Potential role of JAK2 in cerebral vasospasm after experimental subarachnoid hemorrhage

BR A I N R ES E A RC H 1 2 1 4 ( 2 00 8 ) 1 3 6 –14 4

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s

Research Report

Potential role of JAK2 in cerebral vasospasm after experimental subarachnoid hemorrhage Gang Chen a , Jiang Wu b , Caixia Sun b , Meng Qi a , Chunhua Hang a , Yi Gong b , Xiaodong Han b , Jixin Shi a,⁎ a

Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province, China b Jiangsu Key Laboratory of Molecular Medicine, School of Medicine, Nanjing University, Nanjing 210002, Jiangsu Province, China

A R T I C LE I N FO

AB S T R A C T

Article history:

The Janus kinase (JAK) proteins are key regulators for transducing signals from the cell

Accepted 31 March 2008

surface to the nucleus in response to cytokines to orchestrate the appropriate cellular

Available online 11 April 2008

response. Previous studies have demonstrated that JAK1 is activated in the basilar artery after subarachnoid hemorrhage (SAH), however it has not been investigated whether, and to

Keywords:

what degree, JAK2 is induced by SAH and also the role of JAK2 in the pathogenesis of cerebral

Cerebral vasospasm

vasospasm following SAH remains unknown. Experiment 1 aimed to investigate the time-

Subarachnoid hemorrhage

course of the JAK2 activation in the basilar artery after SAH. In Experiment 2, we chose the

JAK2

maximum time point of JAK2 activation and assessed the effect of AG490 (a specific JAK2

Apoptosis

inhibitor) on regulation of cerebral vasospasm and endothelial apoptosis. All SAH animals were subjected to injection of autologous blood into cisterna magna twice on day 0 and day 2. As a result, the elevated expression of activated JAK2 was detected in the basilar artery after SAH and peaked on day 3. After AG490 intracisternal administration, the vasospasm was markedly aggravated and the apoptosis index of endothelial cells was also significantly increased in the basilar arteries. Anti-apoptotic genes such as bcl-2 and bcl-xL were downregulated after the injections of AG490. Our results suggest that JAK2 is activated in the arterial wall after SAH, playing a beneficial role to vasospasm development, possibly through protecting endothelial cells and up-regulating anti-apoptotic genes. © 2008 Elsevier B.V. All rights reserved.

1.

Introduction

Cerebral vasospasm is the most common cause of disability and death in patients suffering from aneurysmal subarachnoid hemorrhage (SAH) (Treggiari-Venzi et al., 2001). Treatment of cerebral vasospasm has been considered as a major goal in the management of patients surviving SAH. However, the exact molecular mechanism of cerebral vasospasm still remains ob-

scure, which has hindered the development of effective and specific treatment paradigms for cerebral vasospasm. The Janus kinase (JAK) family of cytosolic tyrosine kinases, traditionally thought to be coupled to cytokine receptors such as those for the interleukins and interferons, has four members (JAK1, JAK2, JAK3 and TYK2) (Sandberg et al., 2004). In response to ligand binding, these JAK tyrosine kinases associate with, tyrosine-phosphorylate, and activate cytokine receptors. Once

⁎ Corresponding author. Fax: +86 25 84817581. E-mail address: [email protected] (J. Shi). 0006-8993/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2008.03.085

BR A I N R ES E A RC H 1 2 1 4 ( 2 00 8 ) 1 3 6 –1 44

Fig. 1 – Upper panel, Representative autoradiogram of JAK2 activation in basilar arteries. We observed JAK2 at 128 kDa, phospho-JAK2 (Tyr1007/1008) at 131 kDa and a loading control β-actin at 42 kDa. It shows that the phosphorylation of JAK2 protein increased after SAH and peaked on day 3. Bottom panel, Quantitative analysis of the Western blot results for JAK2 and phospho-JAK2. It shows that the levels of JAK2 activation in SAH day 3 and 5 groups were significantly higher than that in control. Bars represent the mean ± SD (n = 6, each group). ⁎⁎P < 0.01 compared with control group.

137

activated, JAKs tyrosine phosphorylate and activate other signaling molecules, including the signal transducers and activators of transcription (STAT) family of nuclear transcription factors after binding of STATs to the receptor (Sandberg et al., 2004). Thus, the JAK/STAT pathway is an important link between cell surface receptors and nuclear transcriptional events leading to cell growth. Clinical and experimental studies have shown the increased levels of cytokines in the basilar arterial walls and cerebrospinal fluid (CSF) after SAH (Hendryk et al., 2004; Zhou et al., 2007a). Afterwards, the data from Osuka et al. (2006) suggested that SAH produced the proinflammatory cytokine IL-6 in the CSF, which induced the JAK1 phosphorylation in the basilar artery following experimental SAH. However till now, no study was found in the literature to investigate the time-course and role of JAK2 activation in the pathogenesis of cerebral vasospasm. Endothelial apoptosis may trigger, aggravate, and maintain cerebral vasospasm, either in the major arteries (Zubkov et al., 2002) or in the penetrating arterioles (Zubkov et al., 2000). Previous research by Negoro et al. (2000) indicated that the JAK2 was activated in myocardium after acute myocardial infarction and administration of JAK2 inhibitor resulted in a significant increase in apoptotic cells of myocardium. Then they concluded that JAK2 played a pivotal role in cytoprotective and anti-apoptotic signaling in acute myocardial infarction. However, none of the previous studies focused on the effect of JAK2 inhibitor on the endothelial apoptosis following SAH. The aim of the current study was to evaluate the changes of basilar arterial JAK2 activation following SAH and determine the potential role of JAK2

