Potato virus Y induced changes in the gene expression of potato (Solanum tuberosum L.)

Physiological and Molecular Plant Pathology 67 (2006) 237–247 www.elsevier.com/locate/pmpp

Potato virus Y induced changes in the gene expression of potato (Solanum tuberosum L.) Marusˇa Pompe-Novak a,*, Kristina Gruden a,b, Sˇpela Baebler a, Hana Krecˇicˇ-Stres a, Maja Kovacˇ a, Maarten Jongsma c, Maja Ravnikar a a

National Institute of Biology, Vecˇna pot 111, 1000 Ljubljana, Slovenia b Jozˇef Stefan Institute, Jamova 39, 1000 Ljubljana, Slovenia c Plant Research International, Postbus 16, 6700 AA Wageningen, The Netherlands Accepted 27 February 2006

Abstract The tuber necrotic strain of Potato virus Y (PVYNTN) causes potato tuber necrotic ringspot disease in sensitive potato cultivars. Gene expression in the disease response of the susceptible potato (Solanum tuberosum L.) cultivar Igor was investigated at different times after infection, using subtractive hybridization, cDNA microarrays and real-time PCR. The most pronounced change in the expression pattern of functionally diverse groups of genes was detected in systemically infected leaves 14 days after inoculation, and in leaves of plants grown from infected tubers. The expression of several stress-related genes during the infection process, including those for heat shock proteins, catalase 1, b-1,3-glucanase, wound inducing gene, and genes involved in photosynthesis, suggests their role in the susceptible potato–PVYNTN interaction. q 2006 Elsevier Ltd. All rights reserved. Keywords: cDNA microarrays; Gene expression; Solanum tuberosum L.; Potyviruses; Potato virus YNTN; Real-time PCR; Subtractive hybridization

1. Introduction Plant responses to plant pathogens are complex, involving a range of signaling pathways [1], and show a broad spectrum of physiological and histological changes. Depending on the pathogen type, plants can exhibit resistance or sensitivity. Necrotic lesions, one of the most frequent phenomena in plant– pathogen interactions, may occur in both resistant and sensitive plants. In a resistant plant, the pathogen is restricted to the necrotic lesions, which are part of a hypersensitive reaction [2]. The encounter between a sensitive plant and a pathogen results in disease, despite the formation of necrotic lesions [3]. It has become increasingly apparent that the speed and extent of the plant response determines the outcome of the plant-pathogen interaction [4]. Hosts react to virus infection in complex ways defined by the demands of the virus, host defenses, host stress factors, cellular responses and local and remote tissue Abbreviations: dpi, days after inoculation; hsp, heat shock protein gene; HSP, heat shock protein. * Corresponding author. Tel.: C386 1 4233388; fax: C386 1 2573847. E-mail addresses: [email protected] (M. Pompe-Novak), hana. [email protected] (H. Krecˇicˇ-Stres). 0885-5765/$ - see front matter q 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.pmpp.2006.02.005

responses [5]. Most work in the field of plant–pathogen interactions has been carried out on plant–bacterial and plant– fungal interactions, while plant responses to viruses are less well understood. Potato virus Y (PVY), a member of the Potyviridae family, has long flexuous particles of 730!11 nm. The particles contain a single molecule of linear, positive sense, singlestranded RNA [6]. There are different strains, PVYNTN being the most aggressive. Most potato cultivars are susceptible and develop diverse symptoms after PVYNTN infection. In sensitive potato cultivars, PVYNTN causes potato tuber necrotic ringspot disease (PTNRD), which significantly decreases the quality and quantity of the yield. Because of the importance of potato as a crop and the epidemic spread of PVYNTN in Europe and other continents from the 1980s onwards, many physiological and morphological parameters have been studied in PVYNTN infected plants. The cultivar Igor is one of the most susceptible and sensitive varieties to PVYNTN. Symptoms are visible on all tubers as severe necrotic ringspots, and on green parts of the plants. A few days after infection, necrotic spots (local lesions) appear on inoculated leaves, with wrinkles and mosaic chloroses appearing later on non-inoculated leaves, as the virus spreads. A palm tree appearance (leaf drop) arises in both primary and secondary infections [7]. Changes can also be seen on the cellular level. In the necrotic spots, of cv. Igor,

238

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247

a swelling of chloroplasts, a loosening of the thylakoid structure and changes in the optical density of chloroplasts were found, while in the parts of leaves around the necrotic spots, only a decrease in the size of chloroplasts was observed [8]. At the time of local lesion development, chlorophyll levels were lower in PVYNTN infected potato leaves than in healthy ones. At the same time, a higher activity of soluble and ionically-bound peroxidases and lower activity of covalentlybound peroxidases were reported than in healthy controls [9]. Fourteen days after infection, several new proteins appeared and some protein breakdown was observed [10]. Lower levels of cytokinins were observed in PVYNTN infected susceptible potato cv. Igor than in control plants. Since, these plant hormones also promote chloroplast development, this observation correlates with the low chlorophyll level [11]. These studies have shown a correlation between plant symptoms and individual physiological and morphological parameters, but have been unable to track the overall changes arising from the interaction of potato and PVYNTN virus. Further, no comprehensive studies on the gene expression level have been carried out during the potato–virus interaction. The aim of the present work was to monitor gene expression and attempt to identify some potato genes involved in the disease response of the highly sensitive potato cv. Igor to PVYNTN, using cDNA microarrays enriched for differentially expressed genes.

2. Materials and methods 2.1. Plant material and symptom development Virus free and PVYNTN infected potato tubers of cv. Igor were supplied by KZˇK Kranj. Tubers or plants from node tissue culture (cultivated for 2 weeks) were planted in soil and plants were kept at 21G2 8C in growth chambers, with illumination at 70 mMmK2 sK1 (Osram L36W/77 lamp), a photoperiod of 16 h and relative humidity 70%. After 4 weeks, four bottom leaves of each plant grown from node tissue culture were mechanically inoculated with the sap of PVYNTN infected plants of cv. Igor (primary infection) or the sap of healthy plants of cv. Igor (mock-inoculation). Plants grown from PVYNTN infected

