong AK 58

Zhoumai 11/Wenmai 6/Zhengzhou 8960

Henan

22

Hedong TX-006

Lumai 14//89D002/Yun 7816-28

Shanxi

23

Lunxuan 987

Recurrent selection

Beijing

24

Shijiazhuang 8

Shi 91-5065/Shi 9306 (Jimai 38)

Hebei

25

Huapei 5

Yumai 18/Hua 4-3

Henan

26

Xiangmai 986

Zhoumai 9/Yumai 18//Yumai 18

Henan

27

Zhengmai 9694

Yumai 21/Yumai 18//Yumai 21

Henan

28

Han 6172

Han 4032/Zhongyin 1

Hebei

29

Zhengmai 98

Derivatives from recurrent selection population

Henan

30

Miannong 4

31

Luomai 21

Luomai 1/Zhoumai 13

Henan

32

Shaan 229

Shaan 7853//TB902/Xiaoyan 6

Shanxi

33 34

Zhengmai 366 Jimai 19

Lumai 13/Linfen 5064 12057//Han 522/K37-20

75-21-4/76-19//Miannong 1(Mianyang 11/Alondra “S”)

Sichuan

Yumai 47/PH82-2-2

Henan Shandong

35

Jinmai 47

36

Chang 4640

Changzhi 5613/Jinmai 63

Shanxi

37

Yumai 18

Zhengzhou 761/Yanshi 4

Henan

38

Yunong 949

Zhengtaiyu 92215/90 m 4341190 (232)

Henan

39

Xinmai 11

Zhou 8826/Xinxiang 3577

Henan

40

Zimai 12

41

Chuanmai 107

42

Wanmai 48

43

Yanzhan 4110

Shanxi

73-1104/Yexuan 1//03201/3/73-1104/Yexuan 1/4/Guinong 35-2 2496/80-28-7

Shandong Sichuan

Aizao 781/Wansu 8802

Anhui

((C39/Xibei 78(6)9-2)//(FR81-3/Aizao 781-4))//Aizao 781-4

Henan

44

Wanmai 38

Yanzhong 144/85-15-9

Anhui

45

Ping’an 6

Laizhou 953/Wen 2540

Henan

46

Zhengmai 9023

Xiaoyan 6/Xinong 65//83(2)3-3/84(14)43/3/

Henan

47

Yumai 34

Aifeng 3//Meng 201//Neuzucht/3/Yumai 2

Henan

48

Yangmai 158

49

Yumai 69

9-16/St1472/506

Jiangsu

Baiquan 3047-3/Neixiang 82C6

Henan

(Continued on next page)

