PPEF: A bisbenzimdazole potent antimicrobial agent interacts at acidic triad of catalytic domain of E. coli topoisomerase IA

BBA - General Subjects 1863 (2019) 1524–1535

Contents lists available at ScienceDirect

BBA - General Subjects journal homepage: www.elsevier.com/locate/bbagen

PPEF: A bisbenzimdazole potent antimicrobial agent interacts at acidic triad of catalytic domain of E. coli topoisomerase IA Raja Singha,1, Stuti Pandeyb,1, Souvik Sura, Vibha Tandona, a b

T

⁎

Special Centre for Molecular Medicine, Jawaharlal Nehru University, New Delhi, India Department of Chemistry, University of Delhi, Delhi 110007, India

A R T I C LE I N FO

A B S T R A C T

Keywords: EcTopo 67 PPEF Poison inhibitor Acidic triad Cleavage and Religation

Background: Topoisomerase is a well known target to develop effective antibacterial agents. In pursuance of searching novel antibacterial agents, we have established a novel bisbenzimidazole (PPEF) as potent E. coli topoisomerase IA poison inhibitor. Methods: In order to gain insights into the mechanism of action of PPEF and understanding protein-ligand interactions, we have produced wild type EcTopo 67 N-terminal domain (catalytic domain) and its six mutant proteins at acidic triad (D111, D113, E115). The DDE motif is replaced by alanine (A) to create three single mutants: D111A, D113A, E115A and three double mutants: D111A-D113A, D113A-E115A and D111A-E115A. Results: Calorimetric study of PPEF with single mutants showed 10 fold lower affinity than that of wild type EcTopo 67 (7.32 × 106 M−1for wild type, 0.89 × 106 M−1for D111A) and 100 fold lower binding with double mutant D113A-E115A (0.02 × 106 M−1) was observed. The mutated proteins showed different CD signature as compared to wild type protein. CD and fluorescence titrations were done to study the interaction between EcTopo 67 and ligands. Molecular docking study validated that PPEF has decreased binding affinity towards mutated enzymes as compared to wild type. Conclusion: The overall study reveals that PPEF binds to D113 and E115 of acidic triad of EcTopo 67. Point mutations decrease binding affinity of PPEF towards DDE motif of topoisomerase. General significance: This study concludes PPEF as poison inhibitor of E. coli Topoisomerase IA, which binds to acidic triad of topoisomerase IA, responsible for its function. PPEF can be considered as therapeutic agent against bacteria.

1. Introduction DNA topoisomerases are ubiquitous enzymes essential to maintain the torsional state of the DNA and plays a pivotal role in almost all cellular processes of DNA [1]. These enzymes are broadly divided into two classes: the type I enzymes catalyse the cleavage of one strand and then passage of another DNA strands through it whereas the type II enzymes catalyse the cleavage of both the strands of DNA and then interpenetration of double-stranded DNA segments through it and this is how these enzyme maintains the DNA topological problems which is encountered by the DNA in different cellular process [2]. Topoisomerases are often used as drug targets for the treatment of bacterial infection and other diseases like cancer [3]. Many antibiotics have been developed to target DNA gyrase and topoisomerase IV. But, development of resistance via multiple mechanisms limits their use [4].

Bacterial topoisomerase I is being explored as an alternative and novel drug target [5]. Type IA topoisomerase enzyme can be found in every microorganism [6]. Topoisomerases IA regulates DNA topology by cleaving a single strand of DNA with a tyrosine nucleophile at the active site, forming a covalent complex with the cleaved DNA via a 5′-phosphotyrosine linkage [7]. Following cleavage of the DNA by topoisomerase and passage of the other strand, the deoxyribosyl hydroxyls so formed acts as the nucleophile and break the phosphotyrosine link and religate the DNA strand [8–10]. There are twelve polar residues that are highly conserved among the type IA enzymes, Glu-9, His-33, Asp-111, Glu-115, Gln-309, Glu-313, Thr-318, Arg-321, Thr-322, Asp-323, His365, and Thr-496. Out of these Glu-9, Asp-111, Asp 113, Glu115 and Arg321 was observed to play critical role in cleavage and rejoining, through its interaction with the 3′-deoxyribosyl oxygen [11]. Antibiotics targeting Topoisomerases are of significant interest. Many

⁎

Corresponding author at: Special Center for Molecular Medicine, Jawaharlal Nehru University, New Delhi 110067, India. E-mail address: [email protected] (V. Tandon). 1 First and second author has equal contribution in manuscript. https://doi.org/10.1016/j.bbagen.2019.05.015 Received 3 January 2019; Received in revised form 20 May 2019; Accepted 23 May 2019 Available online 27 May 2019 0304-4165/ © 2019 Elsevier B.V. All rights reserved.