tubers (secondary infection) were left intact. Plants grown from virus free tubers were used as control. Inoculation efficiency and the infection status of plants were verified by DAS-ELISA [12]. The bottom inoculated leaves of primary infected plants developed necrotic spots (local lesions) 7 days after inoculation (dpi) (Fig. 1a), while there were no visible symptoms on upper non-inoculated leaves at that time. At 14 dpi, inoculated leaves had disappeared, while wrinkles and mosaic chloroses had appeared on non-inoculated leaves (systemic symptoms) (Fig. 1b). Plants grown from infected tubers showed symptoms similar to systemic ones in primary infected plants. At 7 dpi, the inoculated leaves were collected separately from upper non-inoculated leaves, in mock- and virusinoculated (primary infection) plants. At 14 dpi only noninoculated leaves were sampled in mock- and virus-inoculated plants, as inoculated leaves were already absent at that time. Leaves of plants grown from infected (secondary infection) and healthy tubers were sampled 35 days after tuber planting. Collected leaf tissues were frozen immediately in liquid nitrogen and stored at K80 8C for further analysis. Leaves from up to eight plants were pooled for each sample. Four replicates of each experiment were carried out. 2.2. Subtracted cDNA libraries Two differentially expressed gene libraries—a library of up-regulated genes and a library of down-regulated genes in infected plants—were prepared by subtractive hybridization and suppression polymerase chain reaction (PCR). Total RNA was isolated with an RNeasy Plant Mini Kit (Qiagen) from 100 mg of leaf tissue. mRNA was purified with an mRNA purification kit (Amersham Pharmacia Biotech). cDNA was synthesized with a time saver cDNA Synthesis kit (Amersham Pharmacia Biotech). A PCR-Select cDNA Subtraction kit (Clontech) was used as instructed by the manufacturer for constructing cDNA libraries. Unsubtracted cDNA molecules were ligated to pGEM-T Easy vector plasmids (Promega) and introduced into Escherichia coli DH5a cells [13]. Among the transformants obtained, 156 from the library enriched for up-regulated genes and 226 from the library enriched for

Fig. 1. (a) Primary symptoms on inoculated leaves of PVYNTN infected potato plants (7 dpi) of cv. Igor. Leaves from the bottom of the plant upwards are shown from left to right. (b) Systemic symptoms on leaves of PVYNTN infected potato plants (14 dpi) of the same cultivar.

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247

down-regulated genes were picked individually and cDNA inserts were sequenced using an ABI Prism Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems). 2.3. Gene annotation Vector and adaptor sequences were trimmed off from the raw clone sequence data. Similar protein and nucleotide sequences were retrieved from GenBank (http://www.ncbi.nlm.nih.gov) and EST databases (http://www.ncbi.nlm.nih.gov/dbEST) using batch Blastn, Blastx and tBlastx [14] at NCBI. All sequences were also checked against the TIGR Potato Gene Index (http://www.tigr.org). Default parameters were used in all programs. Except for three sequences, only similarities with expect value (E) smaller or equal to 10K3 were considered to be significant, if no lower scores were obtained. Clones that produced hits with identical descriptions were aligned to each other and to the database entry with the lowest E value using the ClustalW alignment algorithm [15] at the EMBL European Bioinformatics Institute (http://www.ebi.ac.uk/clustalw/) or at BCM Search Launcher (http://searchlauncher.bcm.tmc.edu/ multi-align/multi-align.html) to determine the identity of each clone. Each clone was assigned the description of the database entry with the lowest blast score. When the same description represented different genes, they were assigned successive numbers in square brackets. When the sequences were aligned to different parts of the same gene, they were assigned successive letters in square brackets. The total number of genes with the same description is stated as the last number in square brackets. 2.4. Preparation of the microarray slides Inserts of cDNA of 382 clones from differentially expressed gene libraries (GenBank accession numbers: CK325395– CK325776) and of nine clones of cysteine and aspartic proteinase inhibitors (GenBank accession numbers: U59277, U59276, U59275, U59274, U59273, U59272, X53470 and Q43645) previously isolated from potato plants were PCRamplified using primers that were complementary to vector sequences flanking both sides of the cDNA insert, membranepurified using a QIAquick 96 PCR BioRobot Kit (Qiagen), eluted, air-dried and redissolved in 10 ml 5!SSC, giving a final DNA concentration of 0.5–1.0 mg/mL. pAH yeast (Saccharomyces cerevisiae) cDNA clones were included for use in non-specific background hybridization measurements. The complete coding sequence of the firefly (Photinus pyralis) luciferase gene (GenBank accession number E02267) was included for normalization purposes, to correct the expression ratios for channel-specific effects. Three partial clones encompassing the 5 0 -, middle- and 3 0 -part of the luciferase gene were included to monitor the integrity of the labeled sample cDNA [16]. Microarrays were spotted on GAPS Amino Silane Coated glass slides (Corning) using a PixSys 7500 arrayer (Cartesian Technologies) equipped with four quill pins (Telechem). Spotting volumes were about 0.5 nl, resulting in a spot diameter of 120 mm. Each clone was spotted at least twice.

239

pAH yeast cDNA and luciferase cDNA were spotted evenly on the cDNA microarrays in up to 11 repeats. Slides were rehydrated by holding them over a bath of hot water (w70 8C), snap-dried on a 95–100 8C hot plate for 5– 10 s and the DNA cross-linked using a UV cross-linker (150 mJ). The slides were soaked twice in 0.2% SDS for 2 min, twice in water purified with the Milli-Qw Ultrapure water purification system (Millipore) for 2 min and transferred to boiling water for 2 min to allow DNA denaturation. After 5 min of thorough drying, the slides were rinsed three times in 0.2% SDS for 1 min, once in water for 1 min, submerged in boiling water for 2 s and dried. 2.5. Microarray hybridizations cDNA microarrays were hybridized with four pairs of probes that are described in Table 1. Each pair consisted of a probe derived from PVYNTN infected plants and a probe derived from healthy plants: (i) lower inoculated leaves of primary infected plants versus lower mock-inoculated leaves of healthy plants, collected 7 dpi, (ii) upper non-inoculated leaves of primary infected versus upper non-inoculated leaves of mock-inoculated plants, collected 7 dpi, (iii) non-inoculated leaves of primary infected versus non-inoculated leaves of mock-inoculated plants, collected 14 dpi and (iv) leaves of secondary infected plants grown from infected tubers versus leaves of plants grown from healthy tubers. Besides the four pairs of probes mentioned above, cDNA microarrays were hybridized with two RNA samples isolated independently from the same plant material, in order to determine the experimental variability of the method. Total RNA was isolated from 300 mg of plant tissue with the RNeasy Plant Mini kit (Qiagen). mRNA was purified with a Dynabeads kit (Dynal) according to the manufacturer’s instructions. 0.5 mg of each mRNA sample was spiked with 1.0 ng of in vitro synthesized luciferase mRNA (Promega) and reverse-transcribed in the presence of 5-(3-aminoallyl)-2 0 dUTP (Sigma) using SuperScript II RNase H-Reverse Transcriptase (Invitrogen) and 2 mg oligo(dT)21 as a primer. After incubation at 37 8C for 2 h, nucleic acids were ethanol precipitated at room temperature and dissolved in 10 ml 1!TE (pH 8.0). Next, cDNA/mRNA hybrids were denatured for 3 min at 98 8C and chilled on ice. RNA was degraded by adding 2.5 ml 1 M NaOH and incubating for 10 min at 37 8C. After neutralizing the mixture by adding 2.5 ml 1 M HEPES (pH 6.8) and 2 ml 1 M HCl, the cDNA was recovered by ethanol precipitation and resuspended in 10 ml 0.1 M sodium carbonate buffer (pH 9.3). In the second step, the modified cDNA was coupled to a fluorescent dye, either Cyanine 3 (Cy3) or Cyanine 5 (Cy5), using reactive Cy3- or Cy5-NHS-esters (ApBiotech). Ten microliter of 10 mM dye in DMSO was added to 10 ml of the cDNA sample and incubated at room temperature for 30 min. The labeled cDNA was ethanol precipitated twice and dissolved in 5 ml bi-distilled water. Following prehybridization for 2 h at 42 8C in hybridization buffer (50% formamide, 5!Denhardt’s reagent, 5!SSC, 0.2% SDS and 0.1 mg/ml denatured salmon sperm genomic

