- Email: [email protected]
Potential forensic application of closely linked autosomal STR haplotype in complex kinship testing
Forensic Science International: Genetics Supplement Series 4 (2013) e137–e139
Contents lists available at ScienceDirect
Forensic Science International: Genetics Supplement Series journal homepage: www.elsevier.com/locate/FSIGSS
Potential forensic application of closely linked autosomal STR haplotype in complex kinship testing J.P. Du a, P.Y. Chen a, Y. Huang a, J. Zhang a,**, C.T. Li b, Y.B. Li a,* a b
Department of Forensic Genetics, West China School of Basic Science and Forensic Medicine, Sichuan University, Chengdu 610041, Sichuan, PR China Shanghai Key Laboratory of Forensic Medicine, Institute of Forensic Sciences, Ministry of Justice, Shanghai 200063, PR China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 August 2013 Accepted 2 October 2013
It has been noticed that the most commonly used commercial STR kits and mtDNA may not be able to solve some special kinship cases, such as alleged aunt, uncle, niece, nephew or half-siblings. Due to its unique hereditary pattern, the haplotype of genetic markers could be a solution of these questioned family relationships. In this study, we investigated the genetic features of an autosomal STR cluster by employing confirmed family samples. To evaluate the forensic practical value of autosomal STR haplotype, 5 closely linked STR loci, D1S2127-D1S2138-D1S3460-D1S1643-D1S518, which were arranged in about 2 cM region (from 186.29 cM to 188.02 cM; 1 cM represents 1% average recombination between two loci) on chromosome one, were selected to compose haplotype. Genotyping of 60 samples from 8 trios (father–mother–children), 8 duos (father or mother–children), and 4 threegeneration pedigrees were performed using PAGE. Haplotypes were identified in the child by determining alleles for all 5 loci transmitted from each parent. Total 73 haplotypes were detected in all samples and 34 haplotypes were observed to be passed down as a whole and was corresponding with the inherited characteristics of haplotype. In all family members, 34 unrelated individuals contributed 65 haplotypes, of which 62 haplotypes appeared only once and the rest 3 haplotypes appeared twice. No recombination was observed in 4 three-generation pedigrees. In conclusion, the haplotype consisting of 5 closely linked autosomal STRs could pass down steadily as a whole. The family specificity of most haplotypes may provide a unique advantage in forensic complex kinship testing. ß 2013 Elsevier Ireland Ltd. All rights reserved.
Keywords: Lineage STRs Kinship testing Family specific Recombination
1. Introduction
2. Materials and methods
Genetic marker of autosomal STRs is mainstream technology of forensic DNA testing currently and widely used in paternity testing because of their high polymorphic characteristics [1]. However most commonly used commercial STR kits may not able to solve some special kinship cases [2], such as alleged aunt, uncle, niece, nephew or half-siblings. Due to its unique hereditary pattern, the haplotype genetic markers could be a solution of these questioned family relationships [3]. In this study, by employing 5 closely linked STRs on chromosome 1, we research on the hereditary feature of genetic marker of autosomal STR haplotype in confirmed family samples, to explore the potential forensic application in complex kinship testing.
2.1. Construction of STR haplotype
* Corresponding author at: Department of Forensic Genetics, West China School of Basic Science and Forensic Medicine, Sichuan University, Renminnanlu 3-17, Chengdu 610041, Sichuan, PR China. Tel.: +86 28 85503043; fax: +86 28 85503043. ** Corresponding author at: Department of Forensic Genetics, West China School of Basic Science and Forensic Medicine, Sichuan University, Renminnanlu 3-17, Chengdu 610041, Sichuan, PR China. Tel.: +86 28 85573266; fax: +86 28 85503043. E-mail addresses: [email protected] (J. Zhang), [email protected] (Y.B. Li). 1875-1768/$ – see front matter ß 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsigss.2013.10.070
Five closely linked STR loci, D1S2127, D1S2138, D1S3460, D1S1642, and D1S518, which were arranged in about 2 cM region (from 186.29 cM to 188.02 cM; 1 cM represents 1% average recombination between two loci) on chromosome 1, were chosen to compose haplotype. The genetic locations of each locus see the Table 1. 2.2. Family samples A total of 60 individuals of confirmed family samples including 8 trios (father–mother–children), 8 duos (father or mother– children), and 4 three-generation pedigrees living in Sichuan, China were collected, after obtaining written informed consent. 2.3. DNA extraction DNA was extracted from venous blood or buccal swabs using the Chelex-100 as described [4].
