Potential of naturally attenuated Streptococcus agalactiae as a live vaccine in Nile tilapia (Oreochromis niloticus)

Journal Pre-proof Potential of naturally attenuated Streptococcus agalactiae as a live vaccine in Nile tilapia (Oreochromis niloticus)

Xu-Bing Mo, Jing Wang, Song Guo, An-Xing Li PII:

S0044-8486(19)31563-7

DOI:

https://doi.org/10.1016/j.aquaculture.2019.734774

Reference:

AQUA 734774

To appear in:

aquaculture

Received date:

21 June 2019

Revised date:

13 November 2019

Accepted date:

23 November 2019

Please cite this article as: X.-B. Mo, J. Wang, S. Guo, et al., Potential of naturally attenuated Streptococcus agalactiae as a live vaccine in Nile tilapia (Oreochromis niloticus), aquaculture (2019), https://doi.org/10.1016/j.aquaculture.2019.734774

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof Potential of naturally attenuated Streptococcus agalactiae as a live vaccine in Nile tilapia (Oreochromis niloticus) Xu-Bing Moa, Jing Wanga, Song Guoa, An-Xing Lia,b,* [email protected] a

State Key Laboratory of Biocontrol/Guangdong Provincial Key Laboratory of Improved Variety

Reproduction in Aquatic Economic Animals and Institute of Aquatic Economic Animals, School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, Guangdong Province, PR China; Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National

of

b

Corresponding author at: State Key Laboratory of Biocontrol/Guangdong Provincial Key Laboratory

-p

*

ro

Laboratory for Marine Science and Technology, Qingdao 266235, Shandong Province, PR China;

re

of Improved Variety Reproduction in Aquatic Economic Animals and Institute of Aquatic Economic

lP

Animals, School of Life Sciences, Sun Yat-Sen University, 135 Xingang West Street, Haizhu District,

Abstract

na

Guangzhou 510275, Guangdong Province, PR China.

Jo ur

Streptococcosis, caused by Streptococcus agalactiae, among other Streptococcus species, seriously harms the global tilapia aquaculture industry. Immunization is a preferred method to control this disease. A naturally attenuated S. agalactiae strain TFJ0901 was previously isolated from Nile tilapia (Oreochromis niloticus). In this study, the vaccine potential of TFJ0901 in Nile tilapia via intraperitoneal (IP) injection immunization was analyzed by the safety, immune efficacy and immunological response assessments. The virulence test through IP challenge showed that TFJ0901 had extremely low virulence with an LD50 of 8.8 × 108 CFU/fish. The results of serial passage tests in vivo demonstrated that TFJ0901 had stable virulence with no potential of reversion. At 28 days post-vaccination, the relative percent survival (RPS) of fish vaccinated with TFJ0901 at 1.0 × 106 and 1.0 × 107 CFU/fish were 71.8% and 97.4%, 1

Journal Pre-proof respectively, which were significantly higher than those fish vaccinated with 1.0 × 102‒1.0 × 105 CFU/fish. Additionally, the duration of immune protection was determined for 1.0 × 106 and 1.0 × 107 CFU/fish with single or booster vaccinations. At 28, 56 and 84 days post-initial vaccination (DPIV), fish were IP challenged to determine the duration of protection. The booster vaccination at 1.0 × 10 7 CFU/fish showed an RPS of 100% at each time point. The RPS for the single vaccination at 1.0 × 107 CFU/fish were 92.8%, 83.0% and 72.5% at 28, 56 and 84 DPIV, respectively, which were similar with those for the booster vaccination at 1.0 × 106 CFU/fish. The

of

RPS for the single vaccination at 1.0 × 106 CFU/fish were the lowest at 65.7%, 60.3%

ro

and 31.9% for 28, 56 and 84 DPIV, respectively. Vaccinated fish developed specific serum antibodies; however, the antibody levels of the single vaccination were higher

-p

than those of the booster vaccination at 1.0 × 107 CFU/fish. The expression levels of

re

IgM corresponded to the antibody levels, while the expression levels of humoral

lP

immune-related genes (MHC Ⅱβ and CD4) also increased in the vaccinated fish. This study indicates that TFJ0901 can be developed as a safe live vaccine to protect Nile

na

tilapia from S. agalactiae infection for at least 84 days.

Jo ur

Keywords: Streptococcus agalactiae; Nile tilapia; Attenuated vaccine

1. Introduction

Streptococcus agalactiae can infect many fish species, including Nile tilapia, Oreochromis niloticus (see Ye et al., 2011; Li et al., 2014b; Assis et al., 2017; Laith et al., 2019), barcoo grunter, Scortum barcoo (see Liu et al., 2014), silver pomfret, Pampus argenteus (see Duremdez et al., 2004), giant Queensland grouper, Epinephelus lanceolatus (see Bowater et al., 2012) and golden pomfret, Trachinotus blochii (see Chong et al., 2016). The production of tilapia is huge and S. agalactiae is its the main pathogen (Chen et al., 2012; Li et al., 2013; Li et al., 2014a). In China, this infection occurs continuously with a mortality of 30%‒80% in major tilapia cultivation areas, which causes huge economic losses (Chen et al., 2012). An effective 2

Journal Pre-proof method to control S. agalactiae infection is therefore urgently needed in the tilapia aquaculture industry. Although antibiotics can presently control S. agalactiae infection, it has risks that lead to development of antibiotic resistance and they can cause harm to the environment and human health (Baquero et al., 2008). Immunization is an environment-friendly, safe and efficient method to prevent diseases and has been widely used against several fish diseases. For example, the successful application of numerous commercial vaccines in the Norwegian salmon and trout aquaculture

of

industry has greatly contributed to the increased total production of farmed fish and

ro

the decreased use of antibiotics (Sommerset et al., 2005). This practice has also promoted the rapid and healthy development of aquaculture in Norway, and has

-p

contributed to environmental protection. Several S. agalactiae vaccines for Nile

re

tilapia had been studied at the laboratory stage, including formalin-killed whole-cell

lP

vaccines with concentrated extracellular products (ECP) (Evans et al., 2004; Pasnik et al., 2005); subunit vaccines (He et al., 2014; Yi et al., 2014); DNA vaccines (Huang et

na

al., 2014; Zhu et al., 2017); and a live attenuated vaccine (Li et al., 2015). Of the S. agalactiae vaccines described above, the live vaccine induced better immune

Jo ur

protection than the other types of vaccines under the same immunization methods and times (Liu et al., 2016). This live vaccine candidate was, however, artificially attenuated by successive passage of a virulent S. agalactiae strain in vitro (Li et al., 2015), this live vaccine strain may be at risk for reverting to virulence. So far, there have been no reports using a naturally attenuated S. agalactiae strain to develop live vaccines for tilapia. Moreover, the duration of immune protection is an important factor for evaluating the efficacy of a vaccine; however, this has not been tested in most S. agalactiae vaccines for Nile tilapia, except for an inactivated vaccine with relative percent survival (RPS) of 61%‒47% at 47‒180 days post vaccination (Pasnik et al., 2005；Liu et al., 2016) and a live attenuated vaccine with RPS of 82.05% in booster dose at 8 weeks post vaccination (Laith et al., 2019). Streptococcus agalactiae strain TFJ0901 was previously isolated from Nile tilapia 3

