Potential role of heme metabolism in the inducible expression of heme oxygenase-1

    Potential role of heme metabolism in the inducible expression of heme oxygenase-1 Aka-aki Takeda, Machiko Sasai, Yuka Adachi, Keiko Ohnishi, Jun-ichi Fujisawa, Shingo Izawa, Shigeru Taketani PII: DOI: Reference:

S0304-4165(17)30109-5 doi:10.1016/j.bbagen.2017.03.018 BBAGEN 28809

To appear in:

BBA - General Subjects

Received date: Revised date: Accepted date:

13 December 2016 6 March 2017 23 March 2017

Please cite this article as: Aka-aki Takeda, Machiko Sasai, Yuka Adachi, Keiko Ohnishi, Jun-ichi Fujisawa, Shingo Izawa, Shigeru Taketani, Potential role of heme metabolism in the inducible expression of heme oxygenase-1, BBA - General Subjects (2017), doi:10.1016/j.bbagen.2017.03.018

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

IP

T

Potential role of heme metabolism in the inducible expression of heme oxygenase-1 Aka-aki Takedaa, Machiko Sasaia, Yuka Adachia, Keiko Ohnishia, Jun-ichi Fujisawab, Shingo Izawaa , and Shigeru Taketania,c * a

NU

SC R

Department of Biotechnology, Kyoto Institute of Technology, Sakyo-ku, Kyoto, 606-8510 Japan; b Department of Microbiology, and cUnit of Research Complex, Kansai Medical University, Hirakata, Osaka 573-8510 Japan

TE

D

MA

* Corresponding author: Unit of Research Complex/Department of Microbiology, Kansai Medical University, Hirakata, Osaka 573-8510, Japan. Phone: 81-72-804-2380; Fax: 81-72-804-2389; E-mail: [email protected]

CE P

Abbreviations: HO, heme oxygenase; MARE, Maf recognition element; HRI,

AC

heme-regulated inhibitor; eIF2, eukaryotic initiation factor 2; FECH, ferrochelatase; ALA, 5-aminolevulinic acid; ALAS1, ALA synthase-1; SA, succinylacetone; CoPP, Co-protoporphyrin; SnPP, Sn-protoporphyrin; ZnPP, Zn-protoporphyrin; FCS, fetal calf serum; PBS, phosphate-buffered saline; DMEM, Dulbecco’s modified Eagle’s medium; FCS, fetal calf serum; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; SDS-PAGE, sodium dodecylsulfate-polyacrylamide gel electrophoresis; PVDF, poly (vinylidene difluoride); CMH2DCFDA, 5-(and-6)chloromethyl-2',7'-dichlorodihydrofluorescin diacetate; DFO, desferrioxamine; BSA, bovine serum albumin; N-MePP, N-methyl protoporphyrin; CHIP, chromatin immunoprecipitation; ROS, reactive oxygen species; NAC, N-acetylcysteine.

1

ACCEPTED MANUSCRIPT

SC R

IP

T

ABSTRACT Background: The degradation of heme significantly contributes to cytoprotective effects against oxidative stress and inflammatory. The enzyme heme oxygenase-1 (HO-1), involved in the degradation of heme, forms carbon monoxide (CO), ferrous iron, and bilirubin in conjunction with biliverdin reductase, and is induced by various stimuli including oxidative stress and heavy metals. We examined the involvement of heme metabolism in the induction of HO-1 by the inducers sulforaphane and sodium arsenite.

TE

D

MA

NU

Methods: We examined the expression of HO-1 in sulforaphane-, sodium areseniteand CORM3-treated HEK293T cells was determined, by measuring the transcriptional activity, levels of mRNA and protein. Results: The blockade of heme biosynthesis by succinylacetone and N-methyl protoporphyrin, which are inhibitors of heme biosynthesis, markedly decreased the induction of HO-1. The knockdown of the first enzyme in the biosynthesis of heme, 5-aminolevulinic acid synthase, also decreased the induction of HO-1. The cessation of HO-1 induction occurred at the transcriptional and translational levels, and was mediated by the activation of the heme-binding transcriptional repressor

AC

CE P

Bach1 and translational factor HRI. CO appeared to improve the expression of HO-1 at the transcriptional and translational levels. Conclusions: We demonstrated the importance of heme metabolism in the stress-inducible expression of HO-1, and also that heme and its degradation products are protective factors for self-defense responses. General significance: The key role of heme metabolism in the stress-inducible expression of HO-1 may promote further studies on heme and its degradation products as protective factors of cellular stresses and iron homeostasis in specialized cells, organs, and whole animal systems. Key words: HO-1, heme metabolism, sulforaphane, CORM3, Bach1, HRI

2

ACCEPTED MANUSCRIPT

SC R

IP

T

1. Introduction Heme oxygenase (HO) catalyzes the oxidation of heme to biliverdin IXa, carbon monoxide (CO), and free iron in the presence of molecular oxygen and a suitable electron donor [1]. Biliverdin IXa is oxidized to bilirubin by biliverdin reductase, which is conjugated with glucuronic acid and then excreted. Two HO isoforms, HO-1 and HO-2, have been identified in mammals [1,2]. The expression of HO-1 is induced by oxidative stress and is present at high levels in the spleen and liver, while that of HO-2 is constant and abundant in the brain and testis [2-4]. We recently

TE

D

MA

NU

found that various cells continuously synthesize and degrade heme without the use of newly synthesized heme into hemoproteins, that the blockade of heme biosynthesis or the HO reaction induced oxidative stress-induced cell death in non-erythroid and erythroid cells, and also that bilirubin exhibited a protective effect against cell damage [5]. Furthermore, CO is necessary for the transcription of the globin gene [6]. Thus, HO-1 and HO-2 play important roles in physiological iron homeostasis, antioxidant defenses, and anti-inflammation in vivo. The expression of HO-1 is induced by free heme and heme-independent oxidative stress and suppressed by the transcriptional repressor Bach1 [7]. Bach1 binds to

AC

CE P

small Maf proteins to form a heterodimer that binds to MARE in the enhancer 1 (E1) and enhancer 2 (E2) sites in the ho-1 gene promoter in order to repress transcription [7,8]. Bach1 binds to heme. Once oxidative stress and excess free heme accumulate in cells, the tyrosine phosphorylation or heme-mediated inactivation of Bach1 occur, and Bach1-Maf is then released from E1 and E2, thereby allowing the activation of the ho-1 gene by nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-Maf heterodimers [8,9]. The mechanisms involved in the relationship between the heme-dependent and -independent regulation of HO-1 expression have not yet been clarified. Heme positively regulates the translation of globin mRNA in erythroid cells [10]. In the absence of heme, elF2 kinase, called HRI is activated and phosphorylates elF2, thereby stopping the translation of globin in erythroid cells [10,11]. Previous studies have indicated that the involvement of HRI in the regulation of protein translation in non-erythroid cells [12,13]: however, the functions of HRI in these cells have not been elucidated in detail. Previous studies have shown that CO from heme by up-regulated HO-1 has various biological functions including cytoprotective and anti-inflammatory properties [14,15]. The cytoprotective and anti-inflammatory effects of HO-1 were mimicked by the CO-releasing molecules (CORMs) in several disease models [15,16]. CORMs modulated the activation of various molecules involved in the 3

ACCEPTED MANUSCRIPT

SC R

IP

T

signal transduction pathway [17]. CORMs also have shown to stimulate the ROS generation via the inhibition of cytochrome c oxidase, resulting in the activation of Nrf2 and the subsequent induction of HO-1 expression [18,19]. However, it is still unclear whether CO simply modulates the protein expressions directly via heme-containing regulatory factors including Bach1 and HRI or indirectly through generation of ROS that triggers redox activation of Nrf2 and Maf proteins. In the present study, we tried to clarify the importance of heme metabolism and its metabolite CO for the stress-inducible expression of HO-1. We showed that the

D

MA

NU

blockade of heme biosynthesis canceled the induction of HO-1 by HO-1 inducers including sulforaphane and sodium arsenite in cells. A reduction in HO-1 expression under heme-non-producing conditions occurred at transcriptional and translational levels. A deficiency in heme had a negative impact on the function of the transcriptional factor Bach1, which disturbed the recruitment of Nrf2 and the activation of the translational factor HRI, leading to the cessation of HO-1 mRNA translation. CO enhanced the transcriptional and translational activities of HO-1, and this way has been possibly mediated by interactions to these factors.