e138
J.P. Du et al. / Forensic Science International: Genetics Supplement Series 4 (2013) e137–e139
Table 1 Characteristics of 5 autosomal STR loci on chromosome 1. Locus
Gentic distance (cM)
Genbank accession
Primers (50 ! 30 )
Number of repeats
Size (bp)
D1S2127
186.29
G07795
Forward: TAAGGGAGAAAAAAAAGCACC Reverse: GCTGGAGAGATAGTTAATAAACAGA
6–10
111–127
D1S2138
187.2
G07855
Forward: TCTGTTTTGGATAACAATGCC Reverse: TAGGGGAAGCCTGTTACTCC
5–9
218–234
D1S3460
187.23
G07772
Forward: CCTTGAAAGGGGGTTGAGTA Reverse: CATGCAAACTTGAAACCTCA
6–11
225–[1,0]
D1S1642
187.62
G07797
Forward: ACTTGCAGTGTAGCTGACACC Reverse: AGGTACTTCAGATACGGGCA
6–11
233–257
D1S518
188.02
G07854
Forward: TGCAGATCTTGGGACTTCTC Reverse: CAGTTGCCCACACTCTTTTT
6–12
185–219
2.4. PCR amplification Primer sequences of each loci were retrieved from Genbank (http://www.ncbi.nlm.nih.gov/genbank/). Twenty microliter PCR reaction volume was adopted. PCR amplification was performed using a GeneAmp PCR System 9700. 2.5. Genotyping The PCR products were separated using nondenaturing polyacrylamide gel electrophoresis and visualized by silver staining. Different alleles of each locus were mixed together to construct allelic ladder. Genotyping of all samples were determined through comparison with the allelic ladders. 2.6. Haplotype analysis According to the genotypes of 5 STR loci of family samples, Haplotype originated from father and mother separately of each individual was predicted following Mendel genetic law. 3. Results and discussion The mode of inheritance of autosomal genetic markers is in accordance with the Mendelian inheritance law. Of the two alleles on the same loci, one inherited from each parent. Recombination of alleles from different parental chromosomes will happen
randomly among different loci in genetic processing. However, alleles on two closely linked loci tend to be inherited together because they are located on the same chromosome. Alleles on same chromosome constitute a haplotype. In this study, five closely-linked STRs arranged in about 2 cM region on chromosome 1 were employed to compose an autosomal STR cluster. To observe the genetic characteristics of the autosomal STR haplotype, parentage analysis of genotype data of 5 STR loci were performed in all family samples. In 4 three-generation pedigrees, paternal and maternal haplotypes can be deduced based on the genotypes of all 5 STR loci. The results revealed that, all the parental haplotypes of the third generations (C) conjectured according to the analysis of genotypes could be found in the first generation family members (GF/GM) and the second generation individuals (F/M), and did not show any recombination over generations. This result indicates that the haplotype consisting of 5 autosomal STRs could pass down steadily as a whole, which is corresponding with the inherited characteristics of autosomal