Journal Pre-proof in Fujian Province, China. Through virulence analysis, this strain was found to be a naturally attenuated S. agalactiae strain (Li et al., 2014a). In this study, the potential of TFJ0901 as a live vaccine against S. agalactiae was evaluated in Nile tilapia, mainly through safety assessment and analysis of immune protection duration. 2. Materials and methods 2.1. Bacterial strains and preparation of bacterial suspension

of

Naturally attenuated S. agalactiae TFJ0901 was used as a live vaccine strain for the

ro

vaccination of fish. Virulent S. agalactiae THN0901, isolated from Nile tilapia in Hainan Province of China (Li et al., 2014a), was used to challenge the fish following

-p

vaccination. Two strains were cultured in brain-heart infusion (BHI) broth at 28°C as

re

described previously (Li et al., 2016). The bacterial cells were then collected by

lP

centrifugation at 5,000 × g for 15 min at 4‒8°C. The cells were washed 3 times with sterile phosphate buffered saline (PBS; 0.01 M, pH 7.4) and then re-suspended in PBS.

na

The bacterial suspension, adjusted to different concentrations with PBS, was used to immunize and challenge the fish in the following trials. The bacterial concentration

Jo ur

was determined by plating 100 μL of 10-fold serial dilutions onto BHI plates. The plates were incubated at 37°C for 24 h and then the colonies were counted. 2.2. Fish

Nile tilapia (Oreochromis niloticus) (16.2 ± 2.0 g) were purchased from the Freshwater Famous Fish Breed Center in Guangdong Province (Guangzhou, China). During experimentation, the fish were kept in a water flow-through system with aeration at 30 ± 0.5°C. The fish were fed twice daily with commercial puffed pellet feed (Guangdong Evergreen Feed Industry Co. Ltd., China). Before the experiment, ten fish were randomly selected for bacteriological examination of the brain, liver, spleen, kidney and blood. The fish were only used for experiments when no bacteria were detected in the fish samples. The animal use protocols in this study were 4

Journal Pre-proof approved by the Institutional Animal Care and Use Committee of Sun Yat-Sen University. 2.3. Virulence analysis of TFJ0901 In order to assess the virulence of attenuated S. agalactiae TFJ0901, the median lethal dose (LD50) of TFJ0901 was determined. The LD50 of the virulent S. agalactiae THN0901, used as a control, was also detected. The Nile tilapia were challenged by

of

IP injection with seven doses (1.0 × 103, 1.0 × 104, 1.0 × 105, 1.0 × 106, 1.0 × 107, 5.0 × 107, and 1.0 × 108 CFU/fish) of TFJ0901 and THN0901 with a total volume of 100

ro

μL per fish (Table 2). A negative control was conducted through IP injection of fish

-p

with PBS (data not shown). Each treatment group contained 20 fish. Fish mortality was recorded for 15 days post challenge. The death of a fish was attributed to S.

re

agalactiae when the bacteria could be re-isolated. The LD50 was calculated with the

lP

Probit analysis module in SPSS 21.0 package (IBM Inc., Chicago, IL, USA).

na

2.4. Test of reversion to virulence

In order to determine the virulence stability of the naturally attenuated S. agalactiae

Jo ur

TFJ0901, a reversion to virulence test was carried out in vivo. Firstly, the proliferation of bacteria in different organs was examined over time in Nile tilapia after IP injection with TFJ0901 to identify which organ has the largest bacterial content at what time. Secondly, in order to ensure the success of the microorganism re-isolation and passage, the organ with the largest bacterial content was collected at an appropriate time which was determined based on the proliferation of TFJ0901 in different organs after IP injection, then the organ properly treated to serve as a subculture inoculum. The subculture inoculum was then continuously passaged in vivo. Finally, in order to determine whether the vaccine strain reverted to a virulent strain post serial passage in vivo, virulence comparison between the live vaccine suspension and the last generation passage inoculum were performed through IP injection challenge. 5

Journal Pre-proof 2.4.1. Proliferation of TFJ0901 in Nile tilapia To determine the proliferation of TFJ0901 in Nile tilapia organs, a total of 40 fish were IP injected with a 100 μL of an TFJ0901 suspension at a dose of 1.0 × 108 CFU/fish. Five fish were sampled at 1, 2, 3, 5 and 10 days post-injection, respectively. Under aseptic conditions, brains, livers, spleens and kidneys were weighed and then homogenized with 1 mL PBS in glass homogenizers. Organ homogenates were 10-fold serially diluted in PBS and then 100 μL of each dilution were spread on BHI agar plates. After incubated at 37℃ for 24 h, colonies on the plates were counted to

of

calculate the bacteria per gram of tissue (CFU/g). The homogeneity of the colonies on

ro

the plates was observed, and then they were randomly selected for S. agalactiae identification. The selected colonies were subjected to Gram staining and the specific

-p

PCR amplification based on the cfb gene (Chen et al., 2012). The colonies exhibiting

re

Gram-positive cocci and having the specific amplification products were identified as

lP

S. agalactiae.

2.4.2. Virulence determination of TFJ0901 post serial passage in vivo

na

According to the proliferation of TFJ0901 in Nile tilapia organs, it was found that the spleen was the organ with the largest bacterial content (1.4 ×1010‒1.9×1011 CFU/g)

Jo ur

in fish with typical streptococcicosis symptoms within 24 h post-injection. Typical streptococcicosis symptoms include abnormal swimming (rapid or rotated swimming, with the body bending in C-shape) and corneal opacity. In order to successfully perform the passage, the spleen homogenate, prepared as described earlier, was used as the subculture inoculum. During the first inoculation and subsequent passages, the concentration of live TFJ0901 in both the vaccine and subculture inoculum was adjusted to 5.0 × 109 CFU/mL. Twenty-five fish were used in each passage. For the first inoculation, 100 μL of TFJ0901 vaccine (5.0 × 109 CFU/mL, prepared as described in section 2.1) was IP injected into each fish. The spleens of 10 fish exhibiting typical streptococcicosis symptoms within 24 h post-challenge were sampled and homogenized. The concentration of live TFJ0901 in organ homogenates 6

Journal Pre-proof was determined and then adjusted to 5.0 × 109 CFU/mL. The organ homogenates were then used as subculture inoculums to be IP injected into subsequent fish at a total volume of 100 μL. This procedure was repeated six times. To verify whether TFJ0901 reverted to virulence after the passage tests in Nile tilapia, challenge experiments were performed. The concentrations of the TFJ0901 suspension cultured in vitro were adjusted to 1.1 × 108, 2.2 × 108 and 2.2 × 109 CFU/mL. The concentrations of live TFJ0901 in the 6th generation subculture inoculum were adjusted to 1.0 × 108, 1.9 × 108 and 1.9 × 109 CFU/mL. These

of

suspensions were then IP injected to Nile tilapia at a total volume of 100 μL. As a

ro

negative control group, 100 μL of PBS was IP injected to the fish. A total of 20 fish were used in each treatment group. Fish mortality was recorded for 21 days post-IP

-p

injection and the death of each fish was judged to be caused by S. agalactiae as

re

described above.

lP

2.5. Vaccination and sample collection

In

order

to

na

2.5.1. Optimization of TFJ0901immunization dose determine

the

appropriate

dose

of

TFJ0901

for

IP

Jo ur

injection immunization, fish were IP injected with 100 μL TFJ0901 suspensions at six serially diluted doses (1.0 × 102‒1.0 × 107 CFU/fish) (Table 2). For the negative control group, the fish were IP injected with 100 μL of PBS. Forty-five fish were used in each treatment group (15 fish per tank, three replicates). At 28 days post-vaccination, the fish were challenged with a 100 μL of virulent S. agalactiae THN0901 at a dose of 1.2 × 105 CFU/fish through IP injection. The fish mortality was recorded for 15 days post-challenge and the death of the fish was judged to be caused by S. agalactiae as described above. The RPS was calculated with following formula: RPS = {1 - (mortality in vaccinated group/mortality in control group)} × 100. 2.5.2. Effects of booster vaccination and duration of immune protection of TFJ0901 A total of 1,500 fish were randomly and evenly distributed into four treatment 7