CE P

TE

2. Materials and methods 2.1. Materials Antibodies for Bach1, NRF2, and p-NRF2 were products of Sigma Co. (St. Louis, MI). Monoclonal antibody for p53 (DO-1) was obtained from Santa Cruz

AC

Biotechnology (Santa Cruz, CA). Antibodies for HRI, eIF2 and p-eIF2 were from Bethyl Laboratories (Montgomery, TX). Antibodies for actin, ALAS1, HO-1, ferrochelatase (FECH), flag tag and HO-2 were the same as those described previously [5,6,20]. ALAS1 siRNA, Bach1 siRNA, Nrf2 siRNA, hemin, bilirubin, and SA were products of Sigma Co. HRI siRNA was a product of Qiagen (Hilden, Germany). The tricarbonyldichlororuthenium (II) dimer (CORM3) was a product of Funakoshi Co., Ltd. (Tokyo, Japan). To prepare the inactive form of CORM3 (iCORM3), CORM3 was dissolved in PBS and the solution was bubbled with N2 gas at room temperature [21]. The removal of CO from the molecule was confirmed by diminishment of the formation of CO-hemoglobin [22]. The plasmid pCMV-flag HRI was prepared as follows: PCR was performed with human liver cDNA library. Primers 5’-AAGAATTCAGGGGGCAACTCCGGGGTC-3’ and 5’AAGATATCTCATCCCACGCCCCCATC-3’ were used. Amplified cDNAs were digested with EcoRI/EcoRV and ligated into EcoRI/EcoRV site of the vector p3 x FLAG-CMV10 (Sigma Co). CoPP, SnPP, and ZnPP were products of Porphyrin Products (Logan, UT). All other chemicals were of analytical grade. 4

ACCEPTED MANUSCRIPT

IP

T

2.2. Cell Culture Human epithelial cervical cancer HeLa cells and human embryonic kidney HEK293T cells were grown in DMEM supplemented with 7% FCS, penicillin (100 units/ml), and streptomycin (100 µg/ml). HeLa and HEK293T cells were treated with

SC R

5 M sulforaphane or 1 M sodium arsenite plus/minus 1 mM SA for 4-16h. HEK293T cells were transfected with pcDNA3-flag Bach1 or pcDNA-flag Bach1 CP1-6 [23] using Lipofectamine 2000 (Invitrogen Co., Carlsbad, CA) and incubated for 16h. The production of bilirubin by cells was estimated, as described previously

TE

D

MA

NU

[5,6]. Regarding to the knockdown of ALAS1, HRI or Bach1, HEK293T cells were transfected with ALAS1 siRNA, HRI siRNA, Nrf2 siRNA, or Bach1 siRNA using Lipofectamine RNAiMAX (Invitrogen Co.), were cultured for 48h, and then incubated with the chemicals being tested for 4-6h. The nuclear fraction was separated from the cytoplasmic fraction of cells [23]. 2.3. MTT Assay HEK293T cells were cultured with chemical insults for 6 h or 16h and then pulsed with MTT (500 μg /ml) for 1 h; the resultant MTT formazan was solubilized with isopropanol. Absorbance at 590 nm was measured with a Microplate Reader NJ2001

CE P

(Japan InterMed. Co., Tokyo, Japan) [5]. 2.4. Measurement of Intracellular ROS The cells were treated without or with chemicals for 4h, washed with PBS and

AC

then incubated with 10 M CMH2DCFDA (Molecular Probe, Eugene, OR) for 20 min in dark. They were washed and lysed as described previously [24]. Fluorescence in homogenates was measured using a spectrofluorometer with excitation at 485 nm and emission at 535 nm [24]. 2.5. Reporter Assay Luciferase reporter plasmids containing the minimal promoters, tk-lucHO-E1 and tk-lucHO-E2 were constructed as follows: double-stranded oligonucleotides containing the HO-1 MARE site (E1) (5’AGCTTGATTTTGCTGAGTCACCAGTGCCTG -3’) or MARE site (E2) (5’AGCTTTTTCCTGCTGAGTCACGGTCCCG -3’) were phosphorylated and ligated into HindIII-BamHI-digested tk-luc [25]. Cells were transfected with the reporter plasmids tk-lucHO-E1, tk-lucHO-E2, and pRL-CMV (Promega Co., Madison, WI) using a Lipofectamine 2000 reagent, according to the manufacturer’s recommendations. Cells were incubated with or without insultants for 16h and washed twice with PBS. They were then lyzed in Reporter lysis buffer (Promega Co.), the lysates were centrifuged, and the supernatants were assayed for luciferase. 5

ACCEPTED MANUSCRIPT

SC R

IP

T

The Photinus and Renilla luciferase assays were performed according to the protocol for the Dual Luciferase Assay System (Promega Co.). Transfection efficiency was normalized on the basis of Renilla luciferase activity. 2.6. Reverse transcriptase (RT)-PCR analysis Total RNA was isolated from cells using the guanidium isothiocyanate method [6,25]. Single-strand cDNA derived from RNA was synthesized with an oligo (dT) primer using ReveTra Ace (Toyobo Co., Tokyo, Japan), and DNA amplicons were quantitated by real-time PCR, as described previously [6,25]. The primers used

TE

D

MA

NU

were 5’-ATGGTGCACCTGACTGATGC-3’ (forward) and 5’-TTAGTGGTACTTGTGAGCCA-3’ (reverse) for HO-1, and 5’-TGGGTGTGAACCACGAGA-3’ (forward) and 5’-TTACTCCTTGGAGGCCATG-3’ for GAPDH. 2.7. CHIP assay HEK293T cells (1 x 108) were fixed in 20 ml of DMEM with 1% formaldehyde at room temperature for 10 min [25]. Immunoprecipitation with polyclonal antibodies for Bach1 and Nrf2 (Sigma CO.) was performed, followed by the isolation of immunoprecipitates with protein A-magnet beads (Takara Co., Tokyo, Japan). The

AC

CE P

DNA fragments of E1 and E2 were amplified by a real-time PCR, using primers 5’-TGCCCCTGCTGAGTAATCCTT-3’ and 5’-CGGGACCGTGACTGCAAAAC-3’ for E1 and 5’-CTGCATTTCTGCTGCGTCATGT-3’ and 5’-TCCTCCTGCCTACCATTAAAGC-3’ for E2. 2.8. Microscopy Cells in 3.5-cm dishes were washed with PBS (+) (PBS containing 1 mM CaCl2 and 0.5 mM MgCl2), fixed in 4% paraformaldehyde for 20 min, and permeabilized in 0.1% Triton X-100 with PBS (+) for 1 h. After blocking with 2% FCS in PBS (+), an incubation with an antibody for the flag tag was performed, followed by an incubation with a fluorolink Cy2-conjugated rabbit anti-mouse immunoglobulin [20,26]. The localization of antigens in cells was visualized using a Zeiss confocal microscope [20]. 2.9. Immunoblotting. Cell lysates from HEK293T or HeLa cells were subjected to SDS-PAGE and electroblotted onto a PVDF membrane (Bio-Rad Laboratories, Hercules, CA). Immunoblotting was performed as described previously [5,6]. 2.10. Statistic analysis. Two-sample t-tests were used to compare the reporter activity, the amount of the protein-DNA complex, the level of HO-1 mRNA and the production of ROS among 6

ACCEPTED MANUSCRIPT

IP

T

treated and untreated controls. Comparison of data from different treatment groups was conducted using 1-way analysis of variance (ANOVA). All statistical analyses were considered significant at the level of p<0.05 using GraphPad Prism software version 5.02 (GraphPad Software, Inc., CA).