Fig. 2 – Immunohistochemical study of JAK2 and phospho-JAK2 on cross sections of basilar arteries. Upper panel, A few phosphorylated JAK2 positive cells were observed in the control group, which indicates the constitutional activation of JAK2 in the normal basilar arteries of rabbits. Increased phospho-JAK2 positive cells could be found in the basilar arteries of the rabbits in the SAH day 3 and day 5 groups. Bottom panel, Quantitative analysis shows the low ratio of JAK2/phospho-JAK2 in the control group. In contrast, the level of JAK2 activation was increased in the day 3 and day 5 groups. Significant differences were both found between the day 3 or day 5 groups, and the control group. Bars represent the mean±SD (n =6, each group). ⁎P<0.05 compared with control group.

138

BR A I N R ES E A RC H 1 2 1 4 ( 2 00 8 ) 1 3 6 –14 4

in the development of cerebral vasospasm. We hypothesized that the JAK2 pathway activation attenuated the development of cerebral vasospasm through protecting endothelial cells from apoptosis in this rabbit SAH model.

2.

Results

2.1.

General observation

No significant changes in body weight, mean arterial blood pressure, temperature, or injected arterial blood gas data were detected in any of the experimental groups (data not shown). The rabbits all survived from the procedure of induction of experimental SAH.

2.2. Western blot analysis for detecting JAK2 activation after SAH Western blot analysis showed the low level of JAK2 phosphorylation in the control group (Fig. 1). The ratio of the JAK2 phosphorylation was significantly increased after SAH and peaked on day 3 (Fig. 1). There is no statistically significant difference between the SAH day 7 group and the control group (Fig. 1).

2.3. Immunohistochemistry for evaluating JAK2 activation following SAH The immunohistochemical assay showed lower phosphoJAK2 immunoreactivity in the basilar arterial walls in the control group (Fig. 2). Compared to the control group, the level of JAK2 phosphorylation was significantly up-regulated in the endothelial cells, smooth muscle cells, and adventitial cells on days 3 and 5 following SAH (P < 0.05). In the SAH day 7 group, the ratio of JAK2/phospho-JAK2 was not remarkably different as compared with that of the control group (Fig. 2).

2.4. Effects of JAK2 inhibitor on JAK2 and STAT3 phosphorylation in SAH basilar arteries To determine the influence of JAK2 inhibitor (AG490) on JAK2 and STAT3 activation in the basilar arteries post SAH, Western blot was performed to detect the changes of JAK2 and STAT3 phosphorylation ratio as described in Experimental procedures. Fig. 3 showed low level of JAK2 and STAT3 phosphorylation in the control group. On day 3 after SAH, the activated levels of JAK2 and STAT3 were significantly increased in the SAH group and the SAH+ DMSO group (P < 0.01) (Fig. 3). There was no statistically significant difference between the SAH group and the SAH+ DMSO group (P > 0.05) (Fig. 3). After AG 490 injections, the increased levels of JAK2 and STAT3 activation were markedly suppressed in animals of the SAH + AG490 group (P < 0.01) (Fig. 3).

2.5. JAK2 inhibitor administration aggravated cerebral vasospasm after SAH As shown in Fig. 4, there was a significant difference in the cross-sectional area of basilar artery among all the groups on day 3 following SAH (P < 0.01). A significant difference was detected between the SAH group (258187.59± 8311.36 μm2) and the

Fig. 3 – Expressions of JAK2, phospho-JAK2 (Tyr1007/1008), STAT3, and phospho-STAT3 (Tyr705) in the basilar arteries in control group (n = 6), SAH group (n = 6), SAH + DMSO group (n = 6), and SAH + AG490 group (n = 6). Upper panel, Representative autoradiogram of the proteins expression following SAH by Western blot. We detected JAK2 at 128 kDa, phospho-JAK2 at 131 kDa, STAT3 at 92 kDa, phospho-STAT3 at 86 kDa and the loading control β-actin at 42 kDa. Bottom panel, Quantitative analysis of the Western blot results for detecting the activation of JAK2 and STAT3. The levels of JAK2 and STAT3 activation were significantly increased in the animals of SAH and SAH + DMSO groups compared with the control group (P < 0.01). The increased levels of JAK2 and STAT3 activation were markedly suppressed in SAH + AG490 group (P < 0.01). Bars represent the mean± SD. ⁎⁎P < 0.01 compared with control group; nsP > 0.05 compared with SAH group; ##P < 0.01 compared with SAH + DMSO group.

control group (412254.68± 33506.39 μm2) (P < 0.01) (Fig. 4). There was also a significant difference in the basilar arterial crosssectional area between the SAH + AG490 group (235010.57± 4423.46 μm2) and SAH+ DMSO group (259991.51 ± 5022.18 μm2) (P < 0.05) (Fig. 4). No significant difference was seen between the SAH group and the SAH+ DMSO group (P > 0.05).