Journal Pre-proof groups and one negative control group, namely group A, B, C, D and E. Each group included three replicates (300 fish/group, 100 fish/tank). Vaccinations were administered to each fish through IP injection at 100 μL/dose. Group A was immunized once with TFJ0901 at a dose of 1.0 × 106 CFU/fish. Group B was immunized twice with TFJ0901 at a dose of 1.0 × 106 CFU/fish. Group C was immunized once with TFJ0901 at a dose of 1.0 × 107 CFU/fish. Group D was immunized twice with TFJ0901 at a dose of 1.0 × 107 CFU/fish. Group E, the negative control, was IP injected with 100 μL of PBS per fish. The booster

of

vaccinations of Groups B and D were performed in the same manner as their primary

ro

vaccinations at 14 days post-initial vaccination (DPIV). Seventy-five fish were randomly selected from each group (25 fish/tank, three replicates per group) and were

-p

then challenged via IP injection with 100 μL of THN0901 at a dose of 1.6 × 10 5

re

CFU/fish at 28 DPIV; 1.8 × 105 CFU/fish at 56 DPIV; and 1.8 × 105 CFU/fish at 84

2.5.3 Sample collection

na

described previously.

lP

DPIV, respectively. Fish mortality was recorded and the RPS was calculated as

Six fish from each group were sampled at each sampling date. After tilapia were

Jo ur

euthanized with high dose of tricaine methanesulfonate (MS-222) at a concentration of 500 mg/L, spleens were collected from Groups C, D and E in section 2.5.2 at 0, 7, 14, 21 and 28 DPIV to determine the mRNA expression of immune-related genes. Blood was collected from the caudal vein for each group at 21, 28, 56 and 84 DPIV. Sera were collected by centrifugation of the clotted blood at 3,000 × g for 10 min to measure levels of serum specific antibodies through ELISA. 2.6. Evaluation of serum specific antibodies against S. agalactiae by ELISA ELISAs were carried out based on instructions provided by Aquatic Diagnostics Ltd. (Stirling, UK), with modifications. Briefly, 96-well ELISA plates were coated with S. agalactiae THN0901 (1.0 ×108 CFU/μL) at 100 μL/well and incubated 8

Journal Pre-proof overnight at 37℃. Plates were blocked with 1% (w/v) bovine serum albumin (BSA) in PBS (0.02 M, pH 7.3) for 1 h at 37°C. The plates were washed three times with a low salt wash buffer (20 mM Trizma base, 0.38 M NaCl, 0.25 mM Merthiolate, 0.05% Tween 20). Next, 100 μL of serum, 20-fold diluted in PBS, were added into each well of the plates. The plates were incubated for 1 h at 37°C and then washed five times with a high salt wash buffer (20 mM Trizma base, 0.5 M NaCl, 0.25 mM Merthiolate, 0.1% Tween 20). A mouse anti-Nile tilapia (O. niloticus) IgM monoclonal antibody (Aquatic Diagnostics Ltd., Stirling, UK) diluted to 1:330 in PBS was added into each

of

well (100 μL/well) and incubated for 1 h at 37°C. The plates were washed five times

ro

with the high salt wash buffer. Next, 100 μL of horseradish peroxidase-conjugated goat anti-mouse IgG (1:8000 dilution) was added to each well and incubated at 37°C

-p

for 1 h. The plates were washed five times with the high salt wash buffer and a color

re

reaction was performed using the TMB kit (Sangon Biotech, Shanghai, China). The

CA, USA).

lP

absorbance was determined at 450 nm with a microplate reader (Bio-Rad, Hercules,

na

2.7. Real-time PCR analysis of immune-related genes

Jo ur

Total RNA extraction from the spleen and subsequent cDNA synthesis and real-time PCR were performed as previously descried (Jiang et al., 2017). Briefly, the total RNA was isolated from spleen using TRIzol Reagent (Invitrogen). According to the instructions of PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara), cDNA was synthesized from 1 μg of total RNA. The relative expression levels of three immune-related genes, namely immunoglobulin M (IgM), major histocompatibility complex class Ⅱβ (MHC Ⅱβ) and T cell surface co-receptor CD4 (CD4), were investigated with real-time PCR. The β-actin gene was used as the control. The IgM primers have been described previously (Wang et al., 2015). The β-actin, CD4 and MHC IIβ primers designed based on KJ126772.1, XM_005455473.3 and JN967618.1, respectively. Primers for the other genes were designed for this study using Primer Premier 5 (Table 1). The real-time PCR was performed in a 10 μL of reaction volume 9

Journal Pre-proof in a LightCycler480 System (Roche) by using SYSR Premix Ex Taq Ⅱ (Tli RNaseH Plus) Kit (Takara). The qPCR conditions were as follows: denaturation at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. Each amplification was done in triplicate. The mRNA relative expression levels of each gene were determined by the 2– ∆∆Ct method, with β-actin serving as a reference gene (Livak et al., 2001). 2.8. Statistical analysis

of

All statistical analyses were performed using the SPSS 21.0 package (IBM Inc., Chicago, IL, USA). Differences in the antibody and mRNA expression levels between

ro

vaccinated and control fish were analyzed by the Student’s t-test. Differences in

-p

mortality and RPS were analyzed by one-way ANOVA with the LSD post hoc test. A

re

p-value < 0.05 was considered statistically significant.

lP

3. Results

na

3.1. Virulence analysis of TFJ0901

The IP injection challenge results showed that the mortality of Nile tilapia was up

Jo ur

to 90.0% after being challenged with the virulent strain THN0901 at a dose 1.0 × 105 CFU/fish in three days, while the mortality increased to 100% when challenged at a dose above 1.0 × 106 CFU/fish. The LD50 of THN0901 was 1.6 × 103 CFU/fish (Table 2). In contrast, no death or symptoms of streptococcal disease were observed when the fish were challenged with the naturally attenuated strain TFJ0901 at a dose of 1.0 × 107 CFU/fish. The LD50 of TFJ0901 was up to 8.8 × 108 CFU/fish (Table 2). The fish in the negative control group injected with PBS did not die (data not shown). 3.2. Reversion of TFJ0901 to virulence 3.2.1. Proliferation of TFJ0901 in Nile tilapia organs When fish were IP injected with TFJ0901 at a dose of 1.0 × 108 CFU/fish, the peak 10

Journal Pre-proof period of bacterial density in all examined organs, except the brain, was at 1-day post-injection. The organ with the largest bacterial density within 2 days post-injection was the spleen (Fig. 1). The bacterial density in organs of fish with typical streptococcosis symptoms, as described above, was significantly higher than that in symptomless-fish organs (Table S1). The spleen from fish with typical streptococcosis symptoms exhibited the highest bacterial density of all examined organs, with densities as high as 1.4 × 1010‒1.9 × 1011 CFU/g within 24 h

of

post-injection (Table S1).