SC R

3. Results 3.1. Blockade of heme biosynthesis canceled the induction of HO-1 by sulforaphane or sodium arsenite.

NU

We [5] recently reported that various cells constantly synthesize and degrade heme to generate bilirubin. We examined the production of bilirubin in HEK293T cells caused by various insults. The inhibitor of heme biosynthesis, SA (1 mM) and

TE

D

MA

inhibitors of the HO reaction, ZnPP (10 M), CoPP (20 M) and SnPP (30 M), as well as iron chelator DFO (100 M) and the inhibitor of FECH, N-MePP (10 M) inhibited the production of bilirubin (Fig. S1). The knockdown of the first enzyme in the biosynthesis of heme ALAS1 or HO-1/-2 decreased the production of bilirubin (Fig. S2). These results indicate that the production of bilirubin reflects the de novo biosynthesis of heme. In order to examine cellular toxicity by treatment with

AC

CE P

chemicals, MTT assay was performed. When heme biosynthesis was inhibited with SA, cell damage was not observed. The cell viability was slightly decreased by treatment with sulforaphane and SA in combination for 16h (Fig. S3). Under the conditions used in this study, cell damage by chemicals was small (<15%). We next examined whether heme metabolism is involved in the induction of HO-1, HEK293T and HeLa cells were treated with the HO-1 inducer sulforaphane in the absence or presence of SA. The induction of HO-1 by sulforaphane was completely suppressed by SA (Fig. 1A). The treatment of HEK cells with N-MePP decreased the induction of HO-1 by sodium arsenite (Fig. 1B). The HO-2 levels remained unchanged by these treatments. The suppression of the HO-1 induction by SA was restored by the addition of the heme precursors, hematoporphyrin, protoporphyrin, and hemin (Fig. S4). When ALAS1 in HEK cells was knocked down with ALAS1 siRNA, the sulforaphane or arsenite-dependent induction of HO-1 was decreased (Fig. 1C). We then examined HO-1 mRNA levels. HO-1 mRNA levels were increased by the treatment of HEK cells with sulforaphane or sodium arsenite, and these increases were partially reduced by SA at 4h (Fig. 2A). The prolonged treatment with SA led to the marked decrease of HO-1 mRNA (data not shown). We then investigated the transcriptional activity of the HO-1 gene. The activities of reporters containing two MARE sites (E1 and E2) were increased by sulforaphane 7

ACCEPTED MANUSCRIPT

SC R

IP

T

and decreased by SA (Fig. 2B). These results indicate that heme biosynthesis is required for the inducible expression of HO-1, which is regulated at the transcriptional level. 3.2. Involvement in the decrease of the sulforaphane-induced transcription of the HO-1 gene by Bach1. In order to examine the mechanisms involved in the regulation of HO-1 expression by heme, the levels of the transcriptional factors Nrf2 and Bach1, which control HO-1 expression, were measured. When HEK cells were treated with sulforaphane,

TE

D

MA

NU

the levels of the transcriptional activators Nrf2 and p-Nrf2 increased, and remained unchanged in the presence of SA (Fig. 3A), which was consistent with previous findings showing that sulforaphane is a potent activator of Nrf2 [27,28]. The level of the transcriptional repressor Bach1 was not affected by these treatments. We then examined the nuclear localization of Nrf2 and Bach1 in sulforaphane-treated cells. An increase was observed in Nrf2 levels in the nuclei of sulforaphane-treated cells, while nuclear Bach1 levels decreased (Fig. 3B). The co-treatment of the sulforaphane-treated cells with SA resulted in an increase in nuclear Nrf2 as well as Bach1 levels. Microscope observations revealed that a decrease in Bach1 levels in

AC

CE P

the nuclei of sulforaphane-treated cells, whereas its levels were unchanged in nuclei following the addition of SA to sulforaphane-treated cells (Fig. 3C). These results suggest that Bach1 remains in the nuclei of heme-deficient cells. In order to examine the binding of Nrf2 and Bach1 at MARE sites (E1 and E2) in the HO-1 gene promoter, a CHIP assay was performed using antibodies for Nrf2 and Bach1. As shown in Fig. 3D, the binding of Nrf2 to E1 and E2 increased, while that of Bach1 was decreased by the treatment with sulforaphane. The co-treatment of sulforaphane-treated cells with SA decreased the binding of Nrf2 to E1 and E2, whereas the binding of Bach1 remained unchanged. These results indicate that Bach1 is not released from MARE sites in the HO-1 gene in heme-deficient cells and suggest that heme can be required for the recruitment of Nrf2 to MARE sites. 3.3. Enhancement of the transcription of the HO-1 gene by CO In order to examine whether the products of the HO reaction, CO or bilirubin, change with the expression of HO-1 in cells, sodium arsenite-, sulforaphane-treated, or SA-treated HEK cells were incubated with bilirubin or the CO-releasing reagent CORM3. The addition of CORM3, but not bilirubin partially restored the SA-mediated suppression of the sulforaphane-dependent induction of HO-1 (Fig. 4A). In the case of the sodium arsenite treatment, CORM3 also restored the SA-dependent suppression of HO-1 expression. The inactive form of CORM3 8

ACCEPTED MANUSCRIPT

SC R

IP

T

(iCORM3) had no restorative effect (see Fig. 5A). An analysis by RT-PCR showed the restoration of decreases in HO-1 mRNA levels by SA in arsenite- or sulforaphane-treated cells by the addition of CORM3 (Fig. 2A). The reporter activity of HO-1 E2 was then measured to investigate whether CO regulates the transcription of HO-1 gene. The E2 activity was higher with the CORM3 treatment than that in sulforaphane/SA-treated cells (Fig. 4B), or arsenite/SA-treated cells (data not shown). The treatment with CORM3 alone resulted in higher reporter activities than those with no treatment (Fig. 4C). On the other hand, when cells were treated with

TE

D

MA

NU

metalloporphyrins including ZnPP, CoPP, and SnPP, the transcriptional activity of the HO-1 gene increased to a different extent (Fig. S5A). CORM3 did not affect reporter activities. An immunoblot analysis showed an increase in HO-1 levels in ZnPP- or CoPP-treated cells, and no change with the treatment with SA and CORM3 (Fig. S5B). These results indicate that metalloporphyrins directly activate the promoter of the HO-1 gene, instead of heme. In order to examine whether Nrf2 is involved in the CO-dependent stimulation of the expression of HO-1, knockdown of Nrf2 with siRNA was performed. The E2 activity and HO-1 protein in Nrf2-deficient cells were markedly decreased (Fig. 4C and D). There were no

AC

CE P

significant changes in the activity or HO-1 protein in Nrf2-deficient cells by any treatments. Thus, Nrf2 is indispensable for the induction of HO-1 by CORM3. We next investigated whether CO affected the function of the heme-binding factor Bach1. When wild-type Bach1 was expressed in HEK cells and the E2 reporter activity was examined by the treatment with sulforaphane plus/minus SA, reporter activity was decreased by the expression of Bach1, but was enhanced by the treatments with sulforaphane, ALA and hemin (Fig. 4B and E). We then examined effect of CORM3 on the E2 reporter activity in Bach1-expressing cells. While the reporter activity with hemin was enhanced by the addition of CORM3, CORM3 did not show any effects on the activity with ZnPP or SnPP (Fig. 4E). Mutant Bach1 CP1-6, which lacks the heme-binding sites [23], was then expressed in HEK cells. All reporter activities were decreased and they did not respond to any treatments including CORM3 and SA. The knockdown of Bach1 increased reporter activity, whereas the treatment of Bach1-deficient cells with CORM3 resulted in similar activity to that in control cells (Fig. 4F). We then examined ROS production in sulforaphane- or CORM3-treated cells. The intracellular level of ROS was increased by the treatment with sulforaphane or CORM3 (Fig. 4G). Blockade of heme biosynthesis by SA did not change the production of ROS, but antioxidant NAC decreased the production. These results indicate that CO enhances the activation of 9