2.6. Endothelial apoptosis increased in JAK2 inhibitor-treated SAH basilar arteries Few TUNEL-positive apoptotic endothelial cells were found in the control group rabbit basilar arteries (Fig. 5). In the SAH group and the SAH + DMSO group, the apoptotic index in cerebral endothelial cells was found to be significantly increased compared with those in the control animals (P < 0.01) (Fig. 5). In the SAH + AG490 group, when compared with that in the SAH or SAH + DMSO group, the apoptotic index in the basilar arteries

BR A I N R ES E A RC H 1 2 1 4 ( 2 00 8 ) 1 3 6 –1 44

139

Fig. 4 – Changes in the cross-sectional area of basilar arteries in the experimental SAH model. (A–D) Representative images of cross-sectional areas of the basilar arteries of the control rabbits or rabbits subjected to SAH alone or SAH plus intracisternal injection with DMSO or AG490. Severe vasospasm could be detected in the SAH group, which was aggravated in the SAH + AG490 group. (A) The control group; (B) the SAH group; (C) the SAH + DMSO group; and (D) the SAH + AG490 group. Bottom panel: Histogram of the average cross-sectional area of the basilar arteries from different groups. There is a significant difference in the basilar artery cross-sectional area between the SAH and control groups. The basilar artery cross-sectional area was significantly decreased in the SAH + AG490 group compared with the SAH or SAH + DMSO groups. Results are represented as means ± SD of six rabbits in each group. ⁎⁎P < 0.01 versus control group; nsP > 0.05 versus SAH group; #P < 0.05 versus SAH + DMSO group.

studied was significantly increased (P < 0.01) (Fig. 5). The result showed that AG490 administration following SAH could lead to more cell apoptosis in the endothelium of the basilar arteries.

2.7. Influence of JAK2 inhibitor on the mRNA expression of bcl-2 and bcl-xL in the basilar arteries The mRNA levels of two anti-apoptotic genes, bcl-2 and bcl-xL, were detected by quantitative real-time polymerase chain reaction. Both bcl-2 and bcl-xL mRNA expressed at a high level in the rabbit basilar artery of the control group. The mRNA expression of bcl-2 and bcl-xL in the artery was significantly

decreased in the SAH group as compared with that of the control group (P < 0.01). The both mRNA expressions had no significant difference between the SAH group and the SAH + DMSO group (P > 0.05). The levels of bcl-2 and bcl-xL mRNA in the SAH + AG490 group was significantly lower than those of the SAH + DMSO group (P < 0.01) (Fig. 6).

3.

Discussion

The main findings of this study are as follows: (1) JAK2 was activated in the basilar arterial wall during cerebral vasospasm

140

BR A I N R ES E A RC H 1 2 1 4 ( 2 00 8 ) 1 3 6 –14 4

Fig. 5 – TUNEL immunohistochemistry staining of the basilar arteries in control group (n = 6), SAH group (n = 6), SAH + DMSO group (n = 6), and SAH + AG490 group (n = 6). (A) Control group rabbits showing few TUNEL apoptotic endothelial cells; (B) SAH group rabbits showing increased TUNEL apoptotic endothelial cells with intense nuclear stained as brown. (C) In the SAH + DMSO group, it can also be seen endothelial apoptosis in the basilar arteries. (D) SAH + AG490 group rabbits showing more TUNEL apoptotic endothelial cells than the SAH + DMSO group. Bottom panel: Administration of AG490 significantly increased the apoptotic index in basilar arteries following SAH. Bars represent the mean ± SD. ⁎⁎P < 0.01 versus control group; nsP > 0.05 versus SAH group; ##P < 0.05 versus SAH + DMSO group.

after SAH in rabbits; (2) the time-course study showed the JAK2 activation peaked on day 3 and recovered on day 7 following SAH; (3) SAH-induced increases of JAK2 and STAT3 activation could be suppressed by intracisternal administration of AG490, which could down-regulate the mRNA expressions of bcl-2 and bcl-xL in this SAH model; (4) the inhibitor of JAK2, AG490, could aggravate the endothelial apoptosis and vasospasm of the basilar arteries. These findings suggest that activation of JAK2 pathway may play a potential role to attenuate the development of cerebral vasospasm in the rabbit SAH model. Moreover, the possible mechanism of this beneficial influence may relate to

the anti-apoptotic effects of activated JAK2 on the endothelium of cerebral arteries following experimental SAH (Fig. 7). Accumulating evidence has demonstrated that the JAK/ STAT signaling pathway plays important roles in the pathogenesis of different diseases in the central nervous system (CNS), such as spinal cord injury, cerebral ischemia, and subarachnoid hemorrhage (Yamauchi et al., 2006; Justicia et al., 2000; Osuka et al., 2006). Four JAKs (JAK1, JAK2, JAK3, TYK2) have been identified, which are required for STATs phosphorylation, and associated with membrane receptors (e.g. cytokine receptors), and play a critical role in the rapid transduction of signals from the