ro

3.2.2. Virulence stability of TFJ0901 post passage in vivo

Passage experiments could be maintained for at least 6 generations when using

-p

spleens of diseased fish within 24 h post infection as the subculture inoculum. No fish

re

died or exhibited streptococcosis symptoms when IP injected with TFJ0901 (cell suspension cultured in vitro) or the 6th generation of passage inoculum (G6 inoculum)

lP

at a dose of approximately 1.0 × 107 CFU/fish (Table S2). When the injection dose was approximately 2.0 × 107 CFU/fish, the mortality of the fish caused by TFJ0901

na

was the same as that of the G6 inoculum. When the injection dose was approximately 2.0 × 108 CFU/fish, the mortality of the fish caused by TFJ0901 was slightly higher

Jo ur

than that of the G6 inoculum (Table S2). In addition, the mortality curve shows that the death of fish caused by the G6 inoculum generally lagged behind that caused by the TFJ0901 suspension cultured in vitro (Fig. S1). These results indicate that the attenuated vaccine strain TFJ0901 has no potential for reversion to virulence. 3.3. Optimization of immunization dose of TFJ0901 Compared to the 86.7% mortality of the negative control group, the mortality of the immunized groups at doses of 1.0 × 103‒1.0 × 107 CFU/fish significantly decreased to 69.8%‒2.2% (Table 3). The RPS of fish vaccinated at doses of 1.0 × 107, 1.0 × 106 and 1.0 × 105 CFU/fish were 97.4 ± 2.6%, 71.8 ± 2.6% and 56.4 ± 5.1%, respectively (Table 3). The RPS of fish vaccinated at doses of 1.0 × 104, 1.0 × 103 and 1.0 × 102 11

Journal Pre-proof CFU/fish were very low at 38.5 ± 4.4%, 20.5 ± 2.6% and 2.6 ± 2.6%, respectively (Table 3). The RPS of the vaccinated fish was significantly different among all treatments (p < 0.05). These results indicated that this live attenuated vaccine provided excellent immune protection at doses of 1.0 × 107 and 1.0 × 106 CFU/fish, and thus has the potential to efficiently protect fish from S. agalactiae infection. 3.4. Effects of booster vaccination and duration of immune protection

of

The challenge tests were performed at 28, 56 and 84 DPIV. The challenge results show that the mortality of the treatment groups (0.0%‒62.7% mortality) was

ro

significantly lower (p < 0.05) than that of the negative control group (> 90.0%

-p

mortality) for each challenge test (Table 4, Fig. 2). The RPS of Group D (vaccinated twice with 1.0 × 107 CFU/fish) were all 100% for the three challenge tests, while the

re

RPS of Group C (vaccinated once with 1.0 × 107 CFU/fish) were 92.8 ± 2.9%, 83.0 ±

lP

6.5% and 72.5 ± 2.9% at 28, 56 and 84 DPIV, respectively (Table 4). The RPS of Group D was significantly higher (p < 0.05) than that of Group C at 56 and 84 DPIV

na

(Table 4). In addition, the RPS of Group B (vaccinated twice with 1.0 × 106 CFU/fish) was 88.6 ± 6.2%, 81.6 ± 3.7% and 72.5 ± 1.4% at 28, 56 and 84 DPIV, respectively.

Jo ur

There was no significance between Groups B and C (Table 4). The RPS of Group A (vaccinated once with 1.0 × 106 CFU/fish) was significantly lower (p < 0.05) than that of other three immunized groups, and the RPS of this group decreased to 31.9% at 84 DPIV (Table 4).

3.5. Serum specific antibody levels induced by attenuated TFJ0901 The serum antibody levels of fish vaccinated once and twice at doses of 1.0 × 106 and 1.0 × 107 CFU/fish were determined by ELISA at 21, 28, 56 and 84 DPIV. The ELISA results indicate that this live attenuated vaccine can induce vaccinated fish to produce serum specific IgM antibodies at each time point (Fig. 2). The antibody levels of fish vaccinated once at a dose of 1.0 × 107 CFU/fish were the highest among 12

Journal Pre-proof all immune groups at 21, 28 and 56 DPIV. These levels peaked at 28 DPIV and were significantly higher than those of the control group at 21 (p < 0.05) and 28 (p < 0.01) DPIV (Fig. 2). The antibody levels of fish vaccinated once at a dose of 1.0 × 10 6 CFU/fish also reached peaked at 28 DPIV, but these antibody levels were lower than those of fish vaccinated once at a dose of 1.0 × 107 CFU/fish in each time point (Fig. 2). It is worth noting that the antibody levels of fish vaccinated twice at a dose of 1.0 × 107CFU/fish were lower than those of fish vaccinated once in each time point (Fig. 2). The antibody levels of fish vaccinated once at a dose of 1.0 × 106 CFU/fish were

ro

of

also lower than those of fish vaccinated once at 21 DPVI (Fig. 2).

-p

3.6. The expression of immune genes

To examine the effects of the live attenuated vaccine on the expression of immune

re

related genes at a dose of 1.0 × 107 CFU/fish, IgM, MHC Ⅱβ and CD4 genes were

lP

selected for real-time PCR analysis. The IgM gene expression levels in fish vaccinated once were significantly up-regulated compared to those of the control fish

na

at 7 and 21 DPIV (p < 0.01). The IgM gene expression levels in fish vaccinated twice were lower compared to those in fish vaccinated once at 21 and 28 DPIV (Fig. 3).

Jo ur

Furthermore, the MHC Ⅱβ gene expression levels in fish vaccinated once were significantly up-regulated compared to those in the control fish at 21 DPIV (p < 0.01), while the MHC IIβ gene expression levels of fish vaccinated twice were significantly up-regulated at 28 DPIV (p < 0.01) (Fig. 3). The CD4 gene expression levels of fish vaccinated once and twice were both up-regulated at 28 DPIV (Fig. 3). 4. Discussion Recently, several commercial attenuated live vaccines have been successfully used in the aquaculture industry (Brudeseth et al., 2013). The production of live bacterial vaccines is relatively cheap and their application is relatively easy (Frey, 2007). It is noticeable, however, that the safety of live vaccines is a primary consideration 13

Journal Pre-proof because of the potential for microorganisms to survive and proliferate in the environment. Attenuation of microbial virulence has generally been achieved through multiple passages of microorganisms under different culture conditions and through genetic modifications; however, these artificially attenuated microorganisms could still present biological or environmental safety issues, such as reversion to virulence or potentially harmful genetic exchange with other wild-type strains in the environment (Frey, 2007). In contrast, naturally attenuated microorganisms do not have these issues because they are more genetically and toxicologically stable than the

of

artificially attenuated microorganisms. It is best to isolate naturally attenuated

ro

microorganisms for the development of live vaccines; however, it is difficult to identify naturally attenuated microorganisms applicable for use as live vaccines. As

-p

far as we know, there has only been one similar report, which used naturally avirulent

re

Edwardsiella tarda to develop a live vaccine in Japanese flounder, Paralichthys

lP

olivaceus (see Cheng et al., 2010). Fortunately, a naturally attenuated S. agalactiae strain TFJ0901 in Nile tilapia was isolated (Li et al., 2014a). In the current study, the

na

potential of this naturally attenuated S. agalactiae strain TFJ0901 as a live vaccine in Nile tilapia was analyzed, mainly in terms of its safety and efficacy.