ACCEPTED MANUSCRIPT

SC R

IP

T

the HO-1 gene via ROS-dependent activation of Nrf2, and suggest that CO may be involved in the derepression of Bach1. 3.4. Blockade of heme biosynthesis activated HRI and decreased the translation of HO-1 mRNA Immunoblots revealed the induction of HO-1 expression in cells treated with sulforaphane, and this was accompanied by an increase in HO-1 mRNA levels (Figs. 1A, 2A). In the presence of SA, the induction of the HO-1 protein by sulforaphane was mostly canceled while the decrease induced in HO-1 mRNA levels by SA was

NU

small, suggesting that the cessation of heme biosynthesis may cause a decrease in the translation of HO-1 mRNA to its protein form. In order to test this hypothesis, we

MA

examined the involvement of heme-regulated eIF2 kinase HRI in the cessation of HO-1 mRNA translation. An immunoblot analysis of HRI revealed a slight decrease in HRI and the product of the kinase reaction of HRI, phospho-eIF2 in sulforaphane-treated cells (Fig. 5A). In contrast, the addition of SA to these cells

TE

D

increased HRI levels, and this was accompanied by an increase in phospho-eIF2. The increase observed in the phosphorylation of eIF2resulted in a decrease in the translation of HO-1 mRNA. These results suggest that the heme deficiency caused

AC

CE P

by SA activated the kinase activity of HRI, similar to that observed with the translation of globin mRNA in erythroid cells [6]. However, HO-2 and FECH levels remained unchanged during these treatments. Alternatively, the inactivation of HRI by continuously synthesized heme positively induced the translation of HO-1 mRNA. In order to examine whether HRI is required for the translation of HO-1 mRNA, HRI in HEK cells was knocked down with HRI siRNA, and cells were then treated with sulforaphane. HRI was not detected in HRI-deficient cells, whereas eIF2 was normally phosphorylated by other eIF2 kinases [13]. The expression of HO-1 was reduced and the induction of the HO-1 protein by sulforaphane was diminished in HRI-deficient cells (Fig. 5A). Knockdown of HRI diminished arsenite-dependent induction of HO-1 (data not shown). In order to further examine the involvement of HRI in the activation of the HO-1 gene, the transcriptional activity of the E2 site was examined in HRI-knockdown cells. Reporter activity by sulforaphane or arsenite in HRI-deficient cells was similar to that in control cells, and was consistent with the data shown in Figure 2B. When sulforaphane- and SA-treated HEK cells were co-treated with CORM3, the down-regulation of HO-1 expression by SA was partially restored. On the other hand, no increase was observed in HO-1 by the treatment of HRI-knockdown cells with CORM3. When HRI was expressed, the phosphorylation of eIF2 increased and the level of HO-1 were 10

ACCEPTED MANUSCRIPT

markedly reduced (Fig. 5B, C). Treatment of the cells with CORM3 or hemin

IP

T

resulted in a decrease of phospho-eIF2 dependent on the decrease of HRIThe expression of HO-1 by CORM3 or hemin was then induced, albeit to a lesser extent. HO-1 in HRI-expressing cells was not either induced by the treatment with sulforaphane (Fig. 5C). The addition of the cells with CORM3 led to a decrease of

SC R

phospho-eIF2 and the expression of HO-1 returned to the control level. The blockade of heme biosynthesis in HRI-expressing cells canceled the increase in HO-1 by CORM3, suggesting that the binding of CO to HRI-heme promotes the

NU

translation of HO-1 mRNA. Thus, HRI is indispensable for the stress-inducible expression of HO-1 at the translational level.

TE

D

MA

4. Discussion The present study demonstrated that the induction of HO-1 in cells treated with sulforaphane and arsenite was suppressed by the inhibitor of heme biosynthesis, SA. This suppression was also observed with the inhibitor of FECH, N-MePP or knockdown of ALAS1. The treatment of cells with SA led to the marked inhibition of heme biosynthesis in HEK cells, as evaluated by the generation of bilirubin (Fig. S1). These results suggest that heme and its metabolites are indispensable for the

AC

CE P

induction of HO-1. We previously reported the constant production of bilirubin and CO via heme biosynthesis in various cells, and that the degradation of de novo synthesized heme occurred without the use of heme as the prosthetic group of the hemoprotein [5,6]. Furthermore, the induction of HO-1 was not always compatible with the degradation of the heme moiety of heme protein to protect the cells from oxidative stress, but the continuous stream of heme metabolism is required for protection from cellular stresses and the maintenance of cellular homeostasis [5]. We have provided a new evidence to show that the continuous production and subsequent degradation of heme are required for the stress-inducible expression of HO-1. The suppressed induction of HO-1 by the heme deficiency occurred at the transcriptional and translational levels. Regarding the gene expression of HO-1, the binding sites for a number of transcriptional factors identified in the promoter region of the HO-1 gene have been found to induce the enzyme, and Nrf2 was identified as a major factor in responses to heavy metals and oxidative stress [28-30]. Sulforaphane is an activator of Nrf2 [27,28], and increased nuclear Nrf2 levels with concomitant decreases in the nuclear Bach1 levels. These results are consistent with previous findings having that the import of Nrf2 into nuclei and export of Bach1 from nuclei occur in cells under oxidative stress [31]. We herein demonstrated that 11

ACCEPTED MANUSCRIPT

SC R

IP

T

the SA treatment prevented the export of Bach1 from nuclei even when Nrf2 was activated and entered in nuclei (Fig. 3B). An indirect immuno-fluorescence study on Bach1 confirmed that the cytoplasmic location of Bach1 increased in sulforaphane-treated cells, whereas the co-treatment with SA led to the nuclear localization of Bach1 (Fig. 3C). Suzuki et al. [32] reported that a SA treatment increased Bach1 levels in nuclei, while a hemin treatment promoted the export of Bach1 from nuclei. Accordingly, Bach1 is exported from nuclei by stimuli, but remains in nuclei under heme-deficient conditions.

TE

D

MA

NU

We confirmed that the E1 and E2 sites in the HO-1 gene were targets of Bach1 at which heme acts as a positive regulator of the transcription of the HO-1 gene by releasing Bach1 from the MARE in the E1 and E2 sites [33]. The present study showed that Bach1 remained at the E1 and E2 sites under heme-deficient conditions. Bach1 lacking heme may hinder the recruitment of Nrf2 at MARE even when Nrf2 is activated and enters in nuclei. This hypothesis was confirmed by the expression of the mutant Bach1 CP1-6 in cells markedly suppressing the transcriptional activity of the HO-1 gene without any responses to sulphorafane, heme, or CO (Fig. 4B). Heme is continuously synthesized and binds to newly synthesized Bach1, which is

AC

CE P

localized at MARE in the HO-1 gene under normal conditions. It is possible that heme-binding Bach1 can be released from the MARE site when activated Nrf2-Maf protein complex is recruited at the site upon exposure to Nrf2/HO-1 activators. Alternatively, heme is required for the activation and recruitment of Nrf2 at MARE. The role of HRI in the regulation of HO-1 appears to be more complex. The knockdown of HRI not only lowered the expression of HO-1, also the expression of HO-1 did not respond to sulforaphane, arsenite, SA, or CO. HO-2 levels in HRI-deficient cells were similar to those in control cells. Although this unexpected result suggests that HRI controls the transcription of the HO-1 gene, the transcriptional activity of the HO-1 gene in HRI-deficient cells was similar to that in control cells. HRI (-/-) mice synthesized globin in erythroid cells under normal conditions [34,35], but exhibited impaired macrophages maturation and weak anti-inflammatory responses with less cytokines [36]. Lu et al. [35] reported that HRI (-/-) fetal liver cells did not respond to cytoplasmic stresses including arsenite and suggested that HRI functions to protection against cellular stress other than that caused by a heme deficiency. HRI (-/-) mouse embryonic fibroblasts (MEFs) were also sensitive to arsenite treatment compared with control MEFs, suggesting that HRI-mediated phosphorylation of eIF2 is a protective response to arsenite exposure [37]. We herein demonstrated that HO-1 in HRI-deficient cells was not induced by 12