240

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247

Table 1 Pairs of probes for the hybridization of cDNA microarrays Pairs of probes

Position of the collected leaves on plants

Inoculation status of the collected leaves

Infection status of the tubers at the time of planting

Inoculation status of the plants

Infection status of the plants

Time of the collection of the leaves

Lower

Inoculated

Healthy

PVYNTN-inoculated

Lower

Mock-inoculated

Healthy

Mock-inoculated

PVYNTN primary infected Healthy

Upper

Non-inoculated

Healthy

PVYNTN-inoculated

Upper

Non-inoculated

Healthy

Mock-inoculated

Lower

Non-inoculated

Healthy

PVYNTN-inoculated

Lower

Non-inoculated

Healthy

Mock-inoculated

7 dpi-at the time of the appearance of necrotic spots on infected leaves 7 dpi-at the time of the appearance of necrotic spots on infected leaves 14 dpi-at the time of the appearance of systemic symptoms on infected plants

Lower

Non-inoculated

PVYNTN infected

Non-inoculated

Lower

Non-inoculated

Healthy

Non-inoculated

1st pair

2nd pair

3rd pair

4th pair

DNA), slides were rinsed in bi-distilled water and in isopropanol and then dried by 1 min centrifugation at 470g. For a dual hybridization, 50 ml of hybridization mixture, containing both (Cy3- and Cy5-labeled) samples at a concentration corresponding to 8 ng of the initial mRNA per microliter mixture, was used. Prior to use, the hybridization mixture was heated at 95 8C for 1 min, cooled on ice and centrifuged to remove any debris. Hybridizations were done overnight at 42 8C using a 10!10 mm Gene Frame with 25 ml volume (ABgene) in a hybridization chamber. After hybridization, slides were washed at room temperature in 1!SSC, 0.1% SDS for 5 min, followed by 0.1!SSC, 0.1% SDS for 5 min and rinsed briefly in 0.1!SSC before drying by centrifugation for 1 min at 470g. Each hybridization experiment was performed twice on two replicates from pooled plant material. Cy3 and Cy5 labels were swapped for each pair of isolated RNA to minimize any possible impact of inequalities in DNA incorporation and of photo-bleaching of the fluorescent dyes. 2.6. Image acquisition and analysis Microarrays were scanned using a fluorescence scanner ScanArray 3000 (Packard Biochip Technologies). Separate images were acquired for each fluor and different photomultiplier and laser power settings were used to achieve fluorescence values in the linear range. The average fluorescence intensity for each fluor and for each cDNA was determined using ScanArray 1.1.01 software (Packard Biochip Technologies). The data were normalized for channel specific effects using the linear regression method [17]. Scatter plots presenting the fluorescence intensities were designed and positions of spike-in controls (luciferase spots) and background controls were determined [18]. The fluorescence intensity of yeast spots was subsequently used for background subtraction. Spots showing a value of less than average background in Cy3 and

PVYNTN primary infected Healthy PVYNTN primary infected Healthy

PVYNTN secondary infected Healthy

35 Days after tuber planting

Cy5 channels were not considered for the analysis. The results were expressed as log2 of the ratio between the gene expression in infected and control plants, averaged over two replicate spots within the slide and the two replicate spots of the dyeswap slide (four independent spot intensity data), and the level of significance obtained by the Student’s t-test (***p!0.001, **p!0.01, *p!0.05). Results with a probability less than 95% were not considered reliable. For genes represented on the cDNA microarray by more than one clone, the average over all clones and the joint coefficient of variation were considered as the final result. In order to determine the experimental variability of the method, cDNA microarrays were hybridized with two control RNA samples isolated independently from the same plant material. Ninety-two percent of the log2 values of the observed ratios of gene expressions were between K0.5 and 0.5. In order additionally to exclude the possibility of false positive results, all log2 values of gene expression ratios between K0.5 and 0.5 were considered not significant, even though considered reliable by the Student’s t-test. Hierarchical clustering was performed using Vector Xpressione 3.0 software (Invitrogen) with weighted average linkage and Manhattan distance metric [19]. 2.7. Real-time PCR Changes in expression of five selected genes were analyzed by real-time PCR assay, based on either TaqManw (genes for PVY coat protein, catalase 1 and for a protein with unknown function [24/67]) or SYBRw Green technology (genes for heat shock protein 80 [1/1] and for a protein with unknown function [14/67]). Luciferase was used as an external control. RNA was isolated from 100 mg of the same plant material as used for microarray hybridizations and from plant material of three other biological replicates, using an RNeasy Plant Mini Kit (Qiagen). Ten microgram of total RNA was treated with 2 U of DNase (Invitrogen). cDNA was synthesized from 0.5 mg

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247

241

Table 2 Primer and probe sequences and optimized concentrations used in real-time PCR reactions for catalase 1, proteins with unknown function [24/67] and [24/67] and heat shock protein 80 [1/1] genes Gene

Primer/probe

Sequence (5 0 –3 0 )

Amplicon length (bp)