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

mutants-D111A-D113A, D113A-E115A and D111A-E115A. We observed lower binding affinity of PPEF towards D111A, D113A, E115A, D111A-D113A, D113A-E115A and D111A-E115A as compared to the wild type EcTopo67transesterification domain. Availability of Mg2+ and maintenance of the electrostatic potential at the active site pocket of topoisomerase IA is crucial for enzyme activity. Thus inhibitors of this kind are of significant importance as chances of developing topoisomerase IA resistant mutants targeting the residues at the vicinity of the active site would be less. As per our observation, neither E. coli K12 long term exposure with PPEF nor its treatment with 8 X MIC90 of PPEF to E. coli K12, does not lead to target specific (Topoisomerase IA) mutations [23]. It was observed that single and double point mutations decreased the affinity of PPEF to bind EcTopo 67 as compared to wild type. The single mutants of EcTopo 67 at DDE motif did not show much change in conformation, whereas, double mutants have shown change in conformation. The circular dichroism study and intrinsic fluorescence titrations with increasing concentration of PPEF did not show significant change in conformation in mutated EcTopo 67 as compared to wild type. Binding affinity of PPEF found from ITC correlated the data obtained from molecular docking in this context. On the basis of all above mentioned experiments we propose that PPEF binds strongly at the DDE motif of EcTopo 67.

quinolone and coumarin derived antibiotics are known to target Gyrase and Topoisomerase IV and have been developed as catalytic or poison inhibitors [12]. But, the development of frequent resistant mutants against these antibiotics limits the use of these drugs for treatment [13]. The catalytic inhibitors cause reversible inhibition of topoisomerase, whereas poison inhibitors cause irreversible inhibition of topoisomerase enzyme. The catalytic inhibitors act by blocking overall catalytic activity of enzyme. The poison inhibitors trap the binary complex of topoisomerase I and DNA to impair the ability of the enzyme to religate cleaved DNA and/or enhance the forward rate of DNA cleavage. Thus far, all studies topoisomerase poisons increase double strand break in DNA. Topoisomerase poisons can be distinguished from inhibitors by their cytotoxic ability [14]. Increased levels of topoisomerases render cells hypersensitive to enzyme poisons but resistant to inhibitors. Conversely, decreased enzyme levels render cells resistant to poisons but hypersensitive to inhibitors [15]. Earlier we have proved bisbenzimidazole as E.coli topoisomerase IA poison inhibitor [16,17]. PPEF (2′-(4-ethoxyphenyl)-5-(4-propylpiperazin-1-yl)-1H,1′H-2,5′-bibenzo [d]imidazole) having a tertiary nitrogen on N-methylated piperazine ring get protonated at physiological pH to become positively charged molecule. This positive charge on PPEF increase interaction with DDE motif [17]. PPEF was observed to trap the covalent intermediate after DNA cleavage by topoisomerases to act as topoisomerase poisons [18] to cause bactericidal effect. Further, our result suggests, chelation of Mg2+ by (2′-(4-ethoxyphenyl)-5-(4-propylpiperazin-1-yl)-1H,1′H-2,5′bibenzo[d]imidazole), PPEF (Fig. 1) is the probable cause for enzyme inhibition. Mg2+ is required for the religation of the DNA and thus this molecule act as poison inhibitor. The E. coli topoisomerase I enzyme has molecular weight of 97 kDa and the active site tyrosine is responsible for DNA cleavage is found in EcTopo 67transesterification domain. It was reported earlier that the acidic residues D111, D113, and E115 of EcTopo 67 are crucial for enzyme activity. But, the conversion of a single one of these three conserved acidic residues to alanine did not abolish the relaxation activity of E. coli topoisomerase I enzyme [19,20] but EcTopo 67 (E.coli Topoisomerase IA 67 kD a transesterification Nterminal domain) have no relaxation activity.Further, for double mutants involving D111, D113, and E115 requires higher concentrations of Mg2+ for activity, supporting the fact that these three residues are involved in coordinating with the Mg2+ required for relaxation activity [21,22]. Since the results of biochemical assays suggest, Mg2+ chelation as the probable mechanism behind enzyme activity inhibition; we targeted the acidic triads D111, D113 and E115 to validate our hypothesis. Though an accurate estimation of binding affinity of an inhibitor to an enzyme is a challenge, but here we extended our findings by using biophysical approach to study the effect of PPEF on conformation of EcTopo 67 and identify the site of binding. In the present manuscript we demonstrate, interaction of PPEF with EcTopo 67 increase the cleavage activity of EcTopo 67 but do not allow the relegation of DNA by trapping the cleavage complex and not allowing EcTopo 67 to perform relegation activity. We have created alanine substituted mutants of the acidic triad by point mutation resulting in single mutants-D111A, D113A, E115A as well as double