BR A I N R ES E A RC H 1 2 1 4 ( 2 00 8 ) 1 3 6 –1 44

Fig. 6 – The bcl-2 and bcl-xL mRNA expression in the basilar arteries in control group (n = 6), SAH group (n = 6), SAH + DMSO group (n = 6), and SAH + AG490 group (n = 6). SAH could induce a marked decrease of bcl-2 and bcl-xL mRNA expression in the rabbit basilar arteries compared with the control group. After AG490 administration, the bcl-2 and bcl-xL expression was significantly down-regulated as compared with the SAH or SAH + DMSO group. ⁎⁎P < 0.01 versus control group, nsP > 0.05 versus SAH group, ##P < 0.01 versus SAH + DMSO group.

cell surface to the nucleus. The JAK-family members existed in the mature nervous system are JAK1 and JAK2, and the level of JAK3 is very low, while TYK2 was not detected (Cattaneo et al., 1999). Osuka et al. (2006) have reported that IL-6 produced by SAH in the CSF could activate the JAK1 and STAT3 in the rat basilar arteries; however their study did not measure the changes of the basilar artery lumen's cross-sectional areas after JAK1/ STAT3 activation following SAH. At the same time till now, no study was found in the literature to investigate whether the JAK2 was activated in the cerebral artery after SAH. In the current research, we found that activation of JAK2 occurred at rabbit SAH basilar arteries. The JAK2 activation was time dependent, showing the maximal activation occurred on day 3 post SAH. Otherwise, as mentioned in the Introduction section, some endogenous stimuli of JAK2, such as IL-6, IL-1, and IL-8, were reported to have been found or elevated in the CSF or cerebral artery after SAH (Mathiesen et al., 1993; Aihara et al., 2001). But the main JAK2 ligands and the whole mechanism related to JAK2 activation call for further research in vitro. Several studies have demonstrated that JAK2 mediated apoptosis in vivo and vitro (Sandberg and Sayeski, 2004). As revealed by Negoro et al. (2000), administration of the JAK2 inhibitor AG490 suppressed the phosphorylation of STAT3 and resulted in increased caspase-3 activity and Bax expression, concomitant with an increase in TUNEL-positive myocytes, suggesting an anti-apoptotic role of JAK2 signaling. Another research indicated that the JAK-STAT pathway participates in the modulation of expression of Bcl-2 and Bcl-x proteins (Stephanou et al., 2000). In the research regarding apoptosis and STAT3, the early studies clearly established that STAT3 was an anti-apoptotic transcription factor and identified several target genes, including bcl-2, bcl-xL, and survivin, and inhibited p53 and caspase expression (Shen et al., 2001; Haga et al., 2003; Niu et al., 2005). In the present study, we analyzed the degree of endothelial apoptosis in the vessel wall through the assessment of TUNEL-

141

positive cells and evaluated the mRNA expression of bcl-2 and bcl-xL by quantitative real-time polymerase chain reaction. Our data demonstrated that treatment with JAK2 inhibitor reduced the phosphorylation of STAT3, down-regulated the expression of bcl-2 and bcl-xL in the basilar artery, and resulted in a significant increase of the endothelial apoptosis after SAH. Therefore, our results suggested the possibility of an anti-apoptotic function of JAK2-dependent signaling in SAH cerebral arteries. Cell death, especially apoptosis after SAH, has been documented in neurons (Matz et al., 2000), smooth muscle (Ogihara et al., 2000), and endothelial cells (Meguro et al., 2001). Apoptotic endothelial cell death may lead to destruction of the blood-brain barrier and expose smooth muscle cells to vasoconstrictors in the blood flow. Damage to endothelial cells decreases the generation and release of vasodilators such as nitric oxide and prostacyclin from these cells (Pluta et al., 1997). Endothelial apoptosis has also been associated with deencryption of tissue factor activity that may lead to enhanced tissue factor procoagulant activity (Bombeli et al., 1997). Dysfunction of cerebral endothelial cells has been demonstrated and is believed to contribute to the pathogenesis of cerebral vasospasm (Macdonald et al., 1991). Endothelial cell death and detachment of the endothelium promote thrombus formation and trigger cell migration and proliferation (Clower et al., 1994; Borel et al., 2003). Previous studies have reported that varieties of apoptotic inhibitors could reduce cerebral vasospasm in dog SAH model (Zhou et al., 2004, 2005). In the present study, JAK2 inhibitor increased endothelial apoptosis in the basilar artery and aggravated the severity of vasospasm occurring on day 3 post SAH. A possible mechanism for this relates to the cytoprotective effects of JAK2 activation on the endothelial cells, which may prevent smooth muscle cell proliferation and vasoconstriction (Santhanam et al., 2005). In summary, to the best of our knowledge, this present study is the first one to demonstrate the elevated activation of JAK2 in the arterial wall in the experimental SAH model, which suggests that JAK2 activation and signaling could participate in the pathogenesis of cerebral vasospasm induced by SAH. Inhibition of JAK2 activation in this SAH model resulted in augmentation of endothelial cell apoptosis and the degree of

Fig. 7 – Scheme of JAK2 pathway mediating anti-apoptotic signals and alleviating cerebral vasospasm.