Jo ur

The safety of live vaccines should be given particular attention before they are officially used (Brudeseth et al., 2013). Safety assessment of strain TFJ0901 as a live vaccine was performed in vivo using virulence tests and reversion to virulence test. The results of IP injection show that the LD50 of TFJ0901 was up to 8.8 × 108 CFU/fish, while that of the virulent strain THN0901 was 1.6 × 103 CFU/fish, indicating that TFJ0901 has extremely weak virulence and can be developed into a live attenuated vaccine. The results of the reversion to virulence tests show that the virulence of TFJ0901 did not increase following in vivo passage and even exhibited a weakening trend, thereby indicating that this attenuated strain TFJ0901 is not at risk of reversion to virulence in vivo. These results lay a foundation for TFJ0901 to be developed into a safe live vaccine. Vaccines can only be practically used if they produce a sufficiently high immune 14

Journal Pre-proof protection level and a sufficiently long duration of immune protection. Almost all reported S. agalactiae vaccines have only performed short-term evaluation of immune efficacy (Liu et al., 2016). The RPS of fish vaccinated at doses of 1.0 × 106 and 1.0 × 107 CFU/fish were 71.8 ± 2.6% and 97.4 ± 2.6%, respectively, at 28 days post vaccination, which is higher than those of fish vaccinated at other doses. The vaccine at these two doses has the potential to effectively protect Nile tilapia from S. agalactiae infection for a long time. Duration of immune protection and effects of booster vaccination were then determined at these two doses. The booster vaccination

of

significantly increased the RPS of vaccinated fish compared to the single vaccination.

ro

The RPS of fish vaccinated twice at a dose of 1.0 × 107 CFU/fish was 100%, even at 84 DPIV, and the RPS of fish vaccinated twice at a dose of 1.0 × 106 CFU/fish and

-p

fish vaccinated once at a dose of 1.0 × 107 CFU/fish were both up to 72.5% at 84

re

DPIV. These results suggest that this attenuated vaccine can protect Nile tilapia from

lP

S. agalactiae infection for at least 84 days. Furthermore, in a natural farming situation, the density of S. agalactiae in the water is extremely low. It was found that under the laboratory-controlled challenges, even though tilapia immersed in high concentration

na

（106‒108 CFU/mL）of S. agalactiae, the mortality rate of fish was only 10%, which

Jo ur

was far lower than the 100% mortality rate caused by intracoelomic injection at the same dose (Soto et al., 2016). In this study, the immune protection effects of this live vaccine were evaluated by IP injection challenge, and the vaccine presented extremely high immune protection efficiency. This live vaccine therefore may provide higher and longer immune protection to fish in the natural feeding condition. Currently, the Nile tilapia aquaculture cycle can be as short as 3‒4 months; thus, this vaccine has the potential to protect fish from the streptococcosis during the entire farming cycle. Of course, it is undeniable that the variables affecting vaccine efficacy in the natural environment are more complicated, so further field trials are needed. Some studies have shown that vaccine efficacy is related to the antibody levels after vaccination (Bricknell et al., 1997; Bricknell et al., 1999; Klesius et al., 2000; Pasnik et al., 2005; Hetron Mweemba, 2013; Rønneseth et al., 2017), while other 15

Journal Pre-proof studies indicate that there is no strong correlation between induced antibodies and the protective effects of the vaccine (Baba et al., 1988; Panagiotis et al., 2006; Cui et al., 2010; Long et al., 2013; Chettri et al., 2015; Yamasaki et al., 2015; Sudheesh et al., 2016; Abdelhamed et al., 2017). The serum antibody levels of fish vaccinated once at a dose of 1.0 × 107 CFU/fish were higher than those of fish vaccinated once at a dose 1.0 × 106 CFU/fish, and the RPS of the former was also significantly higher than that of the latter. Interestingly, the serum antibody levels of fish with a booster vaccination at a dose of 1.0 × 107 CFU/fish were significantly lower than those of fish with a

of

single vaccination at the same dose; however, the RPS of the former was significantly

ro

higher than that of the latter. These results are similar to other reports which found

-p

that a booster vaccination with higher RPS induced lower antibody levels compared to a single vaccination (Gudmundsdottir et al., 2009; Zhang et al., 2014；Sudheesh et al.,

re

2016). This phenomenon may be due to the process of specific IgM affinity

lP

maturation (Costa et al., 2012). Here, the booster immunization may promote the affinity of specific IgM instead of increasing the amount of specific IgM (Zhang et al.,

na

2014), thereby resulting in fish with lower antibody levels achieving higher protection. In addition, there may be other mechanisms, such as cellular immunity and innate

Jo ur

immunity, involved in immune protection, but this is currently unclear. The changes in IgM expression levels were consistent with the antibody levels. Moreover, the expression levels of humoral immunity-related genes IgM, MHC IIβ and CD4 were up-regulated in vaccinated fish at different time points. These results suggest that humoral immunity could be induced by this live vaccine. The involvement of other immune factors, such as cellular immunity and innate immunity, in the immune protection needs further study. In conclusion, the naturally attenuated S. agalactiae strain TFJ0901 exhibited extremely low virulence to Nile tilapia and showed no risk of reversion to virulence in vivo. This live vaccine can induce high RPS and the protection duration is at least 84 days. Booster immunization had positive effects on RPS, but negative effects on the specific antibody levels. Taken together, TFJ0901 has the potential to be developed 16

Journal Pre-proof into a safe live vaccine to effectively protect Nile tilapia from S. agalactiae infection. Acknowledgements This work was supported by Special Fund for Promoting the Economic Growth of Guangdong Province (Marine project) and China Modern Agricultural Industry Technology System (The Control of Parasites Infection on Marine Fish, CARS-47-18) to Pro. Anxing Li.

of

References

ro

Abdelhamed, H., Ibrahim, I., Nho, S.W., Banes, M.M., Wills, R.W., Karsi, A., Lawrence, M.L., 2017. Evaluation of three recombinant outer membrane proteins, OmpA1, Tdr, and TbpA, as potential vaccine antigens against virulent Aeromonas hydrophila infection in channel catfish (Ictalurus

-p

punctatus). Fish Shellfish Immunol. 66, 480‒486.

Assis, G.B., Tavares, G.C., Pereira, F.L., Figueiredo, H.C., Leal, C.A., 2017. Natural coinfection by

re

Streptococcus agalactiae and Francisella noatunensis subsp. orientalis in farmed Nile tilapia (Oreochromis niloticus L.). J. Fish Dis. 40, 51‒63.

lP

Baba, T., Imamura, J., Izawa, K., Ikeda, K., 1988. Immune protection in carp, Cyprinus carpio L., after immunization with Aeromonas hydrophila crude lipopolysaccharide. J. Fish Dis. 11, 237‒244. Baquero, F., Martinez, J.L., Canton, R., 2008. Antibiotics and antibiotic resistance in water

na

environments. Curr. Opin. Biotechnol. 19, 260‒265. Bowater, R.O., Forbes-Faulkner, J., Anderson, I.G., Condon, K., Robinson, B., Kong, F., Gilbert, G.L., Reynolds, A., Hyland, S., Mcpherson, G., 2012. Natural outbreak of Streptococcus agalactiae