Concn in real-time PCR reaction (nM)

Catalase 1

FP RP MGB probe FP RP MGB probe FP RP FP RP

GAACGTAGGCTCAAGGACCTTATTAA AGGACTTGTCAGCCTGAGACAAGTAT FAM-CTCATGAGATTCGCAGCAT ACGCTCTCTTGGAGCTTCAGA AACATCCCCACAGGCTTAACA FAM-ACTATTCAATTCCATTGCTT TGTGCCTGATGAAGCGATAGA GCCCGAACACCCCAGTTT GAACGTAGGCTCAAGGACCTTATTAA AAATTTCCTTCTCTATGGTCTTCTCAA

91

900 900 250 900 900 250 900 900 900 900

Protein of unknown function [24/67] Protein of unknown function [14/67] Heat shock protein 80 [1/1]

RNA using a high capacity cDNA Archive Kit (Applied Biosystems), spiked with 2 ng of luciferase mRNA (Promega) and 5 mM oligo d(T)16 primers (Applied Biosystems). The primers and probes for selected genes were designed on the basis of available sequences using primer express (Applied Biosystems) software. Their sequences and concentrations used in real-time PCR reactions are shown in Table 2. The efficiency of amplification of each designed amplicon was checked by producing a standard curve from the results of amplifications of serial dilutions of reverse transcription reactions of one sample. The primers and probes for the PVY coat protein and luciferase genes were used as described by Toplak and coworkers [20]. Separate real-time PCR reactions for every selected and luciferase gene were set for each sample. The reaction mix contained TaqManw or SYBRw Green Universal PCR Master Mix (Applied Biosystems), optimal concentration of primers and probes (Table 2), and sample cDNA. Serial dilutions of one sample cDNA were produced for each amplicon in each run, in order to check the efficiency of amplification. Each sample was analyzed in a duplicate of two dilutions of reverse transcription reaction (corresponding to 0.2 and 0.02 ng of total RNA, and 0.7 and 0.07 pg luciferase mRNA). The reactions were set in an ABI PRISM 7900 Sequence Detection System (Applied Biosystems) using a 384 well thermo block and standard cycling parameters. When using SYBRw Green technology, the specificity was checked by melting curve analysis and gel electrophoresis (4% E-Gel, Invitrogen). Relative quantities of all analyzed RNAs were determined in virus and mock—inoculated plants. The raw data were normalized to a passive reference dye by SDS 2.0 (Applied Biosystems) software. Baseline and threshold were set manually, and Ct values were calculated by the software. The Ct values of each amplification reaction were used to calculate the difference (DCT) between the luciferase and target gene signal of the same sample. Relative quantification was performed using comparative CT method (DDCT). The results were expressed as the log2 of the ratio between gene expression in PVYNTN infected and healthy control plants.

111

75 93

3. Results 3.1. Functional classification of selected clones from differentially expressed gene libraries At the time of local lesion appearance (7 dpi), inoculated leaves were harvested and two libraries of differentially expressed genes were prepared by a combination of subtractive hybridization and suppression PCR. The library of upregulated genes was enriched for cDNA fragments corresponding to genes induced in PVYNTN inoculated leaves as compared to mock-inoculated leaves. Similarly, the library of downregulated genes was enriched for genes that were repressed in inoculated leaves, compared to mock-inoculated ones. Each library consisted of approximately 2000 independent colonies carrying partial cDNA sequences. The average insert length was 300 bp. Inserts of 156 randomly selected colonies from the library of up-regulated genes and of 226 colonies from the library of down-regulated genes were selected for printing to the microarray and sequenced. A full list of the selected clones, along with their GenBank accession numbers and expression data, is available in the Supplemental Table. A total of 258 sequences (67%) showed close matches to GenBank non-redundant database entries and an additional 113 sequences (30%) to the dbEST subdivision of GenBank (except for three sequences, E%10K3). Only 11 sequences (3%) produced no hit in the database search. The results were confirmed by a TIGR Potato Gene Index database search. Except for the virus sequences, all similar sequences found were from plants, mostly potato, tomato (Lycopersicon esculentum Mill.), tobacco (Nicotiana tabacum L.) and Arabidopsis thaliana (L.) Heynh. The sequences were analyzed further by alignment to each other and to the most significant entries from the database. Some clones were found to be identical and some constituted different parts of the same gene. The clones together represented a total of 175 different genes, classified into 14 functional groups (Fig. 2). Eleven genes corresponding to cDNA fragments with no matches in the database were listed as genes for unknown proteins.

242

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247

Fig. 2. Fourteen functional groups of genes (according to their similarity to known sequences in databases) spotted on cDNA microarrays.

3.2. Gene expression profile in primary and secondary infected potato plants The hybridization results are based on a microarray containing 382 clones from differentially expressed gene libraries and nine clones of cysteine and aspartic proteinase inhibitors isolated from potato plants, representing altogether 184 different potato genes. cDNA microarrays were hybridized with four pairs of probes in order to compare gene expression in primary and secondary infected potato plants (see Sections 2 and 2.5). Detailed expression data are available in the Supplemental Table. The interaction of genes responsive to PVYNTN infection in four hybridization pairs is illustrated by a Venn diagram (Fig. 3). Only the alteration in expression of a gene coding for the cytosolic NADP-malic enzyme, a widely distributed enzyme that catalyzes the oxidative decarboxylation of L-malate, was shared among all four hybridization pairs. The highest number (4) of regulated genes was shared between noninoculated leaves 14 dpi and leaves of secondary infected plants. Hierarchical clustering showed that gene expression in inoculated leaves was more similar (correlation coefficient 0.54) to that in non-inoculated leaves 7 dpi than to that in noninoculated leaves 14 dpi and in secondary infected leaves (correlation coefficients 0.50 and 0.48, respectively) (Fig. 4). However, the number of genes with altered expression shared between inoculated and non-inoculated leaves 7 dpi was not the highest (Fig. 3). The expression patterns of some genes that could be associated with virus infection, are described in more detail. The gene for heat shock protein 70 [2/2] was significantly down-regulated in inoculated leaves 7 dpi, in non-inoculated leaves 14 dpi and in leaves of secondary infected plants. In non-inoculated leaves 7 dpi, the 1.2-fold down-regulation was statistically significant, but it did not meet the criteria of the defined cut-off. Also the gene for heat shock protein 80 was

down-regulated in leaves of secondary infected plants, while it was up-regulated in inoculated leaves 7 dpi. The gene for glycine-rich RNA binding protein [2/2] was significantly down-regulated 7 dpi, but its down-regulation 14 dpi was not statistically significant. The gene was significantly up-regulated in leaves of secondary infected plants. The gene for ABC transporter protein 1 was significantly up-regulated in inoculated leaves 7 dpi, in non-inoculated leaves 14 dpi and in leaves of secondary infected plants. The gene for auxin repressed protein was significantly down-regulated in inoculated and in non-inoculated leaves 7 dpi. In leaves of secondary infected plants, the gene for b-1,3glucanase was significantly up-regulated and that for catalase 1 significantly down-regulated.