142

BR A I N R ES E A RC H 1 2 1 4 ( 2 00 8 ) 1 3 6 –14 4

Table 1 – PCR primer sequences Target gene bcl-2 bcl-xl GAPDH

Sense primer (5′ to 3′)

Antisense primer (5′ to 3′)

CTACGAGTGGGATACTGGAGATG CAGGCTGGAAGGAGAAGATG CCCAGGGACAGCATATCAGA GCTCCAGGTGGTCATTCAGG CCGCCCAGAACATCATCCCT GCACTGTTGAAGTCGCAGGAGA

cerebral vasospasm following SAH. Moreover, the mRNA expression of the anti-apoptotic genes, bcl-2 and bcl-xL, were down-regulated by administration of JAK2 inhibitor. So the JAK2-dependent pathway activation may play a potential role for alleviating the cerebral vasospasm, which will provide novel ideas for pursuing therapeutic agents for SAH-induced cerebral vasospasm.

4.

Experimental procedures

4.1.

Animals

The animal use and care protocols, including all operation procedures, were approved by the Animal Care and Use Committee of Nanjing University and conformed to the Guide for the Care and Use of Laboratory Animals by the National Institute of Health. Ninety-six adult male New Zealand White (NZW) rabbits weighing from 2.2 to 2.8 kg were purchased from the Animal Center of the Chinese Academy of Sciences (Shanghai, China). They were acclimated in a humidified room and maintained on the standard pellet diet at the Animal Center of Jinling Hospital for 10 days before the experiment. The temperature in both the feeding room and the operation room was maintained at about 25 °C.

4.2.

Two-hemorrhage rabbit model

Experimental SAH was produced according to our previous study (Zhou et al., 2007b). The rabbits were anesthetized with an intramuscular injection of a mixture of ketamine (25 mg/kg) and droperidol (1.0 mg/kg) on day 0. Under spontaneous breathing, a 23-gauge butterfly needle was inserted percutaneously into the cisterna magna. After withdrawal of 1.5 ml CSF, the same amount of non-heparinized fresh autologous auricular arterial blood was slowly injected into the cisterna magna for 1 min under aseptic technique. Then animals were kept in a 30° headdown position for 30 min. After recovery from anesthesia, they were returned to the feeding room. Forty-eight hours after the first SAH, a second one was produced in the same manner as the first. In control animals, the same technique was applied with injection of sterile saline instead of blood.

4.3.

Experimental design

In Experiment 1, forty-eight rabbits were assigned randomly to 4 groups: Control group, SAH day 3, day 5, and day 7 groups. The animals in day 3, day 5, and day 7 groups were subjected to experimental SAH twice on days 0 and 2 and were killed on days 3, 5, and 7, respectively (n = 12 for each group). The groups in Experiment 2 consisted of the Control group (n = 12), SAH group (n = 12), SAH+ DMSO group (n = 12), and SAH +

Annealing temperature (°C)

Number of cycles

Size (bp)

59 59 59

40 40 40

80 194 262

AG490 group (n = 12). The specific JAK2 inhibitor, AG490 (SigmaAldrich Inc., St. Louis, MO, USA), was dissolved in DMSO (dimethylsulfoxide, Sigma-Aldrich Inc., St. Louis, MO, USA) and the proportion was 2 mg (AG490):1 ml (DMSO). In the animals of the SAH + AG490 group, AG490 (0.25 mg/kg) was injected into cisterna magna as the blood injection manner every 24 h from 30 min before first blood injection to the last day. According to the results of our preliminary experiments, this was the maximum dose of safety and effectiveness for the animals. Rabbits of SAH+ DMSO group received equal volumes (0.125 ml/kg) of DMSO at corresponding time points. All the rabbits in Experiment 2 were killed on day 3, which was the time point of the highest JAK2 activation according to the result of Experiment 1. Six rabbits in each group were sacrificed with the fixation– perfusion method. The basilar arteries were taken for hematoxylin and eosin (H&E), immunohistochemical staining and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) method. The other six rabbits in each group were exsanguinated and decollated. The artery was removed and rinsed in 0.9% normal saline (4 °C) several times to wash away blood and blood clot. And then the artery was frozen in liquid nitrogen immediately for Western blot analysis and quantitative real-time polymerase chain reaction.

4.4.

Perfusion–fixation

The rabbits scheduled for death were anesthetized with an intramuscular injection of a mixture of ketamine (40 mg/kg) and droperidol (2.5 mg/kg). The animals were then intubated endotracheally with a 3.5 mm diameter tracheal tube and mechanically ventilated with a rodent ventilator (SGC, China). Perfusion–fixation was then performed. The thorax was opened with a cannula placed in the left ventricle, the descending thoracic aorta clamped, and the right atrium open. Perfusion was begun with 500 ml of physiological phosphate buffer solution (PBS, pH 7.4) at 37 °C, followed by 500 ml of 10% buffered formaldehyde under a perfusion pressure of 120 cm H2O. After perfusion–fixation, the whole brain with the basilar artery was removed and immersed in the same fixative solution.

4.5.