ACCEPTED MANUSCRIPT

SC R

IP

T

sulforaphane or arsenite. Based on the concept that the induction of HO-1 by various stimuli is cytoprotective, HRI may play an essential role in cellular stress via the induction of HO-1. The mechanisms involved in the down-regulation of the inducible expression of HO-1 by the translational molecule HRI are unclear. Nevertheless, the blockade of heme biosynthesis in SA-treated HEK cells decreased the expression of HO-1 at the transcriptional and translational levels. It is reported that CO exerts pleiotropic cellular effects by acting through a number of signalling pathways [15]. CO interacts with several heme-containing proteins

TE

D

MA

NU

including soluble guanylate cyclase, cytochrome oxidase and NADPH oxidase, in order to transduce multiple signals within cells [16,38,39]. Previous studies showed that CO donors inhibited mitochondrial cytochrome c oxidase, resulting in an increase in the production of ROS and increased the expression of HO-1 by activating Nrf2 [18,19]. Then the enhanced expression of HO-1 prolonged anti-inflammatory effects [19,40]. Since newly synthesized heme was continuously turned over to bilirubin in most cells [5], CO constantly produced positively regulates the expression of HO-1. Therefore, it is possible that the cessation of CO generation by blocking heme metabolism leads to the suppression of HO-1 induction.

AC

CE P

The results of the present study showed that CO, but not bilirubin partially elevated HO-1 mRNA and protein levels, even when the biosynthesis and degradation of heme stopped. The partial restoration of the expression of HO-1 by CO could be due to the lack of heme metabolism. Therefore, the interaction of CO with reactive molecules including remaining heme has been shown to improve transcription by regulating multiple signal transductions. The present data showed that treatment of cells with sulforapahne or CORM3 led to an increase in the ROS production, resulting in the induction of HO-1 via activation of Nrf2. The increased ROS was reduced by treatment with NAC (Fig. 4G). We previously reported that NAC reduced the stress-induced activation of Nrf2, followed by the decrease of the induction of HO-1 [41]. On the other hand, the suppression of the induction of HO-1 by the inhibition of heme biosynthesis occurred without reduction of the intracellular ROS since SA treatment had no effect on the production of ROS. Thus, the suppression of the expression of HO-1 by SA was independent of change in the ROS/Nrf2 signal. In an effort to understand the possible mechanisms responsible for the activation of Nrf2 and the expression of HO-1 by CO, we tested whether CO could enhance the ZnPP- or CoPP-dependent increase in the transcription of the HO-1 gene. Although ZnPP or CoPP inhibited the degradation of heme (Fig. S1), resulting in the inhibition 13

ACCEPTED MANUSCRIPT

SC R

IP

T

of the CO production, these metalloporphyrins activated the transcription of the HO-1 gene. In addition, when wild-type Bach1 was expressed, the E2 activity was repressed, but this repression was restored by the treatment with ALA or CORM3. In contrast, the enhanced E2 activity by ZnPP or CoPP in control and Bach1-expressing cells did not increase by the addition of CORM3 (Fig. 4E and S4A), since CO does not bind to these metalloporphyrins. While CORM3 activated the transcription of the HO-1 gene in Bach1-expressing cells, the repressive effects of the mutant Bach1CP1-6 were not influenced by CO. Considering that ZnPP and

TE

D

MA

NU

CoPP increased the transcriptional activity of the HO-1 gene through the activation of various factors including Nrf2 [42-44], CO plays a positive role in the transcription of the HO-1 gene via the derepression of Bach1. Bach1 is able to bind to heme [7]; however, the heme ligand of Bach1 that regulates this activity has not yet been reported. CO may act as a ligand of Bach1-heme and ameliorate the repressive function of Bach1. It must be taken in consideration that the direct interaction of Bach1 with CO functions in the activation of the HO-1 gene. The transcriptional activity of E2 was enhanced by the addition of CORM3. Several studies have shown the CO-dependent activation of Nrf2

AC

CE P

[18,19,45]. Our results also showed that knockdown of Nrf2 abrogated the CORM3 effect on the expression of HO-1 (Fig. 4C and D), indicating that Nrf2 is involved in the CO-dependent induction of HO-1. On the other hand, even when the generation of CO was stopped by the cessation of heme biosynthesis, the sulforaphane-dependent activation of Nrf2 was observed (Fig. 3A and 4D). These results indicated that endogenously generated CO is not necessary for the activation of Nrf2, and this was different from the activation of Nrf2 by exogenously supplied CO from CORM3. Considering that the concentration of endogenous CO was estimated to be 2-9 nM in blood [22,46] and ~90 nM in neural tissues [47], the excess supply of CO by the treatment of cells with CORM3 caused the cellular stress by an increase in the production of ROS, and the activation of Nrf2. The partial restoration of HO-1 induction by CORM3 under heme-deficient conditions may result from the interaction of CO with remaining hemeproteins. In addition to the enhancement of the transcription of the HO-1 gene by CO, CO positively regulates the translation of HO-1 mRNA. HRI is a heme sensor protein and binds to heme [48]. HRI bound to heme not only loses the kinase activity, but also becomes unstable [49,50]. Otherwise, treatment of cells with CORM3 led to the degradation of HRI (Fig. 5B and C). Therefore, the treatment of cells with hemin resulted in an increase in CO production due to the degradation of heme, which could 14

ACCEPTED MANUSCRIPT

SC R

IP

T

accelerate the degradation of HRI. Other investigators reported that CO directly inhibited the kinase activity of HRI in vitro [51,52]. HRI containing heme may bind CO as its ligand, which inhibits kinase activity, leading to an increase in the translation of HO-1 mRNA. This is supported by CO not enhancing the induction of HO-1 by ZnPP or CoPP. Furthermore, when HRI was over-expressed, the level of HO-1 was reduced and restored by the treatment with CORM3. This restoration was not observed by the cessation of heme metabolism (Fig. 5C), suggesting that the binding of CO to HRI-heme may contribute to the increase in the expression of HO-1.

MA

NU

Based on the result that CO is continuously produced via heme biosynthesis in cells, generated CO modulates HRI-heme activity as well as stability, and the CO-mediated regulation of protein synthesis at the translational step plays an essential role in preventing oxidative stress-induced cell damage.

TE

D

5. Conclusion We herein investigated the production of heme by measuring the generation of bilirubin in the cells, and found that heme was continuously synthesized and rapidly degraded by HO, and bilirubin, the final product of the heme-biosynthetic pathway, was then exported out of cells. The production of bilirubin was stopped by

AC

CE P

inhibitors of heme metabolism including SA, N-MePP, CoPP, and ZnPP. The blockade of heme biosynthesis by SA canceled the sulforaphane- or arsenite-dependent induction of HO-1. The cessation of HO-1 induction occurred at the transcriptional and translational levels, and was mediated by the activation of the heme-binding transcriptional repressor Bach1 and translational factor HRI. CO partially restored the decrease in HO-1 induction at the transcriptional and translational levels, possibly via the derepression of these heme-binding factors. The key role of heme metabolism in the stress-inducible expression of HO-1 may promote further studies on heme and its degradation products as protective factors of cellular redox and iron homeostasis in specialized cells, organs, and whole animal systems. Acknowledgments The authors thank Dr. Atsushi Miyawaki for the kind gift of pcDNA3-UnaG, Dr. Kazuhiko Igarashi for the kind gifts of pcDNA3-flag Bach1 and pcDNA-flag Bach1 CP1-6, Mr. Atsushi Saitoh, and Mr. Afeng Mu for his expert technical assistance. This study was supported in part by grants from the Ministry of Health, Labor and Welfare of Japan.