haplotype. In all 60 samples from 8 trios, 8 duos, and 4 three-generation pedigrees, a total of 73 different haplotypes were detected, among which, 34 haplotypes were transmitted over generations (6 types in three generations, 28 types in two generations) and no haplotype was transmitted in different families, see Table 2. In all family members, 34 unrelated individuals contributed 65 haplotypes, of which 62 haplotypes appeared only once and the rest 3 haplotypes appeared twice, see Table 2. The results showed
Table 2 Genotypes and haplotypes of family samples. Family type
Three-generation pedigrees
Samples
1GFf 1GMf 1F 1M 1C 2GFf 2GFm 2F 2M 2C 3GFm 3GMm 3GMf 3F 3M 3C 4GFf 4F 4M 4C
Genotypes
Haplotypes
D1S2127
D1S2138
D1S3460
D1S1642
D1S518
Haplotype 1
Haplotype 2
8-9 9-9 8-9 8-8 8-9 9-10 7-7 8-9 7-7 7-9 10-10 7-7 8-10 7-8 7-10 7-8 6-7 7-8 9-9 7-9
9-9 8-8 8-9 9-9 8-9 8-8 7-7 8-9 7-9 7-8 7-8 8-9 8-9 7-9 7-8 8-9 9-9 8-9 7-9 7-9
10-10 9-9 9-10 10-10 9-10 9-9 8-8 9-10 8-10 8-9 8-9 9-10 9-10 8-10 8-9 9-10 10-10 9-10 8-10 8-10
6-11 9-10 10-11 9-9 1-10 7-9 9-9 7-9 9-11 7-9 9-9 9-9 9-11 9-11 9-9 9-11 9-9 9-9 9-10 9-10
7-9 8-10 8-9 8-10 8-10 9-12 8-8 10-12 8-9 8-12 10-12 7-9 9-10 9-9 9-10 9-9 8-8 8-10 6-9 6-8
9-9-10-6-7 9-8-9-10-8a 9-8-9-10-8a 8-9-10-9-8 9-8-9-10-8a 9-8-9-7-12a 7-7-8-9-8 9-8-9-7-12a 7-9-10-11-9 9-8-9-7-12a 10-7-8-9-10 7-9-10-9-7 8-9-10-11-9a 8-9-10-11-9a 10-7-8-9-10 8-9-10-11-9a 7-9-10-9-8a 7-9-10-9-8a 9-9-10-9-9 7-9-10-9-8a
8-9-10-11-9 9-8-9-9-10 8-9-10-11-9 8-9-10-9-10b 8-9-10-9-10b 10-8-9-9-9 7-7-8-9-8b 8-9-10-9-10 7-7-8-9-8b 7-7-8-9-8b 10-8-9-9-12 7-8-9-9-9b 10-8-9-9-10 7-7-8-9-9 7-8-9-9-9b 7-8-9-9-9b 6-9-10-9-8 8-8-9-9-10 9-7-8-10-6b 9-7-8-10-6b
J.P. Du et al. / Forensic Science International: Genetics Supplement Series 4 (2013) e137–e139
e139
Table 2 (Continued ) Family type
Samples
Genotypes
Haplotypes
D1S2127
D1S2138
D1S3460
D1S1642
D1S518
Haplotype 1
Haplotype 2
Trios
848F 848M 848C 857F 857M 857C 858F 858M 858C 872F 872M 872C 874F 874M 874C 875F 875M 875C 881F 881M 881C 884F 884M 884C
7-8 7-7 7-8 8-9 7-9 8-9 9-9 9-9 9-9 8-9 8-9 9-9 7-10 6-9 6-7 8-8 8-9 8-8 8-9 6-10 9-10 7-8 9-10 8-9
7-9 8-9 7-9 9-9 8-9 9-9 6-7 7-8 7-8 7-8 8-9 8-9 8-8 7-8 7-8 8-8 8-9 8-8 7-9 8-9 8-9 7-8 7-9 7-8
7-9 7-10 9-10 7-10 7-7 7-7 7-10 10-10 7-10 6-10 10-10 10-10 8-10 7-8 8-8 8-10 6-10 6-8 6-8 8-10 6-8 7-10 8-8 8-10
9-10 9-9 9-10 8-9 9-10 8-9 8-9 9-9 9-9 9-11 8-10 9-10 8-9 9-10 9-10 9-9 9-10 9-10 9-9 9-9 9-9 9-10 9-9 9-10
6-9 9-11 9-11 10-10 10-10 10-10 10-11 10-10 10-10 8-12 7-9 9-12 9-12 9-10 9-12 7-9 8-10 7-10 9-10 9-9 9-10 11-11 7-9 7-11
8-7-9-10-9a 7-8-7-9-9 8-7-9-10-9a 8-9-7-8-10a 7-8-7-10-10 8-9-7-8-10a 9-7-7-9-10a 9-7-10-9-10 9-7-7-9-10a 9-8-10-9-12a 8-8-10-8-7 9-8-10-9-12a 7-8-8-9-12a 9-8-7-9-10 7-8-8-9-12a 8-8-8-9-7a 9-9-10-9-8 8-8-8-9-7a 9-9-6-9-10a 6-9-10-9-9 9-9-6-9-10a 8-8-10-10-11a 10-9-8-9-9 8-8-10-10-11a