Fig. 3. A Venn diagram showing the interaction of genes differentially expressed in response to PVYNTN infection in leaves of primary and secondary infected potato plants of cv. Igor. The numbers of genes whose expression was commonly altered in non-inoculated leaves 7 dpi (NI-7), inoculated leaves 7 dpi (I-7) and non-inoculated leaves 14 dpi (NI-14) of primary infected plants and in leaves of secondary infected plants (SI), are shown in the overlapping positions of the circles. Circles for NI-7 and I-7 are divided into two circles.

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247

243

Fig. 4. Clustergram showing similarity of gene expression profiles in leaves of primary and secondary infected potato plants of cv. Igor. Hierarchical clustering with weighted average linkage and Manhattan distance metric was performed using Vector Xpression (Invitrogen) software. Correlation coefficients between gene expression profiles in non-inoculated leaves 7 dpi, and inoculated leaves 7 dpi, leaves of secondary infected plants and non-inoculated leaves 14 dpi were 0.54, 0.50 and 0.48, respectively.

The gene for a protein with unknown function [43/67] was significantly up-regulated 7 dpi, while that for a protein with unknown function [24/67] was significantly down-regulated 7 and 14 dpi. 3.3. Amplification and spread of viral genome PVY RNA was detected in all investigated leaves of infected potato plants. The largest amount of PVY RNA was detected in leaves of secondary infected plants. As expected, more PVY RNA was observed in leaves of infected plants at 14 rather than 7 days after inoculation. There was less PVY RNA in non-inoculated leaves than in inoculated leaves of infected plants 7 dpi (Supplemental Table). Relative quantities of viral RNA were also confirmed by real-time PCR analyses. In healthy plants, the number of copies of PVY RNA was zero, so the ratio of PVY coat protein expression is the ratio between the quantity of PVY RNA in infected plants and the background value. The ratio thus represents the nominal value [21]. 3.4. Verification of microarray hybridization results by real-time PCR The genes selected for verification with real-time PCR were genes for the PVY coat protein, as the only viral gene obtained, genes for catalase 1 and heat shock protein 80 [1/1] as the two genes previously reported to be involved in plant response to virus infection [22–24], and genes for proteins with unknown function ([14/67] and [24/67]) as the two genes with the most pronounced differential expression patterns. In the scatter plot, the correlations between the microarray and real-time PCR data for the five analyzed genes in all four hybridization pairs are shown (Fig. 5). Changes of gene expression obtained by real-time PCR correlate to those obtained with cDNA microarrays, the correlation coefficients between the microarray data and real-time PCR data of four biological replications being 0.91, 0.92, 0.92 and 0.95. The expression ratios obtained by real-time PCR analysis were higher than in microarray hybridizations. The higher expression ratios obtained in real-time PCR analysis, than in microarray hybridizations, can be attributed to the lower sensitivity and narrower linear range of microarray hybridization analysis than those of real-time PCR [20].

Fig. 5. Scatter plot representing the correlation between microarray and realtime PCR data for genes for PVY coat protein, catalase 1, heat shock protein 80 [1/1], protein with unknown function [14/67] and protein with unknown function [24/67], in leaves of primarily and secondarily infected potato plants cv. Igor. The log2 of the ratio between gene expression in infected and healthy plants from real-time PCR analysis (log2 real-time PCR) is plotted against the log2 of the ratio between gene expression in infected and healthy plants from cDNA microarray analysis (log2 cDNA microarrays). r, Correlation coefficient.

Similar results have been found comparing microarray hybridizations and Northern blot analysis [25]. 4. Discussion The aim of this study was to expand understanding of the potato–virus interaction, currently based on the available data for several separate genes and proteins [22,24,26], to a view of the host processes at the level of gene expression profiles on a larger scale. Recent microarray studies of plant—virus interactions have described alterations in the gene expression profile of A. thaliana after infection with Tobacco mosaic virus (TMV), Turnip vein clearing virus (TVCV), Oilseed rape mosaic virus (ORMV), Potato virus X (PVX), Cucumber mosaic virus (CMV) and Turnip mosaic virus (TuMV) [27,28]. These studies identified sets of genes that are candidates for regulating signaling pathways in the response of A. thaliana to viral infection. The viruses caused both specific and general changes in A. thaliana gene expression. Altogether, 114 A. thaliana genes, assigned to different functional classes such as signal transduction, transcription, cell rescue, defense, death and aging, were induced in response to five diverse positivestranded RNA viruses. We addressed this area of research with the analysis of the susceptible plant–virus interaction in potato, a crop species with worldwide importance, in order to complement studies performed on a model A. thaliana system. Our potato microarray experiments in general confirmed the differential expression of genes as described in studies of A. thaliana, since similar types of genes were significantly up- or downregulated.