2. Materials and methods 2.1. Materials Mutants D111A, D113A, E115A, D111A-D113A, D111A-E115A and D111A-E115A were constructed using the plasmid pET-28a(+). Mutagenesis primers for D111A, D113A and E115A were purchased from Sigma Aldrich, India. Phusion High-Fidelity DNA Polymerase, dNTPs and DpnI were purchased from New England Biolabs, MA, USA. DNA sequencing reports were obtained from Eurofins Analytical Services India Pvt. Ltd. Hoechst 33342 was purchased fromSigma Aldrich, India. The hydrochloride salt of PPEF was synthesized in our lab as per procedure reported previously [17]. All reagents were purchased from Sigma Aldrich Pvt. Ltd. The HPLC grade 59 base pair oligonucleotide 5′GCCCTGAAAGATTATGCAATGCGCTTTGGGCAAACCA AGAGAGCATAATCTTTCAGGGC3′, with cleavage site CGCT↓TTG and labelled γ32P-ATP from Bhabha Atomic Research Centre (BARC). 2.2. Plasmids, cloning and site-directed mutagenesis of 67 kDa N-terminal domain of E. coli DNA topoisomerase IA The Wild type 67 kDa N-terminal domain of E. coli DNA topoisomerase IA (EcTopo 67) cloned in pET-28a(+) [24]. Single and double mutants of Alanine substitution were constructed by site-directed mutagenesis. Mutations were confirmed by DNA sequencing. 2.3. Cloning of N-terminal domain of E. coli topoisomerase IA In the present study we have cloned, expressed and purified complete E. coli topoisomerase gene from E. coli K12 genome. We have cloned the complete E. coli topoisomerase I gene ECP in pGEX-5X-1 vector having N- terminal GST tag. The N-terminal domain or catalytic domain was cloned in pET28a(+) expression vector having N–terminal His tag. N-terminal domain or catalytic domain was amplified by using E. coli topoisomerase I gene ECP with forward primer (FPECTD1: 5′ GAATCATATGGGTAAAGCTCTTGTC3′) and reversed primer (RPECTD1: 5′GAACTCGAGCTACGGATCTTTTTC3′) comprised of 1746 bp and 582 amino acids (Restriction sites CATATG- NdeI, CTCGAG- Xho I). 2.4. Transformation, expression and purification of EcTopo 67

Fig. 1. Structure of Hoechst-33,342 and PPEF.

E. coli strain BL21plysS was transformed with the plasmids 1525

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

containing desired gene with HIS tag and grown in LB and 50 μg/mL Kanamycin at 37 °C until OD600 reached 0.6–0.8. Isopropyl-1-thio-J-Dgalactopyranoside (IPTG) was then added to the final concentration of 1 mM and culture was induced for an additional 3 h at 37 °C in a shaker incubator. Cells were harvested by centrifugation at 5000 rpm for 10 min and suspended in PBS containing 1 mM DTT, 2 mM benzimidine, 2 mM PMSF and protease inhibitor cocktail. Cells were sonicated on ice and sonicated lysate was centrifuged at 12,000 rpm for 30 min and the supernatant was checked for expression of proteins. Purification of expressed protein in pET-28a(+) expression plasmid was done using Ni-NTA Agarose. Recombinant protein was localized in soluble fraction and subjected to purification under native conditions. Cells were lysed in PBS containing 1 mM DTT, 2 mM benzimidine, 2 mM PMSF and protease inhibitor cocktail. 1 mg/mL lysozyme was added for the lysis and kept in ice for 30 min. Dipped in liquid N2 for 10 min and thaw under flowing warm water followed by sonication. Centrifuged at 15,000 rpm for 30 min and the supernatant were incubated for 4 h with pre-equilibrated matrix in PBS with constant rotatory motion at 40 °C. After incubation resin bound to protein was washed with 50 mL wash buffer (50 mM Tris-Cl pH 8.0, 150 mM NaCl, 1 mM DTT, 10% glycerol, 1 mM PMSF). Finally, proteins were eluted with elution buffer (50 mM Tris-Cl pH 8.0, 150 mM NaCl, 1 mM DTT, 20% glycerol, 1 mM PMSF, Protease inhibitor cocktail, and 10 mM glutathione reduced). Fractions were analysed by 10% SDS-PAGE. Fractions containing purified fusion proteins were dialysed against 20 mM Tris-Cl pH 7.5, 150 mM NaCl, 1 mM DTT, 1 mM PMSF, Protease inhibitor cocktail, aliquoted and stored at −80 °C. The protein samples were further digested with thrombin then concentrated and desalted with amicon (Millipore) concentrator 50 kDa for further experiments.