7-9-7-9-6 7-9-10-9-11b 7-9-10-9-11b 9-9-10-9-10 9-9-7-9-10b 9-9-7-9-10b 9-6-10-8-11 9-8-10-9-10b 9-8-10-9-10b 8-7-6-11-8 9-9-10-10-9b 9-9-10-10-9b 10-8-10-8-9 6-7-8-10-9b 6-7-8-10-9b 8-8-10-9-9 8-8-6-10-10b 8-8-6-10-10b 8-7-8-9-9 10-8-8-9-9b 10-8-8-9-9b 7-7-7-9-11 9-7-8-9-7b 9-7-8-9-7b
Duos
859M 859C 860M 860C 862M 862C 864F 864C 868M 868C 877M 877C 878M 878C 882M 882C
6-10 10-10 8-10 10-10 7-9 8-9 7-8 7-9 7-8 7-9 8-8 7-8 9-10 8-10 7-8 8-9
7-8 5-7 7-8 7-9 9-9 6-9 6-8 6-6 9-9 8-9 7-8 8-9 6-8 8-8 8-10 7-8
10-10 8-10 10-10 8-10 8-8 7-8 8-10 7-8 8-8 8-10 6-7 7-7 9-10 6-10 8-10 10-10
9-9 9-9 9-9 8-9 8-9 9-9 9-9 9-9 9-9 9-9 10-10 9-10 9-9 9-9 9-9 9-9
9-10 8-9 8-10 10-12 7-10 9-10 10-12 9-10 9-10 7-9 9-10 6-10 10-10 9-10 12-12 10-12
6-8-10-9-10 10-5-8-9-8 8-8-10-9-8 10-9-8-8-12 7-9-7-8-7 8-6-7-9-9 7-6-8-9-10a 7-6-8-9-10a 8-9-8-9-10 9-8-10-9-7 8-7-6-10-9 7-9-7-9-6 9-6-9-9-10 8-8-6-9-9 7-10-8-9-12 9-7-10-9-10
10-7-10-9-9b 10-7-10-9-9b 10-7-10-9-10b 10-7-10-9-10b 9-9-8-9-10b 9-9-8-9-10b 8-8-10-9-12 9-6-7-9-9 7-9-8-9-9b 7-9-8-9-9b 8-8-7-10-10b 8-8-7-10-10b 10-8-10-9-10b 10-8-10-9-10b 8-8-10-9-12b 8-8-10-9-12b
* GFf, GMf refer to the grandfather (father’s father) and grandma (father’s mother), GFm, GMm refer to the grandfather (mather’s father) and grandma (mather’s mother). a The child’s paternal haplotype transmitted over generations. b The child’s maternal haplotype transmitted over generations.
that the haplotype consisting of 5 STR loci possessed higher polymorphism and discriminating power, which exhibited family specificity when passed down over generations.
Acknowledgements We thank Dr. Yufang Wang for providing language help and writing assistance.
4. Conclusion The haplotype consisting of 5 closely linked autosomal STRs on chromosome 1 could pass down steadily as a whole. The family specificity of most haplotypes may provide a unique advantage in forensic complex kinship testing. Conflict of interest None. Role of funding This work was supported by the Twelfth Five-Year Plan of the National Science and Technology Support Program of China (2012BAK16B01).
References [1] P. Gill, D.J. Werrett, B. Budowle, et al., An assessment of whether SNPs will replace STRs in national DNA databases-joint considerations of the DNA working group of the European Network of Forensic Science Institutes (ENFSI) and the Scientific Working Group on DNA Analysis Methods (SEGDAM), Sci. Justice 44 (2004) 51–53. [2] R. Gaytmenn, D.P. Hildebrand, D. Sweet, et al., Determination of the sensitivity and specificity of sibship calculations using AmpFlSTR Profiler Plus, Int. J. Legal Med. 116 (2002) 161–164. [3] J.S. Buckleton, M. Krawczak, B.S. Weir, The interpretation of lineage markers in forensic DNA testing, Forensic Sci. Int. Genet. 5 (2011) 78–83. [4] P.S. Walsh, D.A. Metzger, R. Higuchi, Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material, Biotechniques 10 (1991) 506– 513.