Jo ur

(GBS) infection in wild giant Queensland grouper, Epinephelus lanceolatus (Bloch), and other wild fish in northern Queensland, Australia. J. Fish Dis. 35, 173‒186. Bricknell, I.R., Bowden, T.J., Lomax, J., Ellis, A.E., 1997. Antibody response and protection of Atlantic salmon (Salmo salar) immunised with an extracellular polysaccharide of Aeromonas salmonicida. Fish Shellfish Immunol. 7, 1‒16. Bricknell, I.R., King, J.A., Bowden, T.J., Ellis, A.E., 1999. Duration of protective antibodies, and the correlation with protection in Atlantic salmon (Salmo salar L.), following vaccination with an Aeromonas salmonicida vaccine containing iron-regulated outer membrane proteins and secretory polysaccharide. Fish Shellfish Immunol. 9, 139‒151. Brudeseth, B.E., Wiulsrod, R., Fredriksen, B.N., Lindmo, K., Lokling, K.E., Bordevik, M., Steine, N., Klevan, A., Gravningen, K., 2013. Status and future perspectives of vaccines for industrialised fin-fish farming. Fish Shellfish Immunol. 35, 1759‒1768. Chen, M., Li, L.P., Wang, R., Liang, W.W., Huang, Y., Li, J., Lei, A.Y., Huang, W.Y., Gan, X., 2012. PCR detection and PFGE genotype analyses of streptococcal clinical isolates from tilapia in China. Vet. Microbiol. 159, 526‒530. Cheng, S., Hu, Y.H., Zhang, M., Sun, L., 2010. Analysis of the vaccine potential of a natural avirulent Edwardsiella tarda isolate. Vaccine. 28, 2716‒2721. 17

Journal Pre-proof Chettri, J.K., Jaafar, R.M., Skov, J., Kania, P.W., Dalsgaard, I., Buchmann, K., 2015. Booster immersion vaccination using diluted Yersinia ruckeri bacterin confers protection against ERM in rainbow trout. Aquaculture. 440, 1‒5. Chong, S.M., Wong, W.K., Lee, W.Y., Tan, Z.B., Tay, Y.H., Teo, X.H., Chee, L.D., Fernandez, C.J., 2016. Streptococcus agalactiae outbreaks in cultured golden pomfret, Trachinotus blochii (Lacépède), in Singapore. J. Fish Dis. 40, 971‒974. Costa, G., Danz, H., Kataria, P., Bromage, E., 2012. A holistic view of the dynamisms of teleost IgM: a case study of Streptococcus iniae vaccinated rainbow trout (Oncorhynchus mykiss). Dev. Comp. Immunol. 36, 298‒305. Cui, Z., Samuel-Shaker, D., Watral, V., Kent, M.L., 2010. Attenuated Mycobacterium marinum protects zebrafish against mycobacteriosis. J. Fish Dis. 33, 371‒375. Duremdez, R., Al-Marzouk, A., Qasem, J.A., Al-Harbi, A., Gharabally, H., 2004. Isolation of

of

Streptococcus agalactiae from cultured silver pomfret, Pampus argenteus (Euphrasen), in Kuwait. J. Fish Dis. 27, 307‒310.

ro

Evans, J.J., Klesius, P.H., Shoemaker, C.A., 2004. Efficacy of Streptococcus agalactiae (group B) vaccine in tilapia (Oreochromis niloticus) by intraperitoneal and bath immersion administration.

-p

Vaccine. 22, 3769‒3773. 5598‒5605.

re

Frey, J., 2007. Biological safety concepts of genetically modified live bacterial vaccines. Vaccine. 25, Gudmundsdottir, S., Magnadottir, B., Bjornsdottir, B., Arnadottir, H., Gudmundsdottir, B.K., 2009. Specific and natural antibody response of cod juveniles vaccinated against Vibrio anguillarum.

lP

Fish Shellfish Immunol. 26, 619–624.

He, Y., Wang, K.Y., Xiao, D., Chen, D.F., Huang, L., Liu, T., Wang, J., Geng, Y., Wang, E.L., Yang, Q., 2014. A recombinant truncated surface immunogenic protein (tSip) plus adjuvant FIA confers

na

active protection against Group B Streptococcus infection in tilapia. Vaccine. 32, 7025‒7032. Hetron Mweemba, M.a., 2013. Antigen dose and humoral immune response correspond with protection for inactivated infectious pancreatic necrosis virus vaccines in Atlantic salmon (Salmo salar L.).

Jo ur

Vet. Res. 44, 1‒16.

Huang, L.Y., Wang, K.Y., Xiao, D., Chen, D.F., Geng, Y., Wang, J., He, Y., Wang, E.L., Huang, J.L., Xiao, G.Y., 2014. Safety and immunogenicity of an oral DNA vaccine encoding Sip of Streptococcus agalactiae from Nile tilapia Oreochromis niloticus delivered by live attenuated Salmonella typhimurium. Fish Shellfish Immunol. 38, 34–41. Jiang, B., Wang, J., Luo, H.L., Lu, G.L., Li, Y.W., Li, A.X., 2017. l-amino acid oxidase expression profile and biochemical responses of rabbitfish (Siganus oramin) after exposure to a high dose of Cryptocaryon irritans. Fish Shellfish Immunol. 69, 85‒89. Klesius, P.H., Shoemaker, C.A., Evans, J.J., 2000. Efficacy of single and combined Streptococcus iniae isolate vaccine administered by intraperitoneal and intramuscular routes in tilapia (Oreochromis niloticus). Aquaculture. 188, 237‒246. Laith, A.A., Abdullah, M.A., Nurhafizah, W.W.I., Hussein, H.A., Aya, J., Effendy, A.W.M., Najiah, M., 2019. Efficacy of live attenuated vaccine derived from the Streptococcus agalactiae on the immune responses of Oreochromis niloticus. Fish Shellfish Immunol. 90, 235‒243. Li, L., Wang, R., Liang, W., Gan, X., Huang, T., Huang, Y., Li, J., Shi, Y., Chen, M., Luo, H., 2013. Rare serotype occurrence and PFGE genotypic diversity of Streptococcus agalactiae isolated from tilapia in China. Vet. Microbiol. 167, 719‒724. 18

Journal Pre-proof Li, L.P., Wang, R., Liang, W.W., Huang, T., Huang, Y., Luo, F.G., Lei, A.Y., Chen, M., Gan, X., 2015. Development of live attenuated Streptococcus agalactiae vaccine for tilapia via continuous passage in vitro. Fish Shellfish Immunol. 45, 955‒963. Li, W., Su, Y.L., Mai, Y.Z., Li, Y.W., Mo, Z.Q., Li, A.X., 2014a. Comparative proteome analysis of two Streptococcus agalactiae strains from cultured tilapia with different virulence. Vet. Microbiol. 170, 135‒143. Li, W., Wang, H.Q., He, R.Z., Li, Y.W., Su, Y.L., Li, A.X., 2016. Major surfome and secretome profile of Streptococcus agalactiae from Nile tilapia (Oreochromis niloticus): Insight into vaccine development. Fish Shellfish Immunol. 55, 737‒746. Li, Y.W., Liu, L., Huang, P.R., Fang, W., Luo, Z.P., Peng, H.L., Wang, Y.X., Li, A.X., 2014b. Chronic streptococcosis in Nile tilapia, Oreochromis niloticus (L.), caused by Streptococcus agalactiae. J. Fish Dis. 37, 757‒763.

of

Liu, G., Zhu, J., Chen, K., Gao, T., Yao, H., Liu, Y., Zhang, W., Lu, C., 2016. Development of Streptococcus agalactiae vaccines for tilapia. Dis. Aquat. Organ. 122, 163‒170.

ro

Liu, L., Li, Y.W., He, R.Z., Xiao, X.X., Zhang, X., Su, Y.L., Wang, J., Li, A.X., 2014. Outbreak of Streptococcus agalactiae infection in barcoo grunter, Scortum barcoo (McCulloch & Waite), in

-p

an intensive fish farm in China. J. Fish Dis. 37, 1067‒1072.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time

re

quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402‒408. Long, A., Fehringer, T.R., Swain, M.A., LaFrentz, B.R., Call, D.R., Cain, K.D., 2013. Enhanced efficacy of an attenuated Flavobacterium psychrophilum strain cultured under iron-limited

lP

conditions. Fish and Shellfish Immunology. 35, 1477‒1482. Panagiotis, A., Dimitrios, K., Elizabeth, M.C., 2006. Efficacy of a Listonella anguillarum (syn. Vibrio anguillarum) vaccine for juvenile sea bass Dicentrarchus labrax. Dis. Aquat. Org. 71, 19‒24.

na

Pasnik, D.J., Evans, J.J., Klesius, P.H., 2005. Duration of protective antibodies and correlation with survival in Nile tilapia Oreochromis niloticus following Streptococcus agalactiae vaccination.