244

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247

4.1. Transcription profiles in leaves of susceptible potato plants after PVYNTN infection We analyzed the gene expression profile in a susceptible and sensitive potato cv. Igor–PVYNTN interaction. Seven days after inoculation, we detected viral genome throughout the plant, as previously reported by Mehle and coworkers [29], so necrotic spots present on inoculated leaves at that time do not stop the virus from spreading to adjacent cells and tissues. Gene regulation, therefore, observed from 7 dpi, is rather an adaptive reaction of the plant to virus infection, and is only to a certain degree a defense reaction. Using our potato microarray, most changes in gene expression were detected in plants expressing systemic symptoms (14 dpi) and in secondary infected plants. However, only a few selected genes were responsive at the time of local symptom development (7 dpi). Similar results were reported by Golem and Culver [27]. The major differences in potato gene expression were detected 14 dpi, when systemic symptoms were fully developed. Interestingly, the regulated genes in primary infected plants were mostly down- and, in secondary infected plants, up-regulated, which could imply that in primary infected plants gene shut-off [30] occurs, while active defense responses could be active in secondary infected plants. Nevertheless, some of the genes that were regulated after infection in primary infected plants are associated with a defense response, as was observed in susceptible A. thaliana infected with five different positivestranded RNA viruses [28]. In order to, interpret the results of gene expression in leaves with necrotic spots, it must be borne in mind that expression of genes in the inoculated leaf varies with time and leaf region, depending on the site of PVYNTN infection [23]. Using whole leaves as starting material results in an average response over the leaf and is consequently not sensitive enough to detect the majority of rapid responses in local lesion development, which occur only in cells within the specific zone of the lesion. 4.2. Signal transduction and regulation in stress and defense Several possible candidates for signal transduction and regulation of stress and defense responses were isolated from our subtractive libraries (Supplemental Table). b–1,3-glucanase, heat shock protein 70, Cu/Zn superoxide dismutase and catalase, whose expression was found in this study, were also associated with plant–virus interactions in previous studies [22,24,26,27]. b-1,3-glucanases, a diverse group of proteins, are part of a group of defense-related proteins termed pathogenesis-related proteins [31]. Increased expression of b-1,3-glucanase (GLU I) in virus-infected cells can promote the spread of the virus by enhancing degradation of callose. Consequently, the plasmodesmatal size exclusion limit is increased and the size of local lesions can increase accordingly [32]. Increased b-1,3glucanase expression is especially important for viruses that exploit the movement protein for spreading through the plant [33]. In infected leaves of cv. Igor, the b-1,3-glucanase gene

was up-regulated in secondary PVYNTN infected, but not in primary infected potato plants 7 and 14 dpi. In contrast, in TMV infected A. thaliana ecotype Shahdara, at 14 dpi the same gene was up-regulated in systemically infected leaves, where the virus accumulated significantly [27]. In a study of A. thaliana infected with five different positive-stranded RNA viruses [28], b-1,3-glucanase gene was also up-regulated 2, 4 or 5 dpi. Three different genes for heat shock proteins (HSP) were isolated from our differentially expressed gene libraries. Two of them were similar to that for HSP 70 and one to the gene for HSP 80. The importance of HSP 70 in plant–virus interactions has been observed in other studies applying spatial analysis to expanding infected lesions. In CMV infected squash (Cucurbita pepo L.) leaves, the gene for HSP 70 was induced in apparently uninfected cells just ahead of the infection line [23] and, in Pea, seed-borne mosaic virus (PSbMV) infected pea (Pisum sativum L.) cotyledons, where the induction of heat shock protein gene (HSP) 70 coincided with the onset of viral replication [22]. Similarly to b-1,3-glucanase, induction of HSP 70 was detected in A. thaliana 2, 4 and 5 dpi with five diverse positive-stranded RNA viruses, suggesting that the observed expression changes were not transient [28]. Nevertheless, HSP gene expression was not induced in the response of Nicotiana benthamiana to negative-stranded RNA Sonchus yellow net virus (SYNV) [34]. It has been reported that hsp induction in response to virus infection is tightly controlled, both spatially and temporally, such that recently infected cells accumulate HSP 70 mRNA and protein, and that the induction is different from the heat-shock response [22,35]. On the other hand, Aparicio and coworkers [26] have demonstrated that HSP induction is caused by the increased amount of viral proteins in plant cytosol and that the induction is not virusspecific. The purpose of hsp 70 induction in response to virus infection could therefore be that HSP 70 can fulfill a requirement for rapid protein maturation and turnover during a short virus multiplication cycle. Moreover, there is evidence that HSP 70 plays a role in virus cell-to-cell and long distance movement [36,37]. In PVYNTN inoculated potato leaves 7 dpi, both genes for HSP 70 were down-regulated. One of them was also down-regulated in leaves of plants showing systemic symptoms and in leaves of secondary infected plants. The down regulation was probably part of a general suppression of host gene expression, which may be achieved through the degradation of host transcripts [22]. Down regulation of several hsp genes, including Hsp 70, was observed in the incompatible interaction of A. thaliana plants with CMV [38]. Interestingly, the gene for HSP 80 was up-regulated in inoculated leaves 7 dpi while it was down-regulated in leaves of secondary infected plants. HSP 80 belongs to the HSP 90 family, members of which have been shown to play an important role in resistance responses by binding to R proteins [39]. In our experiments, genes for superoxide dismutase, cytosolic ascorbate peroxidase and catalase—the major reactive oxygen species (ROS) scavenging enzymes [40]—were analyzed. No significant up- or down-regulation of the gene for Cu/Zn superoxide dismutase was observed.

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247

In contrast, cytosolic ascorbate peroxidase was significantly down-regulated 14 dpi. Two different genes for catalase were found in our study, catalase 1 and catalase 2. In squash, three different catalase genes were reported: catalase 1 encoding the catalase located in glyoxysomes, catalase 2 encoding a catalase with an expression pattern resembling that of peroxisome enzymes, and catalase 3 encoding catalase expressed constitutively in mature tissue. Different roles of these catalases were observed during senescence [41]. In Nicotiana plumbaginifolia, catalase 1 is primarily involved in removing the H2O2 produced during photorespiration in leaf peroxisomes, whereas catalase 3 scavenges the H2O2 formed in glyoxysomes during fatty acid degradation [24]. In CMV infected leaves of squash, all the genes studied within the lesions were down-regulated. However, in healthy areas of the same leaves, increased expression of the catalase gene was found [23]. In our study, up-regulation of catalase 2 was found on average over the whole leaf in leaves with necrotic spots. Up-regulation of catalase 2 gene was also observed in leaves of secondary infected plants. However, in systemically infected, noninoculated leaves 14 dpi, down-regulation of catalase 1 was observed. Down-regulation of cytosolic ascorbate peroxidase in the same type of leaves, together with down-regulation of catalase 1, could facilitate an accumulation of H2O2 in both peroxisomes and the cytosol compartments that can contribute to an oxidative stress and can be associated with the virusinduced symptoms. Taken together, these results suggest that different catalase genes show different, sometimes even contrary expression patterns and encode catalases with different roles. 4.3. Changes in general metabolism The expression profile observed in leaves with systemic symptoms 14 dpi indicates activation of the processes connected to leaf degradation and senescence at that time. Many of the genes involved in photosynthesis were downregulated. Down-regulation of genes involved in photosynthesis and metabolism of pigments and photorespiration could be correlated with the development of systemic symptoms on leaves. Alteration of some photosynthetic parameters could be associated with ROS generation in chloroplast. An increased ROS production and an antioxidative metabolism imbalance may be related to the progress of virus infection and symptoms in plants [42–45]. Ubiquitin and ubiquitin conjugated enzyme were also down-regulated. This could be caused by the virus in order to prevent degradation of viral proteins. No repression of the gene for ubiquitin was detected in A. thaliana 5 dpi with five different positive-stranded RNA viruses [28]. In the same microarray study, the induction of cytochrome P450 was observed 5 dpi. The gene for cytochrome P450 was also isolated from our subtractive libraries, but no significant up- or down-regulation was observed. Secondary infected plants appear to have adapted to virus infection to some extent, as the symptoms on the leaves are not as severe as on primary infected leaves. Their metabolism is