Contents lists available at ScienceDirect
Forensic Science International: Genetics Supplement Series journal homepage: www.elsevier.com/locate/FSIGSS
Potential forensic application of closely linked autosomal STR haplotype in complex kinship testing J.P. Du a, P.Y. Chen a, Y. Huang a, J. Zhang a,**, C.T. Li b, Y.B. Li a,* a b
Department of Forensic Genetics, West China School of Basic Science and Forensic Medicine, Sichuan University, Chengdu 610041, Sichuan, PR China Shanghai Key Laboratory of Forensic Medicine, Institute of Forensic Sciences, Ministry of Justice, Shanghai 200063, PR China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 August 2013 Accepted 2 October 2013
It has been noticed that the most commonly used commercial STR kits and mtDNA may not be able to solve some special kinship cases, such as alleged aunt, uncle, niece, nephew or half-siblings. Due to its unique hereditary pattern, the haplotype of genetic markers could be a solution of these questioned family relationships. In this study, we investigated the genetic features of an autosomal STR cluster by employing confirmed family samples. To evaluate the forensic practical value of autosomal STR haplotype, 5 closely linked STR loci, D1S2127-D1S2138-D1S3460-D1S1643-D1S518, which were arranged in about 2 cM region (from 186.29 cM to 188.02 cM; 1 cM represents 1% average recombination between two loci) on chromosome one, were selected to compose haplotype. Genotyping of 60 samples from 8 trios (father–mother–children), 8 duos (father or mother–children), and 4 threegeneration pedigrees were performed using PAGE. Haplotypes were identified in the child by determining alleles for all 5 loci transmitted from each parent. Total 73 haplotypes were detected in all samples and 34 haplotypes were observed to be passed down as a whole and was corresponding with the inherited characteristics of haplotype. In all family members, 34 unrelated individuals contributed 65 haplotypes, of which 62 haplotypes appeared only once and the rest 3 haplotypes appeared twice. No recombination was observed in 4 three-generation pedigrees. In conclusion, the haplotype consisting of 5 closely linked autosomal STRs could pass down steadily as a whole. The family specificity of most haplotypes may provide a unique advantage in forensic complex kinship testing. ß 2013 Elsevier Ireland Ltd. All rights reserved.
Keywords: Lineage STRs Kinship testing Family specific Recombination
1. Introduction
2. Materials and methods
Genetic marker of autosomal STRs is mainstream technology of forensic DNA testing currently and widely used in paternity testing because of their high polymorphic characteristics [1]. However most commonly used commercial STR kits may not able to solve some special kinship cases [2], such as alleged aunt, uncle, niece, nephew or half-siblings. Due to its unique hereditary pattern, the haplotype genetic markers could be a solution of these questioned family relationships [3]. In this study, by employing 5 closely linked STRs on chromosome 1, we research on the hereditary feature of genetic marker of autosomal STR haplotype in confirmed family samples, to explore the potential forensic application in complex kinship testing.
2.1. Construction of STR haplotype
* Corresponding author at: Department of Forensic Genetics, West China School of Basic Science and Forensic Medicine, Sichuan University, Renminnanlu 3-17, Chengdu 610041, Sichuan, PR China. Tel.: +86 28 85503043; fax: +86 28 85503043. ** Corresponding author at: Department of Forensic Genetics, West China School of Basic Science and Forensic Medicine, Sichuan University, Renminnanlu 3-17, Chengdu 610041, Sichuan, PR China. Tel.: +86 28 85573266; fax: +86 28 85503043. E-mail addresses: [email protected] (J. Zhang), [email protected] (Y.B. Li). 1875-1768/$ – see front matter ß 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsigss.2013.10.070
Five closely linked STR loci, D1S2127, D1S2138, D1S3460, D1S1642, and D1S518, which were arranged in about 2 cM region (from 186.29 cM to 188.02 cM; 1 cM represents 1% average recombination between two loci) on chromosome 1, were chosen to compose haplotype. The genetic locations of each locus see the Table 1. 2.2. Family samples A total of 60 individuals of confirmed family samples including 8 trios (father–mother–children), 8 duos (father or mother– children), and 4 three-generation pedigrees living in Sichuan, China were collected, after obtaining written informed consent. 2.3. DNA extraction DNA was extracted from venous blood or buccal swabs using the Chelex-100 as described [4].