15

ACCEPTED MANUSCRIPT

SC R

IP

T

References [1] M.D. Maines, The heme oxygenase system: a regulator of second messenger gases. Ann. Rev. Pharmacol. Toxicol. 37 (1997) 517-554. [2] S. Shibahara, T. Kitamuro, K. Takahashi, Heme degradation and human disease: diversity is the soul of life. Antioxid. Redox Signal. 4 (2002) 593-602. [3] S. Taketani, H. Kohno, T. Yoshinaga, R. Tokunaga, The human 32-kDa stress protein induced by exposure to arsenite and cadmium ions is heme oxygenase. FEBS Lett. 245 (1989) 173-176.

NU

[4] S.W. Ryter, R.M. Tyrrell, The heme synthesis and degradation pathways: role in oxidant sensitivity. Heme oxygenase has both pro- and antioxidant properties. Free Radic. Biol. Med. 28 (2001) 289-309.

MA

[5] T.A.Takeda, A. Mu, T.T. Tai, S. Kitajima, S. Taketani, Continuous de novo biosynthesis of haem and its rapid turnover to bilirubin are necessary for cytoprotection against cell damage. Sci. Rep. 5 (2015) 10488.

TE

D

[6] A. Mu, M. Li, M. Tanaka, Y. Adachi, T.T. Tai, P.H. Liem, S. Izawa, K. Furuyama, S. Taketani, Enhancements of the production of bilirubin and the expression of β-globin by carbon monoxide during erythroid differentiation. FEBS Lett. 590 (2016) 1447-1454.

CE P

[7] K. Igarashi, M. Watanabe-Matsui, Wearing red for signaling: the heme-bach axis in heme metabolism, oxidative stress response and iron immunology. Tohoku J. Exp. Med. 232 (2014) 229-253.

AC

[8] A. Maruyama, J. Mimura, K. Itoh, Non-coding RNA derived from the region adjacent to the human HO-1 E2 enhancer selectively regulates HO-1 gene induction by modulating Pol II binding. Nucleic Acids Res. 42 (2014) 13599-13614. [9] J.W. Kaspar, A.K. Jaiswal, Antioxidant-induced phosphorylation of tyrosine 486 leads to rapid nuclear export of Bach1 that allows Nrf2 to bind to the antioxidant response element and activate defensive gene expression. J. Biol. Chem. 285 (2010) 153-162. [10] S. Liu, S. Bhattacharya, A. Han, R.N. Suragani, W. Zhao, R.C. Fry, J.J.Chen, Haem-regulated eIF2alpha kinase is necessary for adaptive gene expression in erythroid precursors under the stress of iron deficiency. Br. J. Haematol. 143 (2008) 129-137. [11] J.J. Chen, Translational control by heme-regulated eIF2α kinase during erythropoiesis. Curr. Opin. Hematol. 21 (2014) 172-178.

16

ACCEPTED MANUSCRIPT

IP

T

[12] M. Liao, M.K. Pabarcus, Y. Wang, C. Hefner, D.A. Maltby, K.F. Medzihradszky, S.P. Salas-Castillo, J.Yan, J.J. Maher, M.A. Correia, Impaired dexamethasone-mediated induction of tryptophan 2,3-dioxygenase in heme-deficient rat hepatocytes: translational control by a hepatic eIF2alpha kinase, the heme-regulated inhibitor. J. Pharmacol. Exp. Ther. 323 (2007) 979-989.

SC R

[13] P. Acharya, J.J. Chen, M.A. Correia, Hepatic heme-regulated inhibitor (HRI) eukaryotic initiation factor 2alpha kinase: a protagonist of heme-mediated translational control of CYP2B enzymes and a modulator of basal endoplasmic reticulum stress tone. Mol. Pharmacol. 77 (2010) 575-592.

MA

NU

[14] S.T. Fraser, R.G. Midwinter, B.S. Berger, R. Stocker, Heme oxygenase-1: A critical link between iron metabolism, erythropoiesis, and development. Adv. Hematol. 2011 (1998) 473709. [15] S.W. Ryter, A.M. Choi, Targeting heme oxygenase-1 and carbon monoxide for therapeutic modulation of inflammation. Transl. Res. 167(1) (2016) 7-34.

TE

D

[16] L.E. Otterbein, R. Foresti, R. Motterlini, Heme oxygenase-1 and carbon monoxide in the heart: the balancing act between danger signaling and pro-survival. Circ. Res. 118 (2016) 1940-1959.

CE P

[17] S.W. Ryter, A.M. Choi, Heme oxygenase-1/carbon monoxide: from metabolism to molecular therapy. Am. J. Respir. Cell Mol. Biol. 41 (2009) 251-260.

AC

[18] C.I. Schwer, M. Mutschler, P. Stoll, U. Goebel, M. Humar, A. Hoetzel, R. Schmidt, Carbon monoxide releasing molecule-2 inhibits pancreatic stellate cell proliferation by activating p38 mitogen-activated protein kinase/heme oxygenase-1 signaling. Mol. Pharmacol. 77(4) (2010) 660-669. [19] P.Y. Yeh, C.Y. Li, C.W. Hsieh, Y.C. Yang, P.M. Yang, B.S. Wung, CO-releasing molecules and increased heme oxygenase-1 induce protein S-glutathionylation to modulate NF-κB activity in endothelial cells. Free Radic. Biol. Med. 70 (2014) 1-13. [20] R. Itoh, K. Fujita, A. Mu, D.H. Kim, T.T. Tai, I. Sagami, S. Taketani, Imaging of heme/hemeproteins in nucleus of the living cells expressing heme-binding nuclear receptors. FEBS Lett. 587 (2013) 2131-2136. [21] S. McLean, R. Begg, H.E. Jesse, B.E. Mann, G. Sanguinetti, R.K. Poole, Analysis of the bacterial response to Ru(CO)3Cl(Glycinate) (CORM-3) and the inactivated compound identifies the role played by the ruthenium compound and reveals sulfur-containing species as a major target of CORM-3 action. Antioxid. Redox Signal. 19 (2013) 1999-2012.

17

ACCEPTED MANUSCRIPT

H. Kitagishi, S. Minegishi, A. Yumura, S. Negi, S. Taketani, Y. Amagase, Y.Mizukawa, T. Urushidani, Y. Sugiura, K. Kano. Feedback response to selective depletion of endogenous carbon monoxide in the blood. J. Am. Chem. Soc. 138 (2016) 5417-5425.

IP

T

[22]

SC R

[23] T. Tahara, J. Sun, K. Nakanishi, M. Yamamoto, H. Mori, T. Saito, H. Fujita, K. Igarashi, S. Taketani, Heme positively regulates the expression of beta-globin at the locus control region via the transcriptional factor Bach1 in erythroid cells. J. Biol. Chem. 279 (2004) 5480-5487.

MA

NU

[24] T. Ohashi, A. Mizutani, A. Murakami, S. Kojo, T. Ishii, S. Taketani, Rapid oxidation of dichlorodihydrofluorescin with heme and hemoproteins: formation of the fluorescein is independent of the generation of reactive oxygen species. FEBS Lett. 511 (2002) 21-27.

D

[25] R. Shimizu, N.N, Lan, T.T, Tai, Y. Adachi, A. Kawazoe, A. Mu, S. Taketani, p53 directly regulates the transcription of the human frataxin gene and its lack of regulation in tumor cells decreases the utilization of mitochondrial iron. Gene. 551 (2014) 79-85.

TE

[26] M. Sawamoto, T. Imai, M. Umeda, K. Fukuda, T. Kataoka, S. Taketani, The

CE P

p53-dependent expression of frataxin controls 5-aminolevulinic acid-induced accumulation of protoporphyrin IX and photo-damage in cancerous cells. Photochem. Photobiol. 89 (2013) 163-172.