Immunohistochemical study

In Experiment 1, immunohistochemistry on formalin-fixed paraffin-embedded sections was performed to determine the immunoreactivity of JAK2 and phospho-JAK2. Sections were deparaffinized and rehydrated in graded concentrations of ethanol to distilled water. Endogenous peroxidase activity was blocked with 3% H2O2 for 5 min, followed by a brief rinse in distilled water and a 15 min wash in PBS. Sections were placed in 10 mmol/l citrate buffer (pH 6.0), and heated in microwave oven at 95 °C for 30 min. Sections were cooled at room temperature for 20 min and rinsed in PBS. Non-specific protein binding was

BR A I N R ES E A RC H 1 2 1 4 ( 2 00 8 ) 1 3 6 –1 44

blocked by 40 min incubation in 5% horse serum. Sections were incubated with primary antibodies (anti-JAK2 and anti-phospho-JAK2 at Tyr1007/1008, both diluted 1:200, respectively, from Santa Cruz Biotechnology, Inc., California, USA) for 1 h at room temperature, followed by a 15 min wash in PBS. Sections were incubated with horseradish peroxidase (HRP)-conjugated IgG (1:500 dilution, Santa Cruz Biotechnology, Inc., California, USA) for 60 min at room temperature. DAB was used as chromogen and counterstaining was done with hematoxylin. Sections incubated in the absence of primary antibody were used as negative controls. Microscopy of the immunohistochemically stained tissue sections was performed by an experienced pathologist blinded to the experimental condition. Evaluation of sections was, therefore undertaken by assessing the intensity of staining (4 grades). “1” indicates very low density of positive cells; “2” indicates a moderate density of positive cells; “3” indicates the higher, but not maximal density of positive cells; and “4” indicates the highest density of positive cells.

4.6.

Western blot analysis

The frozen basilar arteries were mechanically lysed in 20 mM Tris, pH 7.6, which contains 0.2% SDS, 1% Triton X-100, 1% deoxycholate, 1 mM phenylmethylsulphonyl fluoride (PMSF), and 0.11 IU/ml aprotinin (all purchased from Sigma-Aldrich, Inc., St. Luis, MO, USA). Lysates were centrifuged at 12,000 ×g for 20 min at 4 °C. The protein concentration was estimated by the Bradford method using the Nanjing Jiancheng (NJJC) protein assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The samples (60 μg per lane) were separated by 8% SDSPAGE and electro-transferred onto a polyvinylidene-difluoride (PVDF) membrane (Bio-Rad Lab, Hercules, CA, USA). The membrane was blocked with 5% skimmed milk for 2 h at room temperature, incubated overnight at 4 °C with primary antibodies directed against JAK2, phospho-JAK2 at Tyr1007/1008, STAT3, and phospho-STAT3 at Tyr705 (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA) at the dilutions of 1:200, 1:200, 1:100, and 1:150, respectively. The β-actin (diluted in 1:6000, SigmaAldrich, Inc., St. Luis, MO, USA) was used as a loading control. After the membrane was washed for 10 min each for six times in PBS +Tween 20 (PBST), it was incubated in the appropriate HRP-conjugated secondary antibody (diluted 1:400 in PBST) for 2 h. The blotted protein bands were visualized by enhanced chemiluminescence (ECL) Western blot detection reagents (Amersham, Arlington Heights, IL, USA) and were exposed to X-ray film. Developed films were digitized using an Epson Perfection 2480 scanner (Seiko Corp, Nagano, Japan). Optical densities were obtained using Glyko Bandscan software (Glyko, Novato, CA, USA). The tissue of six animals was used for Western blot analysis at each time point. All experiments have been repeated at least three times.

4.7.

Measurement of blood vessel cross-sectional area

The degree of cerebral vasospasm was evaluated by the measurement of basilar artery lumen's cross-sectional areas. The formalin-fixed and paraffin-embedded basilar artery sections (4 μm in thickness) were deparaffinized, hydrated, washed and stained with hematoxylin and eosin. Then micrographs of the basilar arteries were put into the computer. Cross-sectional

143

areas and wall thicknesses of blood vessels were determined by an investigator without knowing the group setting, using the High Definition Medical Image Analysis Program (HMIAP2000, developed by Tongji Medical University, China). The areas were calculated by measuring the perimeter of the actual vessel lumen and then calculating the area of an equivalent circle (area= π r2, where r = radius) based on the calculated equivalent r value from the perimeter measurement (r = perimeter/2π), thus correcting for vessel deformation and offtransverse sections. For each vessel, three sequential sections (midpoint of the proximal, the middle and the distal) were taken, measured and averaged.

4.8.

TUNEL staining

The formalin-fixed tissues were embedded in paraffin and sectioned at 4 μm thickness with a microtome. The sections were detected for apoptotic cells by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) method. TUNEL: in situ cell death detection Kit POD (ISCDD, Boehringer Mannheim, Germany) was used. The procedures were according to protocol of the kit and the other references. Briefly, sections were deparaffinized, rehydrated, and washed with distilled water (DW). The tissues were digested with 20 g/ml proteinase K (Boehringer Mannheim, Mannheim, Germany) at room temperature for 15 min. Endogenous peroxidase activity was blocked by incubation in 0.3% hydrogen peroxide/methanol in PBS at 37 °C for 30 min. The sections then were incubated with terminal deoxynucleotidyl transferase at 37 °C for 60 min to add the dioxigenin-conjugated dUTP to the 3′-OH ends of fragmented DNA. Anti-digoxigenin antibody peroxidase was applied to the sections to detect the labeled nucleotides. The sections were stained with DAB and counterstained slightly with hematoxylin. The positive cells were identified, counted and analyzed under the light microscope by an investigator blinded to the grouping. The apoptotic index of the endothelium was the average number of positive cells per 100 endothelial cells. For each vessel, three sequential sections (midpoint of the proximal, the middle and the distal) were taken, measured and averaged.