1999

REN Xiao-li et al. Journal of Integrative Agriculture 2015, 14(10): 1992–2001

Table 3 (Continued from preceding page) Line no. 50

Genotype Jinan 17

Pedigree

Origin

Linfen 5064/Lumai 13

Shandong

51

Yangmai 17

92F101/Chuanyu 21256

Jiangsu

52

Xinong 979

Xinong 2611/(918/95Xuan 1) F1

Shanxi

53

Lumai 23

54

Yannong 19

55

Jimai 20

56

Gaomai 8901-11

Lumai 8/Dali’ai

Shandong

Yan 1933/Shan 82-29

Shandong

Lumai 14/Lumai 884187

Shandong

7292/Landrace Xingfu//Landrace Linzhang

Hebei

57

Yumai 41

Bainong 791//Wenxuan 1/Zhengzhou 761/3/Yumai 2

Henan

58

Zhengnong 16

Zhengnong 7/Xiaoyan 6

Henan

59

Chuanmai 39 Chuannong 19 Pumai 9

Mo444/90-7 1104A/R935 (Xuzhou 174/Neixiang 183) F1/Yumai 24

60 61

Sichuan Sichuan Henan

62

Fumai 936

(Wanmai 20/Jimai 5418) F1//Neixiang 188

Anhui

63

Luohan 2

Yumai 49/Shannong 45

Henan

64

Yangmai 11

3*Yangmai 158/4/Yuma/8*Chancellor//Yangmai 5/3/4*Yang 85-85

Jiangsu

65

Yangmai 15

89-40/Chuanyu 21526

Jiangsu

66

Yumai 47

Baofeng 7228/Baiquan 3199

Henan

67

Mianyang 26

68

Wanmai 19

Chuanyu 9/Mianyang 20 Bo’ai 74-22/Yumai 2

Sichuan Anhui

69

Mianyang 28

T79350-1-4-1-2/Mianyang 11

Sichuan

70

Xiaoyan 22

Xiaoyan 6//775-1/Xiaoyan 107

Shanxi

71

Gaoyou 9409

8818/8901

Hebei

72

Taishan 22

Lumai 18/Lumai 14

73

Wanmai 50

Zhengzhou 8329/Wanmai 19

Anhui

74

Wanmai 53

Yumai 29/Wanmai 19

Anhui Henan

Shandong

75

Yumai 58

Tal recurrent selection

76

Jinmai 54

12057/Han 522//K37-20

Shanxi

77 78

Jing 9428

Jing 411 (Fengchan 2 (Youmangbai 4/Lovrin 10)/Changfeng 1)/German Dunbanmai

Beijing

Chuanmai 42

(Syn-CD768/SW3243)/Chuan6415

Sichuan

79

Changhan 58

Changwu 112/PH82-2

Shanxi

80

Qinnong 142

Zhengzhou 8329/Zhi 87135-2-1-2-9

Shanxi

81

Yunhan 22-33

89D46/90-13-20

Shanxi

82

Chang 6878

Linhan 5178/Jinmai 63

Shanxi

83

Nongda 135

Shan 225/Linfen 5064

Beijing

84

Taikong 6

Irradiation variants from Yumai 49

Henan

Infection types 0 to 2+ were considered low reaction, and infection types 3– to 4 were considered high reaction. The experiments were carried out two times.

5.4. Gene postulation The postulations were carried out based on the principle proposed by Browder (1973) and Dubin et al. (1989). SAS macro software for gene postulation (Wamishe et al. 2004) was used to identify genes (Wamishe and Milus 2004).

5.5. Molecular marker identification of Lr genes DNA was extracted and purified from 7-day-old wheat seed-

lings based on the modified CTAB method (Gill et al. 1991). The specificities of 11 STS and SCAR molecular markers were confirmed according to the literature (Table 4) (data not shown). Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. in China. The PCR experiments were repeated twice independently. The primer sequences for the target Lr genes are presented in Table 4. PCR reaction was performed in a 10-μL reaction mixture containing: 5 μL 2×Taq plus PCR MasterMix (Tiangen Biochemical Incorporation, Beijing), 0.5 μL (5 μmol L–1) of each primer, and 100 ng of template DNA. PCR conditions: pre-denaturing at 94°C for 3 min, 35 cycles (94°C, 1 min, 52–68°C, 1 min, 72°C, 2 min), final extension at 72°C for 10 min. The PCR products were separated on a 1.5%

2000

REN Xiao-li et al. Journal of Integrative Agriculture 2015, 14(10): 1992–2001

Table 4 PCR primers and conditions for detecting Lr genes as well as specific fragment sizes used in this study Lr gene

Marker type

Primer

Sequence of primer (5´→3´)

Lr9

STS

Lr10

STS

Lr19

STS

Lr20

STS

Lr21

STS

Lr24

STS

Lr26

STS

TCCTTTTATTCCGCACGCCGG CCACACTACCCCAAAGAGACG GAAGCCCTTCGTCTCATCTG TTGATTCATTGCAGATGAGATCACG CATCCTTGGGGACCTC CCAGCTCGCATACATCCA ACAGCGATGAAGCAATGAAA GTCCAGTTGGTTGATGGAAT CGCTTTTACCGAGATTGGTC TCTGGTATCTCACGAAGCCTT TCTAGTCTGTACATGGGGGC TGGCACATGAACTCCATACG GCAAGTAAGCAGCTTGATTTAGC AATGGATGTCCCGGTGAGTGG

Lr29

SCAR

J13/1 J13/2 Lrk10D1 Lrk10D2 Lr19GbF Lr19GbR Lr20STS638-L Lr20STS638-R Lr21L Lr21R Lr24 J 9/1 Lr24 J 9/2 Lr26F: IB-267 Lr26R: IB-267 IBIB-267IB-267 OPY10/1 OPY10/2

GTGACCTCAGGCAATGCA GTGACCTCAGAACCGATG

agarose gel in 1× TAE and stained with ethidium bromide, then photographed under UV light.

Acknowledgements Yang Shouqin and Sun Yuxia, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, China, are acknowledged for their technical assistance. Dr. Eugene A Milus at University of Arkansas, USA, is appreciated for his critical review for the earlier version of the manuscript. The work was financed by the Ministry of Science and Technology of China (2011CB100403, 2013CB127701, 2012BAD19B04 and 2012AA101501), the National Natural Science Foundation of China (31371884), the Ministry of Agriculture of China (CARS-03), and Science & Technology aiding to Xinjiang Uygur Autonomous Region, China (2013911092) during the course of the study.