245

obviously changed, as seen by the regulation of several genes found in this study, such as those involved in photosynthesis, intracellular signal transduction and protein synthesis, and by previously reported changes in the metabolism of cytokinins and jasmonic acid [11,46,47]. At the time of appearance of necrotic spots (7 dpi) there was no significant regulation of genes involved in photosynthesis, although Milavec and coworkers [9] reported a lower content of photosynthetic pigments in inoculated leaves of cv. Igor, than in the control. 4.4. Importance of genes with unknown function No function could be assigned to 33% of the isolated genes. The genes belonging to this group have the most diverse expression pattern in primary and secondary infected plants. Many of them were up-regulated in leaves of secondary infected plants and several were down-regulated in leaves of primary infected plants at the stage of systemic symptom development. Some were responsive, even at the time of appearance of local symptoms, when the majority of other genes were non-regulated. The possible function of these genes was also checked in the Arabidopsis gene expression database (www.tair.org). Only orthologs of four genes (for example, proteins with unknown function [30/67] and [37/67]) were present on both potato and A. thaliana microarrays, so the possibility of acquiring additional data was limited. In our experiment, proteins with unknown function [30/67] and [37/67] were down-regulated. Their orthologs on A. thaliana microarrays were mostly upregulated under continuous illumination conditions, which suggests that they may be connected to a stress response, since several characteristic defense reactions (including accumulation of salicylate, expression of PR proteins and development of lesions) have been shown to be light dependent (reviewed in [48]). 5. Conclusions In the work presented here, potato cv. Igor was used to identify potato genes, the regulation of which leads to symptoms involved in compatible plant—virus interaction. We isolated and identified 175 genes. From the observed changes in expression profiles of several stress-related genes, such as those involved in photosynthesis and those for heat shock proteins, catalase 1, b-1,3-glucanase and wound inducing gene, were shown to be possible players in disease development and defense reaction to viral attack. Comparison of the results with those obtained in other studies investigating plant–virus interactions suggested that different sets of genes are activated in different stages of disease development and, especially, in different hosts. Only studies on a wide range of host–virus combinations can lead to identification of general features in plant–virus interactions. The results obtained so far still comprise only individual elements of processes in the interaction; so further functional studies are needed to determine complete response cascades. However, this study

246

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247

has provided important insights into the susceptible potato– PVYNTN interaction at the level of gene expression. Only a combination of understanding both the process involved in disease development and the process underlying plant defense against virus infection will enable the design of successful plant protection strategies. Acknowledgements We thank Dr Oscar Vorst (Plant Research International, The Netherlands) for great help with microarray data analyses. We thank Merkator-KZˇK Kranj, Slovenia for providing potato tubers and Prof Dr Borut Sˇtrukelj (Jozˇef Stefan Institute and Faculty of Pharmacy, University of Ljubljana, Slovenia) for providing proteinase inhibitor cDNAs. We also thank Lidija Maticˇicˇ (National Institute of Biology, Slovenia) for carrying out DAS-ELISA and Ralph Litjens (Plant Research International, The Netherlands) for excellent technical help. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.pmpp.2006.02. 005

References [1] Birch PRJ, Kamoun S. Studying interaction transcriptomes: coordinated analyses of gene expression during plant–microorganism interactions. New technologies for life sciences: a trends guide; December 2000: p. 77– 82. [2] Freytag S, Arabatzis N, Hahlbrock K, Schmelzer E. Reversible cytoplasmic rearrangements precede wall apposition, hypersensitive cell death and defense-related gene activation in potato/Phytophthora infestans interactions. Planta 1994;194:123–35. [3] Hinrichs-Berger J, Harfold M, Berger S, Buchenauer H. Cytological responses of susceptible and extremely resistant potato plants to inoculation with potato virus Y. Physiol Mol Plant Pathol 1999;55: 143–50. [4] Benhamou N. Elicitor-induced plant defence pathways. Trends Plant Sci 1996;1:233–9. [5] Maule A, Leh V, Lederer C. The dialogue between viruses and hosts in compatible interactions. Curr Opin Plant Biol 2002;5:279–84. [6] De Bokx JA, Huttinga H, Potato virus Y. Descriptions of plant viruses. No. 242. Surrey, Great Britain: Commonwealth Mycological Institute and Association of Applied Biologists; 1981. [7] Kus M. Investigations of the sensitivity of potato cultivars to tuber necrotic ringspot strain of potato virus Y (PVYNTN). EAPR, virology section, bled, 18–22 (1995) 135–8. [8] Pompe-Novak M, Wrischer M, Ravnikar M. Ultrastructure of chloroplasts in leaves of potato plants infected by potato virus YNTN. Phyton 2001;41: 215–26. [9] Milavec M, Ravnikar M, Kovacˇ M. Peroxidases and photosynthetic pigments in susceptible potato infected with potato virus YNTN. Plant Physiol Biochem 2001;39:891–8. [10] Gruden K, Sˇtrukelj B, Ravnikar M, Herzog-Velikonja B. A putative viral resistance-connected protein isolated from potato cultivar Sante resistant to PVYNTN infection. Phyton 2000;40:191–200. [11] Dermastia M, Ravnikar M, Kovacˇ M. Increased cytokinin-9-glucosylation in roots of susceptible Solanum tuberosum cultivar infected by potato virus YNTN. Mol Plant Microbe Interact 1995;8:327–30.