e138
J.P. Du et al. / Forensic Science International: Genetics Supplement Series 4 (2013) e137–e139
Table 1 Characteristics of 5 autosomal STR loci on chromosome 1. Locus
Gentic distance (cM)
Genbank accession
Primers (50 ! 30 )
Number of repeats
Size (bp)
D1S2127
186.29
G07795
Forward: TAAGGGAGAAAAAAAAGCACC Reverse: GCTGGAGAGATAGTTAATAAACAGA
6–10
111–127
D1S2138
187.2
G07855
Forward: TCTGTTTTGGATAACAATGCC Reverse: TAGGGGAAGCCTGTTACTCC
5–9
218–234
D1S3460
187.23
G07772
Forward: CCTTGAAAGGGGGTTGAGTA Reverse: CATGCAAACTTGAAACCTCA
6–11
225–[1,0]
D1S1642
187.62
G07797
Forward: ACTTGCAGTGTAGCTGACACC Reverse: AGGTACTTCAGATACGGGCA
6–11
233–257
D1S518
188.02
G07854
Forward: TGCAGATCTTGGGACTTCTC Reverse: CAGTTGCCCACACTCTTTTT
6–12
185–219
2.4. PCR amplification Primer sequences of each loci were retrieved from Genbank (http://www.ncbi.nlm.nih.gov/genbank/). Twenty microliter PCR reaction volume was adopted. PCR amplification was performed using a GeneAmp PCR System 9700. 2.5. Genotyping The PCR products were separated using nondenaturing polyacrylamide gel electrophoresis and visualized by silver staining. Different alleles of each locus were mixed together to construct allelic ladder. Genotyping of all samples were determined through comparison with the allelic ladders. 2.6. Haplotype analysis According to the genotypes of 5 STR loci of family samples, Haplotype originated from father and mother separately of each individual was predicted following Mendel genetic law. 3. Results and discussion The mode of inheritance of autosomal genetic markers is in accordance with the Mendelian inheritance law. Of the two alleles on the same loci, one inherited from each parent. Recombination of alleles from different parental chromosomes will happen
randomly among different loci in genetic processing. However, alleles on two closely linked loci tend to be inherited together because they are located on the same chromosome. Alleles on same chromosome constitute a haplotype. In this study, five closely-linked STRs arranged in about 2 cM region on chromosome 1 were employed to compose an autosomal STR cluster. To observe the genetic characteristics of the autosomal STR haplotype, parentage analysis of genotype data of 5 STR loci were performed in all family samples. In 4 three-generation pedigrees, paternal and maternal haplotypes can be deduced based on the genotypes of all 5 STR loci. The results revealed that, all the parental haplotypes of the third generations (C) conjectured according to the analysis of genotypes could be found in the first generation family members (GF/GM) and the second generation individuals (F/M), and did not show any recombination over generations. This result indicates that the haplotype consisting of 5 autosomal STRs could pass down steadily as a whole, which is corresponding with the inherited characteristics of autosomal