References Boroujeni F R, Arzani A, Afshari F, Torabi M. 2011. Postulation of leaf rust resistance genes in Iranian wheat cultivars and breeding lines. Canadian Journal of Plant Pathology, 33, 550–558. Browder L E. 1973. Specificity of the Puccinia recondita f. sp. tritici: Triticum aestivum ‘Bulgaria 88’ relationship. Phytopathology, 63, 524–528. Chai J F, Zhou R H, Jia J Z, Liu X. 2006. Development and application of a new codominant PCR marker for detecting 1BL center dot 1RS wheat-rye chromosome translocations. Plant Breeding, 125, 302–304. Chen W Q, Wang J X. 1997. Genes for leaf and stem rust resistance in 76 wheat genetic resources. Acta Agronomica Sinica, 23, 655–663. (in Chinese)

Annealing temp. (°C) 66

Size (bp) 1 100

Reference

58

282

56

130

Schachermayr et al. (1994) Schachermayr et al. (1997) Prins et al. (2001)

60

542

Neu et al. (2002)

57

669

57

310

60

210

Huang and Gill (2001) Schachermayr et al. (1995) Mago et al. (2002)

60

850

Tar et al. (2002)

Cherukuri D P, Gupta S K, Charpe A, Koul S, Prabhu K V, Singh R B, Haq Q M R. 2005. Molecular mapping of Aegilops speltoides derived leaf rust resistance gene Lr28 in wheat. Euphytica, 143, 19–26. Dubin H, Johnson R, Stubbs R. 1989. Postulated genes for resistance to stripe rust in selected CIMMYT and related wheats. Plant Disease, 73, 472–475. Fang Z. 1994. Breeding of winter wheat variety Lumai 13 with drought-resistance and high-yield. Acta Agriculturae Boreall-Sinica, 9, 12–15. (in Chinese) Froidmont D. 1998. A co-dominant marker for the 1BL/1RS wheat-rye translocation via multiplex PCR. Journal of Cereal Science, 27, 229–232. Gill K S, Lubbers E L, Gill B S, Raupp W J, Cox T S. 1991. A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome, 34, 362–374. Gupta S K, Charpe A, Koul S, Prabhu K V, Haq Q M. 2005. Development and validation of molecular markers linked to an Aegilops umbellulata-derived leaf-rust-resistance gene, Lr9, for marker-assisted selection in bread wheat. Genome, 48, 823–830. Gupta S K, Charpe A, Prabhu K V, Haque Q M R. 2006a. Identification and validation of molecular markers linked to the leaf rust resistance gene Lr19 in wheat. Theoretical and Applied Genetics, 113, 1027–1036. Gupta S, Charpe A, Koul S, Haque Q, Prabhu K. 2006b. Development and validation of SCAR markers cosegregating with an Agropyron elongatum derived leaf rust resistance gene Lr24 in wheat. Euphytica, 150, 233–240. He Z H, Rajaram S, Xin Z Y, Huang G Z. 2001. A History of Wheat Breeding in China. CIMMYT, Mexico, DF. Huang L, Gill B. 2001. An RGA-like marker detects all known Lr21 leaf rust resistance gene family members in Aegilops tauschii and wheat. Theoretical and Applied Genetics, 103, 1007–1013.