Jo ur

Dis. Aquat. Organ. 66, 129‒134.

Rønneseth, A., Haugland, G.T., Colquhoun, D.J., Brudal, E., Wergeland, H.I., 2017. Protection and antibody reactivity following vaccination of lumpfish (Cyclopterus lumpus L.) against atypical Aeromonas salmonicida. Fish Shellfish Immunol. 64, 383‒391. Sommerset, I., Krossoy, B., Biering, E., Frost, P., 2005. Vaccines for fish in aquaculture. Expert review of vaccines. 4, 89‒101.

Soto, E., Zayas, M., Tobar, J., Illanes, O., Yount, S., Francis, S., Dennis, M.M., 2016. Laboratory-controlled challenges of Nile tilapia (Oreochromis niloticus) with Streptococcus agalactiae: comparisons between immersion, oral, intracoelomic and intramuscular routes of infection. J. Comp. Pathol. 155, 339‒345. Sudheesh, P.S., Cain, K.D., 2016. Optimization of efficacy of a live attenuated Flavobacterium psychrophilum immersion vaccine. Fish Shellfish Immunol. 56, 169‒180. Wang, E., Wang, K., Chen, D., Wang, J., He, Y., Long, B., Yang, L., Yang, Q., Geng, Y., Huang, X., Ouyang, P., Lai, W., 2015. Evaluation and selection of appropriate reference genes for real-time quantitative PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus) during vaccination and infection. Int. J. Mol. Sci. 16, 9998–10015. Yamasaki, M., Araki, K., Maruyoshi, K., Matsumoto, M., Nakayasu, C., Moritomo, T., Nakanishi, T., Yamamoto, A., 2015. Comparative analysis of adaptive immune response after vaccine trials 19

Journal Pre-proof using live attenuated and formalin-killed cells of Edwardsiella tarda in ginbuna crucian carp (Carassius auratus langsdorfii). Fish Shellfish Immunol. 45, 437‒442. Ye, X., Li, J., Lu, M.X., Deng, G.C., Jiang, X.Y., Tian, Y.Y., Quan, Y.C., Jian, Q., 2011. Identification and molecular typing of Streptococcus agalactiae isolated from pond-cultured tilapia in China. Fish. Sci. 77, 623‒632. Yi, T., Li, Y.W., Liu, L., Xiao, X.X., Li, A.X., 2014. Protection of Nile tilapia (Oreochromis niloticus L.) against Streptococcus agalactiae following immunization with recombinant FbsA and α-enolase. Aquaculture. s 428–429, 35‒40. Zhang, Z.H., Wu, H.Z., Xiao, J.F., Wang, Q.Y., Liu, Q., Zhang, Y.X., 2014. Booster vaccination with live attenuated Vibrio anguillarum elicits strong protection despite weak specific antibody response in zebrafish. J. Appl. Ichthyol. 30, 117‒120. Zhu, L., Yang, Q., Huang, L., Wang, K., Wang, X., Chen, D., Geng, Y., Huang, X., Ouyang, P., Lai, W.,

of

2017. Effectivity of oral recombinant DNA vaccine against Streptococcus agalactiae in Nile

ro

tilapia. Dev. Comp. Immunol. 77, 77‒87.

-p

Figure 1

Brain Liver Spleen Kidney

Jo ur

na

CFU/g

lP

re

10

4.9×10 4.9 1 0 10 10 3.7× 3.710 1 0 10 10 10 2.5× 10 2.51 0 10 1.3× 1.310 1 0 10 9 09 1.0× 10 1.01 0 9 1.0× 1.010 1 0 09 8 08 7.6× 7.610 1 0 8 5.2× 5.210 1 0 08 08 2.8× 2.810 1 08 4.0× 10 4.01 0 077 7 3.0× 3.010 1 0 07 7 07 2.3× 10 2.31 07 07 1.5× 1.510 1 0 7.5× 10 6 7500000.0 0 0.0

1

2

3

5

10

Days post challenge

Fig. 1. The proliferation of TFJ0901 in Nile tilapia organs post-injection. Brain, liver, spleen and kidney were taken from five fish at 1, 2, 3, 5 and 10 days post-injection with TFJ0901 at a dose of 1.0 × 108 CFU/fish. The amount of bacteria in each organ was quantified by plating on BHI plates post-serial dilution. Each point represents the mean of five individuals. The standard errors are large; therefore, error bars are not shown to ensure that the figure is legible.

20

Journal Pre-proof

28 days 100.0

PBS 10 6 vaccined once 10 6 vaccined twice 10 7 vaccined once 10 7 vaccined twice

80.0 60.0 40.0 20.0 0.0 0

2

4

6

8

10

12

14

16

56 days 100.0

ro

PBS

10 6 vaccined once 10 6 vaccined twice 10 7 vaccined once 10 7 vaccined twice

80.0

-p

60.0

re

40.0 20.0 0.0 0

2

4

6

8

10

12

14

16

lP

Mean cumulative mortality (%)

Days post initial challenge

of

Mean cumulative mortality (%)

Figure 2

84 days

na

100.0 80.0 60.0 40.0 20.0 0.0 0

Jo ur

Mean cumulative mortality (%)

Days post initial challenge

2

4

6

8

10

12

14

PBS 10 6 vaccined once 10 6 vaccined twice 10 7 vaccined once 10 7 vaccined twice

16

Days post initial challenge

Fig. 2. Cumulative mortality (%) of tilapia was recorded for 15 days post challenge. A single or booster vaccination was performed through IP injection in Nile tilapia at doses of 1.0 × 106 CFU/fish and 1.0 × 107 CFU/fish. Fish were challenged at 28, 56 and 84 days post-initial vaccination. Each point represents the mean of three parallel tanks. The results of the significance analysis (described in Table 4) and error bars are not shown to ensure that the figure is legible.

21

Journal Pre-proof Figure 3

PBS 106 vaccinated 106 vaccinated 107 vaccinated 107 vaccinated

**

0.7 0.6 0.5

once twice once twice

*

0.4 0.3 0.2 0.1 0.0 21

28

56

84

ro

Days post initial vaccination

of

Absorbance at 450nm

0.8

Fig. 3. Serum specific antibody levels after vaccination with TFJ0901. A single or booster

-p

vaccination was performed through IP injection in Nile tilapia at doses of 1.0 × 106 CFU/fish and

re

1.0 × 107 CFU/fish. Each bar represents the mean ± SEM (n = 6). Asterisks indicate statistical

Jo ur

na

lP

significance between the vaccinated group and the PBS control group (*p < 0.05, **p < 0.01).