haplotype. In all 60 samples from 8 trios, 8 duos, and 4 three-generation pedigrees, a total of 73 different haplotypes were detected, among which, 34 haplotypes were transmitted over generations (6 types in three generations, 28 types in two generations) and no haplotype was transmitted in different families, see Table 2. In all family members, 34 unrelated individuals contributed 65 haplotypes, of which 62 haplotypes appeared only once and the rest 3 haplotypes appeared twice, see Table 2. The results showed
Table 2 Genotypes and haplotypes of family samples. Family type
Three-generation pedigrees
Samples
1GFf 1GMf 1F 1M 1C 2GFf 2GFm 2F 2M 2C 3GFm 3GMm 3GMf 3F 3M 3C 4GFf 4F 4M 4C
Genotypes
Haplotypes
D1S2127
D1S2138
D1S3460
D1S1642
D1S518
Haplotype 1
Haplotype 2
8-9 9-9 8-9 8-8 8-9 9-10 7-7 8-9 7-7 7-9 10-10 7-7 8-10 7-8 7-10 7-8 6-7 7-8 9-9 7-9
9-9 8-8 8-9 9-9 8-9 8-8 7-7 8-9 7-9 7-8 7-8 8-9 8-9 7-9 7-8 8-9 9-9 8-9 7-9 7-9
10-10 9-9 9-10 10-10 9-10 9-9 8-8 9-10 8-10 8-9 8-9 9-10 9-10 8-10 8-9 9-10 10-10 9-10 8-10 8-10
6-11 9-10 10-11 9-9 1-10 7-9 9-9 7-9 9-11 7-9 9-9 9-9 9-11 9-11 9-9 9-11 9-9 9-9 9-10 9-10
7-9 8-10 8-9 8-10 8-10 9-12 8-8 10-12 8-9 8-12 10-12 7-9 9-10 9-9 9-10 9-9 8-8 8-10 6-9 6-8
9-9-10-6-7 9-8-9-10-8a 9-8-9-10-8a 8-9-10-9-8 9-8-9-10-8a 9-8-9-7-12a 7-7-8-9-8 9-8-9-7-12a 7-9-10-11-9 9-8-9-7-12a 10-7-8-9-10 7-9-10-9-7 8-9-10-11-9a 8-9-10-11-9a 10-7-8-9-10 8-9-10-11-9a 7-9-10-9-8a 7-9-10-9-8a 9-9-10-9-9 7-9-10-9-8a
8-9-10-11-9 9-8-9-9-10 8-9-10-11-9 8-9-10-9-10b 8-9-10-9-10b 10-8-9-9-9 7-7-8-9-8b 8-9-10-9-10 7-7-8-9-8b 7-7-8-9-8b 10-8-9-9-12 7-8-9-9-9b 10-8-9-9-10 7-7-8-9-9 7-8-9-9-9b 7-8-9-9-9b 6-9-10-9-8 8-8-9-9-10 9-7-8-10-6b 9-7-8-10-6b
J.P. Du et al. / Forensic Science International: Genetics Supplement Series 4 (2013) e137–e139
e139
Table 2 (Continued ) Family type
Samples
Genotypes
Haplotypes
D1S2127
D1S2138
D1S3460
D1S1642
D1S518
Haplotype 1
Haplotype 2
Trios
848F 848M 848C 857F 857M 857C 858F 858M 858C 872F 872M 872C 874F 874M 874C 875F 875M 875C 881F 881M 881C 884F 884M 884C
7-8 7-7 7-8 8-9 7-9 8-9 9-9 9-9 9-9 8-9 8-9 9-9 7-10 6-9 6-7 8-8 8-9 8-8 8-9 6-10 9-10 7-8 9-10 8-9
7-9 8-9 7-9 9-9 8-9 9-9 6-7 7-8 7-8 7-8 8-9 8-9 8-8 7-8 7-8 8-8 8-9 8-8 7-9 8-9 8-9 7-8 7-9 7-8
7-9 7-10 9-10 7-10 7-7 7-7 7-10 10-10 7-10 6-10 10-10 10-10 8-10 7-8 8-8 8-10 6-10 6-8 6-8 8-10 6-8 7-10 8-8 8-10
9-10 9-9 9-10 8-9 9-10 8-9 8-9 9-9 9-9 9-11 8-10 9-10 8-9 9-10 9-10 9-9 9-10 9-10 9-9 9-9 9-9 9-10 9-9 9-10
6-9 9-11 9-11 10-10 10-10 10-10 10-11 10-10 10-10 8-12 7-9 9-12 9-12 9-10 9-12 7-9 8-10 7-10 9-10 9-9 9-10 11-11 7-9 7-11
8-7-9-10-9a 7-8-7-9-9 8-7-9-10-9a 8-9-7-8-10a 7-8-7-10-10 8-9-7-8-10a 9-7-7-9-10a 9-7-10-9-10 9-7-7-9-10a 9-8-10-9-12a 8-8-10-8-7 9-8-10-9-12a 7-8-8-9-12a 9-8-7-9-10 7-8-8-9-12a 8-8-8-9-7a 9-9-10-9-8 8-8-8-9-7a 9-9-6-9-10a 6-9-10-9-9 9-9-6-9-10a 8-8-10-10-11a 10-9-8-9-9 8-8-10-10-11a