[12] Clark MF, Adams AN. Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J Gen Virol 1977;34:475–83. [13] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor: Cold Spring Harbor Laboraty Press; 1989. [14] Altschul SF, Gish W, Miller W, Meyers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403–10. [15] Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. Multiple sequence alignment with Clustal X. Trends Biochem Sci 1998;23:403–5. [16] Franssen-van Hal NLW, Vorst O, Kramer E, Hall RD, Keijer J. Factors influencing cDNA microarray hybridization on silylated glass slides. Anal Biochem 2002;308:5–17. [17] Causton HC, Quackenbush J, Brazma A. Microarray gene expression data analysis. Carlton, Australia: Blackwell Publishing; 2003. [18] Benesˇ V, Muckenthaler M. Standardization of protocols in cDNA microarray analysis. Trends Biochem Sci 2003;28:244–9. [19] Berrar DP, Dubitzkiy W, Granzov M. A practical approach to microarray data analysis. London: Kluwer; 2003. [20] Toplak N, Okrsˇlar V, Stanicˇ-Racman D, Gruden K, Zˇel J. A high throughput method for quantifying transgene expression in transformed plants using Real-Time PCR analysis. Plant Mol Biol Rep 2004;22: 237–50. [21] Czechowski T, Bari RP, Stitt M, Scheible W-R, Udvardi MK. Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes. Plant J 2004;38:366–79. [22] Aranda MA, Escaler M, Wang D, Maule AJ. Induction of HSP70 and polyubiquitin expression associated with plant virus replication. Proc Natl Acad Sci USA 1996;93:15289–93. [23] Havelda Z, Maule AJ. Complex spatial response to Cucumber mosaic virus infection in susceptible Cucurbita pepo cotyledons. Plant Cell 2000; 12:1975–85. [24] Talarczyk A, Krzymowska M, Borucky W, Henning J. Effect of yeast CTA1 gene expression on response of tobacco plants to tobacco mosaic virus infection. Plant Physiol 2002;129:1032–44. [25] Hihara Y, Kamei A, Kanehisa M, Kaplan A, Ikeuchi M. DNA microarray analysis of cyanobacterial gene expression during acclimation to high light. Plant Cell 2001;13:793–806. [26] Aparicio F, Thomas CL, Lederer C, Niu Y, Wang D, Maule AJ. Virus Induction of heat shock protein 70 reflects a general response to protein accumulation in the plant cytosol. Plant Physiol 2005;138:529–36. [27] Golem S, Culver JN. Tobacco mosaic virus induced alterations in the gene expression profile of Arabidopsis thaliana. Mol Plant Microbe Interact 2003;16:681–8. [28] Whitham SA, Quan S, Chang H-S, Cooper B, Estes B, Zhu T, et al. Diverse RNA viruses elicit the expression of common sets of genes in susceptible Arabidopsis thaliana. Plant J 2003;33:271–83. [29] Mehle N, Kovacˇ M, Petrovicˇ N, Pompe Novak M, Baebler Sˇ, Krecˇicˇ Stres H, et al. Spread of potato virus YNTN in potato cultivars (Solanum tuberosum L.) with different levels of sensitivity. Physiol Mol Plant Pathol 2004;64:293–300. [30] Aranda M, Maule A. Virus-induced host gene shutoff in animals and plants. Virology 1998;243:261–7. [31] Van Loon LC, Van Strien EA. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant Pathol 1999;55:85–97. [32] Bucher GL, Tarina C, Heinlein M, Di Serio F, Meins Jr F, Iglesias VA. Local expression of enzymatically active class I b-1,3-glucanase enhances symptoms of TMV infection in tobacco. Plant J 2001;28:361–9. [33] Iglesias VA, Meins Jr F. Movement of plant viruses is delayed in a b-1,3glucanase-deficient mutant showing a reduced plasmodesmatal size exclusion limit and enhanced callose deposition. Plant J 2000;21:157–66. [34] Senthil G, Liu H, Puram VG, Clark A, Stromberg A, Goodin MM. Specific and common changes in Nicotiana benthamiana gene expression in response to infection by enveloped viruses. J Gen Virol 2005;86: 2615–25.

M. Pompe-Novak et al. / Physiological and Molecular Plant Pathology 67 (2006) 237–247 [35] Escaler M, Aranda MA, Thomas CL, Maule AJ. Pea embryonic tissues show common responses to the replication of a wide range of viruses. Virology 2000;267(2):318–25. [36] Aoki K, Kragler F, Xoconostle-Ca´zares B, Lucas WJ. A subclass of plant heat shock cognate 70 chaperones carries a motif that facilitates trafficking through plasmodesmata. Proc Natl Acad Sci USA 2002;99:16342–7. [37] Prokhnevsky AI, Peremyslov VV, Napuli AJ, Dolja VV. Interaction between long-distance transport factor and Hsp70-related movement protein of Beet Yellows Virus. J Virol 2002;76:11003–11. [38] Marathe R, Guan Z, Anandalakshmi R, Zhao H, Dinesh-Kumar SP. Study of Arabidopsis thaliana resistome in response to cucumber mosaic virus infection using whole genome microarray. Plant Mol Biol 2004;55: 501–20. [39] Liu Y, Burch-Smith T, Schiff M, Feng S, Dinesh-Kumar SP. Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J Biol Chem 2004;279:2101–8. [40] Mitter R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 2002;7:405–10. [41] Esaka M, Yamada N, Kitabayashi M, Setoguchi Y, Tsugeki R, Kondo M, et al. cDNA cloning and differential gene expression of three catalases in pumpkin. Plant Mol Biol 1997;33:141–55.

247

[42] Foyer HC, Lelandais M, Kunert KJ. Photooxidation stress in plants. Physiol Plant 1994;92:696–717. [43] Rahoutei J, Garcı´a-Luque I, Baro´ M. Inhibition of photosynthesis by viral infection: effect on PSII structure and function. Physiol Plant 2000;286–92. [44] Riedle-Bauer M. Role of reactive oxygen species and antioxidant enzymes in systemic virus infection of plants. J Phytopathol 2000;297–302. [45] Herna´ndez JA, Rubio MR, Olmos E, Ros-Barcelo´ A, Martı´nez-Go´mez P. Oxidative stress induced by long-term plum pox virus infection in peach (Prunus persica). Physiol Plant 2004;122:486–95. [46] Dermastia M, Ravnikar M. Altered cytokinin pattern and enhanced tolerance to potato virus YNTN in the susceptible potato cultivar (Solanum tuberosum cv. Igor) grown in vitro. Physiol Mol Plant Pathol 1996;48: 65–71. [47] Petrovicˇ N, Miersch O, Ravnikar M, Kovacˇ M. Potato virus YNTN alters the distribution and concentration of endogenous jasmonic acid in potato plants grown in vitro. Physiol Mol Plant Pathol 1997;50:237–44. [48] Bechtold U, Karpinski S, Mullineaux PM. The influence of the light environment and photosynthesis on oxidative signalling responses in plant-biotrophic pathogen interactions. Plant Cell Environ 2005;28(8): 1046–55.