22

Journal Pre-proof

Fold change

Figure 4

10 9 8 7 6 5 4 3 2 1 0

IgM

Vaccinated once Vaccinated twice

** Booster vaccination **

NA

7

NA

14

21

28

Vaccinated once Vaccinated twice

ro

**

NA

-p

**

7

NA

14

21

28

3

lP

Days post initial vaccination

na

CD4

2

1

*

Jo ur

Fold change

of

MHC Ⅱβ

10 9 8 7 6 5 4 3 2 1 0

re

Fold change

Days post initial vaccination

NA

0 7

Vaccinated once Vaccinated twice

NA

14

21

28

Days post initial vaccination

Fig. 4. The expression levels of IgM, MHC Ⅱβ and CD4 genes in the spleens of Nile tilapia. A single or booster vaccination was performed through IP injection in Nile tilapia at a dose of 1.0 × 107 CFU/fish. The mRNA expression levels of each gene were normalized to that of the β-actin gene. The relative expression was calculated by dividing the values of the vaccinated fish by those of the negative controls. “NA” indicates no available data at this time point because the fish vaccinated twice were sampled only at 3 and 4 weeks post-vaccination. Each bar represents the mean ± SEM (n = 6). Asterisks indicate statistical significance between vaccinated fish and 23

Journal Pre-proof

Jo ur

na

lP

re

-p

ro

of

negative control fish (*p < 0.05, **p < 0.01).

24

Journal Pre-proof Table 1 Real-time PCR primers used in this study. Sequences(5'→3')

β-actin-F

GGCTACTCCTTCACCACCACAG

β-actin-R

GGGCAACGGAACCTCTCATT

CD4-F

AAGAAACAGATGCGGGAGAGT

CD4-R

AGCAGAGGGAACGACAGAGAC

IgM-F

GGGAAGATGAGGAAGGAAATGA

IgM-R

GTTTTACCCCCCTGGTCCAT

MHC IIβ-F

ACTGAGTTTGGTGTGAGGAATGC

MHC IIβ-R

TGTGGAGTGAAGTCTTACTGATGGTT

Target Gene

GenBank/Reference

β-actin

KJ126772.1

CD4

XM_005455473.3

IgM

Wang, et al., 2015

MHC IIβ

JN967618.1

Jo ur

na

lP

re

-p

ro

of

Primer Name

25

Journal Pre-proof Table 2 Virulence of the S. agalactiae strain THN0901 and TFJ0901 to Nile tilapia by IP injection. Challenge

dose

(CFU/fish,

100

Mortality（%）

μL/fish)

THN0901

TFJ0901

1.0 × 103

45.0

0.0

1.0 × 104

65.0

0.0

5

90.0

0.0

1.0 × 106

100.0

0.0

1.0 × 107

100.0

0.0

7

100.0

10.0

1.0 × 108

100.0

5.0 × 10

25.0 3

1.6 × 10 CFU/fish

8.8 × 108 CFU/fish

Jo ur

na

lP

re

-p

ro

LD50

of

1.0 × 10

26

Journal Pre-proof Table 3 Relative percent survival of fish at different vaccination doses. Group

Vaccination dose

DPVa

Fish no.b

(CFU/fish)

Average mortalityc

RPSc,d (%) ±

(%) ± SEM

SEM

a

Control

-

28

3 × 15

86.7 ± 0.0

-

Vaccination

1.0 × 102

28

3 × 15

84.4 ± 2.2a

2.6 ± 2.6a

1.0 × 103

28

3 × 15

68.9 ± 2.2b

20.5 ± 2.6b

1.0 × 104

28

3 × 15

53.3 ± 3.8c

38.5 ± 4.4c

1.0 × 105

28

3 × 15

37.8 ± 4.5d

56.4 ± 5.1d

1.0 × 106

28

3 × 15

24.4 ± 2.2e

71.8 ± 2.6e

1.0 × 107

28

3 × 15

2.2 ± 2.2f

97.4 ± 2.6f

of

Significant differences (p < 0.05) are indicated by different superscript letters indicate after multiple comparisons. Time of challenge: days post-vaccination.

b

The number of fish used for challenge. Each group had three replicates with 15 fish per replicate.

c

The results are the average of the data from three replicates for each group.

d

RPS: Relative percent survival.

Jo ur

na

lP

re

-p

ro

a

27

Journal Pre-proof Table 4 Effects of booster vaccination and duration of immune protection in Nile tilapia vaccinated with TFJ0901 at doses of 1.0 × 106 and 1.0 × 107 CFU/fish. Group E

Vaccination

Vaccination

doses (CFU/fish)

timesa

PBS

-

A

1.0 × 10

B

6

DPIVb

Fish no.c

28

3 × 25

Average mortalityd

RPSd,e (%)

(%) ± SEM

± SEM

93.3 ± 3.5

a

-

b

65.7 ± 0.0a

once

28

3 × 25

32.0 ± 0.0

1.0 × 106

twice

28

3 × 25

10.7 ± 5.8c

88.6 ± 6.2b

C

1.0 × 107

once

28

3 × 25

6.7 ± 2.7c,d

92.8 ± 2.9b,c

D

1.0 × 107

twice

28

3 × 25

0.0 ± 0.0d

100.0 ± 0.0c

E

PBS

-

56

2 × 25

94.0 ± 2.0a

3 × 25

37.3 ± 1.3

b

60.3 ± 1.4a

17.3 ± 3.5

c

81.6 ± 3.7b

1.0 × 10

6

B

1.0 × 10

6

C

once

56

twice

56

3 × 25

1.0 × 107

once

56

3 × 25

D

1.0 × 107

twice

56

3 × 25

of

A

-

E

PBS

-

84

3 × 25

92.0 ± 0.0a

3 × 25

62.7 ± 1.3

b

31.9 ± 1.5a

3 × 25

25.3 ± 1.3c

72.5 ± 1.4b

3 × 25

25.3 ± 2.7c

72.5 ± 2.9b

0.0 ± 0.0d

100.0 ± 0.0c

84

B

1.0 × 106

twice

84

C

1.0 × 107

once

84

D

1.0 × 107

twice

84

83.0 ± 6.5b

0.0 ± 0.0d

100.0 ± 0.0c

ro

once

-p

1.0 × 10

re

A

6

16.0 ± 6.1c

3 × 25

-

lP

Significant differences (p < 0.05) are indicated by different superscript letters after multiple comparisons at each challenge time point.

Booster vaccination was performed at 14 days post-initial vaccination. The vaccination doses were the

na

a

same as the initial vaccination doses.

Time of challenge: days post-initial vaccination.

c

The numbers of fish used for challenge. Each group had three replicates at each time point, except for

Jo ur

b

E group with two replicates at 56 DPIV, 25 fish per replicate. d

The results are the average of the data from three replicates for each group.

e

RPS: Relative percent survival.

28

Journal Pre-proof Dear editor: We would like to submit the enclosed manuscript entitled “Potential of naturally attenuated Streptococcus agalactiae as a live vaccine in Nile tilapia (Oreochromis niloticus)”, which we wish to be considered for publication in “Aquaculture”. No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication. I would like to declare on behalf of my co-authors that the work described was original research that has not been published previously, and not under consideration for publication elsewhere, in whole or in part.

ro

of

Thank you and best regards.

-p

Yours sincerely,

re

Professor An-Xing Li

Tel: +86 20 84115113

na

Fax: +86 20 84115113

lP

School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, PR China

Jo ur

Email: [email protected] (A.-X. Li)

29

Journal Pre-proof

Highlights: 

A naturally attenuated Streptococcus agalactiae live vaccine TFJ001 was developed. TFJ0901 was safe as a live vaccine, without the potential to revert to virulence.



The attenuated live vaccine provided immunity to the fish for at least 84 days.



Humoral immunity could be induced in the vaccinated fish.

Jo ur

na

lP

re

-p

ro

of



30