4.9.

Quantitative real-time PCR

The levels of bcl-2 and bcl-xL mRNA expression were determined by quantitative real-time polymerase chain reaction (PCR). Total cellular RNA was isolated from sample brain using Trizol Reagents (Invitrogen Life Technologies, Carlsbad, CA, USA) as per the manufacturer's direction. RNA quality was insured by gel visualization and spectrophotometric analysis (OD260/280). The quantity of RNA was measured using the OD260. RNA was transcribed to cDNA using MMLV Reverse Transcriptase (Promega, Madison, WI, USA) and oligo dT primers. The primers were synthesized by Kangcheng Biotechnology (Shanghai, China) and were shown in Table 1. Quantitative real-time polymerase chain reaction (PCR) analysis was performed by using the Rotor-Gene™ 3000 real-time DNA analysis system (Corbett Research, Sydney, Australia), applying realtime SYBR Green PCR technology. The reaction mixtures contained diluted cDNA, SYBR Green I Nucleic Acid Stain (Invitrogen Life Technologies, Carlsbad, CA, USA), 20 μM of each genespecific primer and nuclease-free water to a final volume of

144

BR A I N R ES E A RC H 1 2 1 4 ( 2 00 8 ) 1 3 6 –14 4

25 μl. Test cDNA results were normalized to glyceraldehyde-3phosphate dehydrogenase (GAPDH) measured on the same plate. All samples were analyzed in triplicate.

4.10.

Statistical analysis

All data were presented as mean ± SD. SPSS 12.0 was used for statistical analysis of the data. All data were subjected to oneway ANOVA. Differences between experimental groups were determined by the Fisher's LSD post-test. Statistical significance was inferred at P < 0.05.

Acknowledgments We thank Dr. Bo Wu and Dr. Geng-bao Feng for their technical assistance. This work was partially supported by grants from the China Scholarship Council (CSC).

REFERENCES

Aihara, Y., Kasuya, H., Onda, H., Hori, T., Takeda, J., 2001. Quantitative analysis of gene expressions related to inflammation in canine spastic artery after subarachnoid hemorrhage. Stroke 32, 212–217. Bombeli, T., Karsan, A., Tait, J.F., Harlan, J.M., 1997. Apoptotic vascular endothelial cells become procoagulant. Blood 89, 2429–2442. Borel, C.O., McKee, A., Parra, A., Haglund, M.M., Solan, A., Prabhakar, V., Sheng, H., Warner, D.S., Niklason, L., 2003. Possible role for vascular cell proliferation in cerebral vasospasm after subarachnoid hemorrhage. Stroke 34, 427–433. Cattaneo, E., Conti, L., De-Fraja, C., 1999. Signalling through the JAK-STAT pathway in the developing brain. Trends Neurosci. 22, 365–369. Clower, B.R., Yamamoto, Y., Cain, L., Haines, D.E., Smith, R.R., 1994. Endothelial injury following experimental subarachnoid hemorrhage in rats: effects on brain blood flow. Anat. Rec. 240, 104–114. Haga, S., Terui, K., Zhang, H.Q., Enosawa, S., Ogawa, W., Inoue, H., Okuyama, T., Takeda, K., Akira, S., Ogino, T., Irani, K., Ozaki, M., 2003. Stat3 protects against Fas-induced liver injury by redox-dependent and -independent mechanisms. J. Clin. Invest. 112, 989–998. Hendryk, S., Jarzab, B., Josko, J., 2004. Increase of the IL-1 beta and IL-6 levels in CSF in patients with vasospasm following aneurysmal SAH. Neuro Endocrinol. Lett. 25, 141–147. Justicia, C., Gabriel, C., Planas, A.M., 2000. Activation of the JAK/STAT pathway following transient focal cerebral ischemia: signaling through Jak1 and Stat3 in astrocytes Glia 30, 253–270. Macdonald, R.L., Weir, B.K., Runzer, T.D., Grace, M.G., Findlay, J.M., Saito, K., Cook, D.A., Mielke, B.W., Kanamaru, K., 1991. Etiology of cerebral vasospasm in primates. J. Neurosurg. 75, 415–424. Mathiesen, T., Andersson, B., Loftenius, A., von Holst, H., 1993. Increased interleukin-6 levels in cerebrospinal fluid following subarachnoid hemorrhage. J. Neurosurg. 78, 562–567. Matz, P.G., Fujimura, M., Chan, P.H., 2000. Subarachnoid hemolysate produces DNA fragmentation in a pattern similar to apoptosis in mouse brain. Brain Res. 858, 312–319. Meguro, T., Chen, B., Lancon, J., Zhang, J.H., 2001. Oxyhemoglobin induces caspase-mediated cell death in cerebral endothelial cells. J. Neurochem. 77, 1128–1135.