REN Xiao-li et al. Journal of Integrative Agriculture 2015, 14(10): 1992–2001

Huerta-Espino J, Singh R P, German S, McCallum B D, Park R F, Chen W Q, Bhardwaj S C, Goyeau H. 2011. Global status of wheat leaf rust caused by Puccinia triticina. Euphytica, 179, 143–160. Li Z F, Xia X C, He Z H, Li X, Zhang L J, Wang H Y, Meng Q F, Yang W X, Li G Q, Liu D Q. 2010. Seedling and slow rusting resistance to leaf rust in Chinese wheat cultivars. Plant Disease, 94, 45–53. Liu T G, Chen W Q. 2012. Race and virulence dynamics of Puccinia triticina in China during 2000–2006. Plant Disease, 96, 1601–1607. Long D L, Kolmer J A. 1989. A North American system of nomenclature for Puccinia recondita f. sp. tritici. Phytopathology, 79, 525–529. Mago R, Spielmeyer W, Lawrence G, Lagudah E, Ellis J, Pryor A. 2002. Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1RS of rye using wheat-rye translocation lines. Theoretical and Applied Genetics, 104, 1317–1324. McIntosh R A, Dubcovsky J, Rogers W J, Morris C, Appels R, Xia X C. 2010. Catalogue of gene symbols for wheat: 2010 supplement. [2015-01-20]. http://www.shigen.nig. ac.jp/wheat/komugi/genes/macgene/supplement2010.pdf McIntosh R A, Dubcovsky J, Rogers W J, Morris C, Appels R, Xia X C. 2014. Catalogue of gene symbols for wheat: 2013–2014 supplement. [2015-01-20]. http://www.shigen. nig.ac.jp/wheat/komugi/genes/macgene/supplement2013. pdf McIntosh R A, Wellings C R, Park R. 1995. Wheat Rusts: An Atlas of Resistance Genes. Kluwer Academic Publishers, Dordrecht, Netherlands, CSIRO, Australia. McIntosh R A, Yamazaki Y, Devos K M, Dubcovsky J, Rogers J, Appels R. 2003. Catalogue of gene symbols for wheat. In: Pogna N E, Romano N, Pogna E, Galterio G, eds., Tenth International Wheat Genetics Symposium. Instituto Sperimentale per la Cerealcoltura, Roma, Italy. Neu C, Stein N, Keller B. 2002. Genetic mapping of the Lr20Pm1 resistance locus reveals suppressed recombination on chromosome arm 7AL in hexaploid wheat. Genome, 45, 737–744. Prins R, Groenewald J, Marais G, Snape J, Koebner R. 2001. AFLP and STS tagging of Lr19, a gene conferring resistance to leaf rust in wheat. Theoretical and Applied Genetics, 103, 618–624. Qi Z J, Liu D J, Chen P D, Li Q Q. 2001. Molecular cytogenetic analysis of winter wheat germplasm Aimengniu. Acta Botanica Sinica, 43, 469–474. (in Chinese) Ren X L, Liu T G, Liu B, Gao L, Chen W Q. 2012. Multiplex PCR assay for detection of wheat leaf rust resistance genes Lr9–Lr26 and Lr19–Lr20 in 116 Chinese wheat cultivars

2001

(lines). Plant Protection, 38, 29–36. (in Chinese) Roelfs A P. 1984. Race specificity and methods of study. In: Bushnell W R, Roelfs A P, eds., The Cereal Rusts. vol. I. Academic Press, New York. pp. 131–164. Schachermayr G, Feuillet C, Keller B. 1997. Molecular markers for the detection of the wheat leaf rust resistance gene Lr10 in diverse genetic backgrounds. Molecular Breeding, 3, 65–74. Schachermayr G, Siedler H, Gale M D, Winzeler H, Winzeler M, Keller B. 1994. Identification and localization of molecular markers linked to the Lr9 leaf rust resistance gene of wheat. Theoretical and Applied Genetics, 88, 110–115. Schachermayr G M, Messmer M M, Feuillet C, Winzeler H, Winzeler M, Keller B. 1995. Identification of molecular markers linked to the Agropyron elongatum-derived leaf rust resistance gene Lr24 in wheat. Theoretical and Applied Genetics, 90, 982–990. Singh R P, Chen W Q, He Z H. 1999. Leaf rust resistance of spring, facultative, and winter wheat cultivars from China. Plant Disease, 83, 644–651. Tar M, Purnhauser L, Csösz L, Mesterházy A, Gyulai G. 2002. Identification of molecular markers for an efficient leaf rust resistance gene (Lr29) in wheat. Acta Biologica Szegediensis, 46, 133–134. Wamishe Y A, Milus E A. 2004. Seedling resistance genes to leaf rust in soft red winter wheat. Plant Disease, 88, 136–146. Wamishe Y A, Thompson K C, Milus E A. 2004. A computer program to improve the efficiency and accuracy of postulating race-specific resistance genes. Plant Disease, 88, 545–549. Yang W X. 2000. The postulated genes for resistance to leaf rust in 21 wheat cultivars used in Hebei province. Journal of Agricultural University of Hebei, 23, 69–72. (in Chinese) Yang W X. 2003. Molecular Markers for Lr37, Lr44 based on AFLP and detection of wheat leaf rust resistance genes in 124 wheat cultivars (lines). PhD thesis, Agricultural University of Hebei, China. (in Chinese) Yang Z M, Tang B R, Shen K Q, Xia X C. 1994. A strategic in wheat resistance breeding-building and utilization of sources of second line resistance against rusts and mildew in China. Acta Agronomica Sinica, 20, 385–394. (in Chinese) Yuan J H, Liu T G, Chen W Q. 2007. Postulation of leaf rust resistance genes in 47 new wheat cultivars (lines) at seedling stage. Scientia Agricultura Sinica, 40, 1925–1935. (in Chinese) Zhuang Q S. 2003. Chinese Wheat Improvement and Pedigree Analysis. China Agriculture Press, Beijing. (in Chinese) (Managing editor ZHANG Juan)