AC

[27] M. Kerns, D. DePianto, M. Yamamoto, P.A. Coulombe, Differential modulation of keratin expression by sulforaphane occurs via Nrf2-dependent and -independent pathways in skin epithelia. Mol. Biol. Cell. 21 (2010) 4068-4075. [28] A. Alfieri, S. Srivastava, R.C. Siow, D. Cash, M. Modo, M.R. Duchen, P.A. Fraser, S.C. Williams, G.E. Mann, Sulforaphane preconditioning of the Nrf2/HO-1 defense pathway protects the cerebral vasculature against blood-brain barrier disruption and neurological deficits in stroke. Free Radic. Biol. Med. 65 (2013)1012-1022 [29] C.H. He, P. Gong, B. Hu, D. Stewart, M.E. Choi, A.M. Choi, J. Alam, Identification of activating transcription factor 4 (ATF4) as an Nrf2-interacting protein. Implication for heme oxygenase-1 gene regulation. J. Biol. Chem. 276 (2001) 20858-20865. [30] Y. Shinkai, D. Sumi, I. Fukami, T. Ishii, Y. Kumagai, Sulforaphane, an activator of Nrf2, suppresses cellular accumulation of arsenic and its cytotoxicity in primary mouse hepatocytes. FEBS Lett. 580 (2006) 1771-1774.

18

ACCEPTED MANUSCRIPT

T

[31] H. Suzuki, S. Tashiro, J. Sun, H. Doi, S. Satomi, K. Igarashi, Cadmium induces nuclear export of Bach1, a transcriptional repressor of heme oxygenase-1 gene. J. Biol. Chem. 278 (2003) 49246-49253.

SC R

IP

[32] H. Suzuki, S. Tashiro, S. Hira, J. Sun, C. Yamazaki, Y. Zenke, M. Ikeda-Saito, M. Yoshida, K. Igarashi, Heme regulates gene expression by triggering Crm1-dependent nuclear export of Bach1. EMBO J. 23 (2004) 2544-2553. [33] Y. Dohi, J. Alam, M. Yoshizumi, J. Sun, K. Igarashi, Heme oxygenase-1 gene enhancer manifests silencing activity in a chromatin environment prior to oxidative stress. Antioxid. Redox Signal. 8 (2006) 60-67.

MA

NU

[34] A.P. Han, C. Yu, L. Lu, Y. Fujiwara, C. Browne, G. Chin, M. Fleming, P. Leboulch, S.H. Orkin, J.J. Chen, Heme-regulated eIF2alpha kinase (HRI) is required for translational regulation and survival of erythroid precursors in iron deficiency. EMBO J. 20 (2001) 6909-6918.

D

[35] L. Lu, A.P, Han, J.J. Chen, Translation initiation control by heme-regulated eukaryotic initiation factor 2alpha kinase in erythroid cells under cytoplasmic stresses. Mol. Cell. Biol. 21 (2001) 7971-7980.

TE

[36] S. Liu, R.N. Suragani, F. Wang, A. Han, W. Zhao, N.C. Andrews, J.J.

CE P

Chen, The function of heme-regulated eIF2alpha kinase in murine iron homeostasis and macrophage maturation. J. Clin. Invest. 117 (2007) 3296-3305. [37] E. McEwen, N. Kedersha, B. Song, D. Scheuner, N. Gilks, A. Han, J.J. Chen, P.

AC

Anderson, R.J. Kaufman, Heme-regulated inhibitor kinase-mediated phosphorylation of eukaryotic translation initiation factor 2 inhibits translation, induces stress granule formation, and mediates survival upon arsenite exposure. J. Biol. Chem. 280 (2005) 16925-16933. [38] B. Wegiel, Z. Nemeth, M. Correa-Costa, A.C. Bulmer, L.E. Otterbein, Heme oxygenase-1: a metabolic nike. Antioxid. Redox Signal. 20 (2014) 1709-1722. [39] Y. Naito, T. Takagi, K. Uchiyama, T. Yoshikawa, Heme oxygenase-1: a novel therapeutic target for gastrointestinal diseases. J. Clin. Biochem. Nutr. 48 (2011) 126-133. [40] Y.C. Yang, Y.T. Huang, C.W. Hsieh, P.M. Yang, B.S. Wung, Carbon monoxide induces heme oxygenase-1 to modulate STAT3 activation in endothelial cells via S-glutathionylation. PLoS One. 9 (2014) e100677. [41] Y. Andoh, A. Mizutani, T. Ohashi, S. Kojo, T. Ishii, Y. Adachi, S. Ikehara, S. Taketani, The antioxidant role of a reagent, 2',7'-dichlorodihydrofluorescin

19

ACCEPTED MANUSCRIPT

diacetate, detecting reactive-oxygen species and blocking the induction of heme oxygenase-1 and preventing cytotoxicity. J. Biochem. 140 (2006) 483-489.

IP

T

[42] G. Yang, X. Nguyen, J. Ou, P. Rekulapelli, D.K. Stevenson, P.A. Dennery, Unique effects of zinc protoporphyrin on HO-1 induction and apoptosis. Blood. 97 (2001) 1306-1313.

SC R

[43] W. Hou, Y. Shan, J. Zheng, R.W. Lambrecht, S. E. Donohue, H.L. Bonkovsky, Zinc mesoporphyrin induces rapid and marked degradation of the transcription factor Bach1 and up-regulates HO-1. Biochim. Biophys. Acta. 1779 (2008) 195-203.

NU

[44] S.C. Kwok, Zinc protoporphyrin upregulates heme oxygenase-1 in PC-3 Cells via the stress response pathway. Int. J. Cell. Biol. 2013 (2013) 162094.

MA

[45] P.L. Chi, C.C. Lin, Y.W. Chen, L.D. Hsiao, C.M. Yang, CO induces Nrf2-dependent heme oxygenase-1 transcription by cooperating with Sp1 and c-Jun in rat brain astrocytes. Mol. Neurobiol. 52 (2015) 277-292.

TE

D

[46] D.G. Levitt, M.D. Levitt, Carbon monoxide: a critical quantitative analysis and review of the extent and limitations of its second messenger function. Clin. Pharmacol. 7 (2015) 37-56.

CE P

[47] P. Carratu, M. Pourcyrous, A. Fedinec, C.W. Leffler, H. Parfenova, Endogenous heme oxygenase prevents impairment of cerebral vascular functions caused by seizures. Am. J. Physiol. Heart Circ. Physiol. 285 (2003) H1148-H1157.

AC

[48] M. Miksanova, J. Igarashi, M. Minami, I. Sagami, S. Yamauchi, H. Kurokawa, T. Shimizu, Characterization of heme-regulated eIF2alpha kinase: roles of the N-terminal domain in the oligomeric state, heme binding, catalysis, and inhibition. Biochemistry. 45 (2006) 9894-9905. [49] P.J. Chefalo, J. Oh, M. Rafie-Kolpin, B. Kan, J.J. Chen, Heme-regulated eIF-2alpha kinase purifies as a hemoprotein. Eur. J. Biochem. 258 (1998) 820-830. [50] J.J. Berlanga, S. Herrero, C. de Haro, Characterization of the hemin-sensitive eukaryotic initiation factor 2alpha kinase from mouse nonerythroid cells. J. Biol. Chem. 273 (1998) 32340-32346. [51] S. Uma, B.G. Yun, R.L. Matts, The heme-regulated eukaryotic initiation factor 2alpha kinase. A potential regulatory target for control of protein synthesis by diffusible gases. J. Biol. Chem. 276 (2001) 14875-14883. [52] J. Igarashi, A. Sato, T. Kitagawa, I. Sagami, T. Shimizu, CO binding study of mouse heme-regulated eIF-2alpha kinase: kinetics and resonance Raman spectra. Biochim. Biophys. Acta. 1650 (2003) 99-104. 20

ACCEPTED MANUSCRIPT

IP

T

Legends Fig. 1. Suppression of the induced expression of HO-1 by the inhibition of heme biosynthesis. (A) The blockade of heme biosynthesis with SA decreased the expression of HO-1 in sulforaphane-treated HEK293T and HeLa cells. Cells were

SC R

treated with 5 M sulforaphane (SFN) plus/minus SA for 16h. After washing the cells twice with PBS, cell lysates were obtained. Cellular proteins were separated by SDS-PAGE, and blotted onto the PVDF membranes. Immunoblotting was performed with anti-HO-1, HO-2, and actin as the primary antibodies. (B) Effects of the inhibitor of FECH, N-MePP on the arsenite-induced expression of

MA

NU

HO-1. HEK cells were incubated with 1 M sodium arsenite plus/minus 10 M N-MePP for 16h. After cellular proteins had been analyzed by SDS-PAGE, immunoblotting was performed. (C) The knockdown of ALAS1 caused a decrease in the sulforaphane (SFN)- or sodium arsenite-induced expression of HO-1. Cells were transfected with scramble siRNA or ALAS1 siRNA and incubated for 48h.