Negoro, S., Kunisada, K., Tone, E., Funamoto, M., Oh, H., Kishimoto, T., Yamauchi-Takihara, K., 2000. Activation of JAK/STAT pathway transduces cytoprotective signal in rat acute myocardial infarction. Cardiovasc. Res. 47, 797–805. Niu, G., Wright, K.L., Ma, Y., Wright, G.M., Huang, M., Irby, R., Briggs, J., Karras, J., Cress, W.D., Pardoll, D., Jove, R., Chen, J., Yu, H., 2005. Role of Stat3 in regulating p53 expression and function. Mol. Cell. Biol. 25, 7432–7440. Ogihara, K., Zubkov, A.Y., Parent, A.D., Zhang, J.H., 2000. Oxyhemoglobin produces necrosis in cultured smooth muscle cells. Acta Neurochir., Suppl. 76, 507–510. Osuka, K., Watanabe, Y., Yamauchi, K., Nakazawa, A., Usuda, N., Tokuda, M., Yoshida, J., 2006. Activation of the JAK-STAT signaling pathway in the rat basilar artery after subarachnoid hemorrhage. Brain Res. 1072, 1–7. Pluta, R.M., Oldfield, E.H., Boock, R.J., 1997. Reversal and prevention of cerebral vasospasm by intracarotid infusions of nitric oxide donors in a primate model of subarachnoid hemorrhage. J. Neurosurg. 87, 746–751. Sandberg, E.M., Sayeski, P.P., 2004. Jak2 tyrosine kinase mediates oxidative stress-induced apoptosis in vascular smooth muscle cells. J. Biol. Chem. 279, 34547–34552. Sandberg, E.M., Wallace, T.A., Godeny, M.D., Vonderlinden, D., Sayeski, P.P., 2004. Jak2 tyrosine kinase: a true jak of all trades? Cell Biochem. Biophys. 41, 207–232. Santhanam, A.V., Smith, L.A., Akiyama, M., Rosales, A.G., Bailey, K.R., Katusic, Z.S., 2005. Role of endothelial NO synthase phosphorylation in cerebrovascular protective effect of recombinant erythropoietin during subarachnoid hemorrhage-induced cerebral vasospasm. Stroke 36, 2731–2737. Shen, Y., Devgan, G., Darnell, Bromberg, J.F., 2001. Constitutively activated Stat3 protects fibroblasts from serum withdrawal and UV-induced apoptosis and antagonizes the proapoptotic effects of activated Stat1. Proc. Natl. Acad. Sci. U. S. A. 98, 1543–1548. Stephanou, A., Brar, B.K., Knight, R.A., Latchman, D.S., 2000. Opposing actions of STAT-1 and STAT-3 on the Bcl-2 and Bcl-x promoters. Cell Death Differ. 7, 329–330. Treggiari-Venzi, M.M., Suter, P.M., Romand, J.A., 2001. Review of medical prevention of vasospasm after aneurysmal subarachnoid hemorrhage: a problem of neurointensive care. Neurosurgery 48, 249–261. Yamauchi, K., Osuka, K., Takayasu, M., Usuda, N., Nakazawa, A., Nakahara, N., Yoshida, M., Aoshima, C., Hara, M., Yoshida, J., 2006. Activation of JAK/STAT signalling in neurons following spinal cord injury in mice. J. Neurochem. 96, 1060–1070. Zhou, C., Yamaguchi, M., Kusaka, G., Schonholz, C., Nanda, A., Zhang, J.H., 2004. Caspase inhibitors prevent endothelial apoptosis and cerebral vasospasm in dog model of experimental subarachnoid hemorrhage. J. Cereb. Blood Flow Metab. 24, 419–431. Zhou, C., Yamaguchi, M., Colohan, A.R., Zhang, J.H., 2005. Role of p53 and apoptosis in cerebral vasospasm after experimental subarachnoid hemorrhage. J. Cereb. Blood Flow Metab. 25, 572–582. Zhou, M.L., Shi, J.X., Hang, C.H., Cheng, H.L., Qi, X.P., Mao, L., Chen, K.F., Yin, H.X., 2007a. Potential contribution of nuclear factor-kappaB to cerebral vasospasm after experimental subarachnoid hemorrhage in rabbits. J. Cereb. Blood Flow Metab. 27, 1583–1592. Zhou, M.L., Wu, W., Ding, Y.S., Zhang, F.F., Hang, C.H., Wang, H.D., Cheng, H.L., Yin, H.X., Shi, J.X., 2007b. Expression of Toll-like receptor 4 in the basilar artery after experimental subarachnoid hemorrhage in rabbits: a preliminary study. Brain Res. 1173, 110–116. Zubkov, A.Y., Tibbs, R.E., Aoki, K., Zhang, J.H., 2000. Morphological changes of cerebral penetrating arteries in a canine double hemorrhage model. Surg. Neurol. 54, 212–219. Zubkov, A.Y., Tibbs, R.E., Clower, B., Ogihara, K., Aoki, K., Zhang, J.H., 2002. Morphological changes of cerebral arteries in a canine double hemorrhage model. Neurosci. Lett. 326, 137–141.