7-9-7-9-6 7-9-10-9-11b 7-9-10-9-11b 9-9-10-9-10 9-9-7-9-10b 9-9-7-9-10b 9-6-10-8-11 9-8-10-9-10b 9-8-10-9-10b 8-7-6-11-8 9-9-10-10-9b 9-9-10-10-9b 10-8-10-8-9 6-7-8-10-9b 6-7-8-10-9b 8-8-10-9-9 8-8-6-10-10b 8-8-6-10-10b 8-7-8-9-9 10-8-8-9-9b 10-8-8-9-9b 7-7-7-9-11 9-7-8-9-7b 9-7-8-9-7b
Duos
859M 859C 860M 860C 862M 862C 864F 864C 868M 868C 877M 877C 878M 878C 882M 882C
6-10 10-10 8-10 10-10 7-9 8-9 7-8 7-9 7-8 7-9 8-8 7-8 9-10 8-10 7-8 8-9
7-8 5-7 7-8 7-9 9-9 6-9 6-8 6-6 9-9 8-9 7-8 8-9 6-8 8-8 8-10 7-8
10-10 8-10 10-10 8-10 8-8 7-8 8-10 7-8 8-8 8-10 6-7 7-7 9-10 6-10 8-10 10-10
9-9 9-9 9-9 8-9 8-9 9-9 9-9 9-9 9-9 9-9 10-10 9-10 9-9 9-9 9-9 9-9
9-10 8-9 8-10 10-12 7-10 9-10 10-12 9-10 9-10 7-9 9-10 6-10 10-10 9-10 12-12 10-12
6-8-10-9-10 10-5-8-9-8 8-8-10-9-8 10-9-8-8-12 7-9-7-8-7 8-6-7-9-9 7-6-8-9-10a 7-6-8-9-10a 8-9-8-9-10 9-8-10-9-7 8-7-6-10-9 7-9-7-9-6 9-6-9-9-10 8-8-6-9-9 7-10-8-9-12 9-7-10-9-10
10-7-10-9-9b 10-7-10-9-9b 10-7-10-9-10b 10-7-10-9-10b 9-9-8-9-10b 9-9-8-9-10b 8-8-10-9-12 9-6-7-9-9 7-9-8-9-9b 7-9-8-9-9b 8-8-7-10-10b 8-8-7-10-10b 10-8-10-9-10b 10-8-10-9-10b 8-8-10-9-12b 8-8-10-9-12b
* GFf, GMf refer to the grandfather (father’s father) and grandma (father’s mother), GFm, GMm refer to the grandfather (mather’s father) and grandma (mather’s mother). a The child’s paternal haplotype transmitted over generations. b The child’s maternal haplotype transmitted over generations.
that the haplotype consisting of 5 STR loci possessed higher polymorphism and discriminating power, which exhibited family specificity when passed down over generations.
Acknowledgements We thank Dr. Yufang Wang for providing language help and writing assistance.
4. Conclusion The haplotype consisting of 5 closely linked autosomal STRs on chromosome 1 could pass down steadily as a whole. The family specificity of most haplotypes may provide a unique advantage in forensic complex kinship testing. Conflict of interest None. Role of funding This work was supported by the Twelfth Five-Year Plan of the National Science and Technology Support Program of China (2012BAK16B01).
References [1] P. Gill, D.J. Werrett, B. Budowle, et al., An assessment of whether SNPs will replace STRs in national DNA databases-joint considerations of the DNA working group of the European Network of Forensic Science Institutes (ENFSI) and the Scientific Working Group on DNA Analysis Methods (SEGDAM), Sci. Justice 44 (2004) 51–53. [2] R. Gaytmenn, D.P. Hildebrand, D. Sweet, et al., Determination of the sensitivity and specificity of sibship calculations using AmpFlSTR Profiler Plus, Int. J. Legal Med. 116 (2002) 161–164. [3] J.S. Buckleton, M. Krawczak, B.S. Weir, The interpretation of lineage markers in forensic DNA testing, Forensic Sci. Int. Genet. 5 (2011) 78–83. [4] P.S. Walsh, D.A. Metzger, R. Higuchi, Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material, Biotechniques 10 (1991) 506– 513.