D

The cells were then treated with 5 M sulforaphane or 5 M sodium arsenite for 5h. The expression of HO-1 was evaluated by immunoblotting.

TE

Fig. 2. Blockade of heme biosynthesis decreased HO-1 expression at the transcriptional level. (A) Cells were treated with the indicated chemicals for 4h.

CE P

Chemicals used were 5 M sulforaphane (SFN), 5 M sodium arsenite, 1 mM SA, 25 M hemin, 1 M bilirubin and 40 M CORM3. After RNA was isolated and cDNA was synthesized, real-time PCR was performed. Data are expressed as the

AC

average of triplicate experiments ± S.D. (*P<0.05 versus control; †P<0.05 versus the treatment with arsenite/sulforaphane). (B) The transcription activities of the E1 and E2 sites of MARE in the HO-1 gene. Cells were transfected with a luciferase reporter plasmid (tk-lucHO-E1 and tk-lucHO-E2) containing the E1 and E2 sites of the human HO-1 gene promoter. Cells were cultured with the indicated chemicals for 16h. Luciferase activity was measured and normalized to Renilla luciferase activity. Data are the average of 4 independent experiments ± S.D. (*P<0.05 versus control). Fig. 3. Involvement of Nrf2 and Bach1 in the suppression of the sulforaphane (SFN)-induced expression of HO-1 by SA. (A) Changes in Nrf2 and Bach1 levels. HEK cells were treated with 5 M sulforaphane (SFN) plus/minus 1 mM SA for 4h. Cellular proteins were analyzed by SDS-PAGE. Immunoblotting was performed with antibodies for Nrf2, p-Nrf2, Bach1, and actin. (B) Location of Nrf2 and Bach1 in nuclei. Cells treated as described above were fractionated into cytoplasmic and nuclear fractions. Each fraction was analyzed by SDS-PAGE. Imunoblotting was performed. (C) Immunofluorescence observations of Bach1. HEK 293T cells were 21

ACCEPTED MANUSCRIPT

transfected with pcDNA-flag-Bach1 and treated with 5 M sulforaphane (SFN) plus/minus 1 mM SA for 4h. Cells were fixed and then stained for Bach1 with

IP

T

anti-flag and for nuclei with DAP1. White bar; 10 m. (D) Binding of Nrf2 and Bach1 to the human HO-1 E1 and E2 site sites. ChIP assays on Nrf2 and Bach1

SC R

were performed with lysates from HEK293T cells treated with 5 M sulforaphane (SFN) plus/minus 1 mM SA for 4h. An immunoprecipitation reaction was performed with anti-Bach1 and anti-Nrf2 antibodies. Real-time PCR was performed to amplify the E1 (left) and E2 (right) sites containing MARE of the HO-1 gene. Data

NU

are represented as fold enrichment from the values obtained with no treatment (*P <0.05 versus no treatment). Fig. 4. Effects of CO on the suppression of sulforaphane (SFN)- or arsenite-induced HO-1 expression by SA. (A) Immunoblot analysis. HEK293T cells were treated

MA

with 1 M sodium arsenite (left) or 5 M sulforaphane (right) plus/minus 1 mM SA

TE

D

for 16h. A co-treatment with 1 M bilirubin or 40 M CORM3 was performed. Cellular proteins were analyzed by SDS-PAGE, and immunoblotting was performed with anti-HO-1 and actin. (B) Expression of Bach1. HEK293T cells were transfected with tk-luc HO-1E2 plus/minus pcDNA-flag Bach1 or pcDNA-flag Bach1CP1-6 and

AC

CE P

then treated with the indicated chemicals for 16h. The reporter activity of E2 was examined. Data are the average of 3 experiments ± S.D. *P<0.05 versus no treatment; †P<0.05 versus SFN treatment. (C) Knockdown of Nrf2. Cells were transfected with scramble siRNA or Nrf2 siRNA. The cells were also transfected with tk-luc-HO-1E2, cultured for 16h, and then treated as above. Reporter activity was measured. Data are the average of 3 experiments ± S.D. *P<0.05 versus no treatment in scramble siRNA-transfected cells. (D) Immunoblot analysis. The cells treated as above were incubated with 40 M CORM3 and 1 mM SA for 8h. Immunoblotting was performed. (E) Effect of metalloporphyrins on the E2 activity. The cells were transfected with tk-luc HO-1E2 plus pcDNA-flag Bach1 and then treated with the indicated metalloporphyrin for 16h. The reporter activity of E2 was examined. Data are the average of 4 experiments ± S.D. * P<0.05 versus with iCORM3. (F) Knockdown of Bach1. Cells were transfected with scramble siRNA or Bach1 siRNA and cultured for 30h. Cells were then transfected with tk-luc-HO-1E2 and treated as above. Reporter activity was measured. Data are the average of 3 experiments ± S.D. *P<0.05 versus scramble siRNA-transfected cells. (G) ROS production in cells. Cells were treated with the indicated chemicals plus/minus 2 mM NAC for 4h, and then with 10 M CMH2DCFDA for 20 min. The fluorescence in the cells was measured by fluorescence spectrophotometry. Data 22

ACCEPTED MANUSCRIPT

are the average of 4 experiments ± S.D. * P<0.05 versus with no treatment; †P<0.05 versus minus NAC.

IP

T

Fig. 5. Involvement of HRI on the cessation of HO-1 expression at the translational step. (A) Knockdown of HRI. HEK cells were transfected with scramble siRNA or

SC R

HRI siRNA, and cultured for 48h. Cells were then treated with 5 M sulforaphane (SFN) plus/minus 1 mM SA for 6h. A co-treatment with 40 M CORM3 was also performed. Cellular proteins were analyzed by SDS-PAGE. Immunoblotting was performed with antibodies for HO-1, HO-2, FECH, HRI, p-eIF2, eIF2 and actin. (B) Expression of HRI. The cells were transfected with mock DNA or pCMV-flag

NU

HRI and cultured for 16 h. The cells were treated with 40 M CORM3 or 20 M hemin for 6h. Immunoblotting was performed as above. (C) The effects of

AC

CE P

TE

D

MA

sulforaphane (5 M), CORM3 (40 M) and SA (1 mM) on the expression of HO-1 in HRI-expressing cells at 6h.

23

AC

CE P

TE

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

24

AC

CE P

TE

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

25

AC

CE P

TE

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

26

AC

CE P

TE

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

27

AC

CE P

TE

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

28

AC

CE P

TE

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

29

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

Conflict of interest The authors declare no competing financial interest.

30

AC

CE P

TE

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

Graphical abstract

31

ACCEPTED MANUSCRIPT

Highlights Blockade of heme biosynthesis cancels the stress-inducible expression of HO-1 The suppressed expression of HO-1 is regulated at transcription, mediated by Bach1

 

The suppression of HO-1 synthesis also occurs at translation, mediated by HRI CO enhances the expression of HO-1 at the transcriptional and translational levels

AC

CE P

TE

D

MA

NU

SC R

IP

T

 

32