and heated at 95 °C for 5 min. The DNA cleavage products were analysed by electrophoresis on a 15% sequencing gel followed by autoradiography of the dried gel to visualize the 32Plabelled DNA cleavage products. EcTopo 67 mutant mediated DNA religation assay, the enzyme-oligonucleotide cleavage reaction with no MgCl2was carried out at 37 °C for six mutant proteins. To initiate religation, 2.0 mM MgCl2 were added for the religation reaction at 37 °C. All reactions were stopped after15 min by adding equal volume of stop solution. The samples were heated at 95 °C for 5 min before electrophoresis in a 15% sequencing gel. The percentage of oligonucleotide rejoined by the enzymes was determined by the disappearance of the cleaved product after analysis by autoradiography of the dried gel. 2.7. Circular dichroism spectroscopy of EcTopo 67 with PPEF Far UV CD experiments were performed using 1 mm path length cells on a Circular Dichroism Spectrometer with Stop Flow-Applied PhotoPhysicsChirascan. CD spectra of wild type (67 kDa) and single and double mutants of wild type N-terminal domains in the absence and presence of varied concentrations of PPEF and Hoechst-33342 were recorded at a wavelength ranging from 250 nm to 200 nm under constant nitrogen flush. A scan speed of 50 nm/min, 1 nm bandwidth, 1 nm data pitch and 3 accumulations with a response time of 1 s were adopted. Samples were prepared in 20 mM phosphate buffer (pH 7.4) containing 100 mM KCl and when required; 5 mM Mg2+ ion was included in the buffer. A constant concentration of protein (5 μM) was titrated with increasing concentrations of the ligand Hoechst 33342 and PPEF up to 1: 5 ratios (~25 μM ligand concentration) in 20 mM phosphate buffer (pH 7.4) containing 100 mM KCl. Between each ligand addition an interval of 5 min was maintained and samples were mixed by pipetting up and down with a micro pipette. All spectra were buffer baseline corrected and measured at 25 °C.

2.5. Site-directed mutagenesis Alanine substitution mutants were constructed by site-directed mutagenesis. The nucleotide sequences of the mutagenesis primers used in the construction are mentioned in (Table S1). Expression vector (pET-28a(+) with catalytic domain of Topoisomerase IA) isolated from DH5α was used as template. In a reaction mix of 25 μL, 10 ng of template DNA was added with 5 μL of 5× reaction buffer, 125 ng each of forward and reverse primer, 1 μL of 10 mM dNTP mix, 1 μL Pfu turbo DNA polymerase (2.5 U/μL). This reaction mix was then subjected to PCR under the condition of 50s at 95 °C, 50s at 60 °C and 8 min at 68 °C. After PCR, 0.5 μL of DpnI restriction enzyme (20 U/μL) was added to the reaction mix and then incubated at 37 °C for 1 h to digest the parent strand. After digestion the enzyme is inactivated by incubating the reaction mix at 80 °C for 20 min. After heat inactivation, 10 μL of sample was run in 1% agarose gel containing EtBr (to check the amplification). 2.5 μL of the reaction mix was used to transform E. coli DH5α. Transformation was performed. Plasmid DNA extracted from the transformed cells was sent for sequencing to (Applied Biosystems, Lab India, Gurgaon) to confirm mutation. Protein purification was done as written above.

2.8. Intrinsic tryptophan fluorescence measurements of EcTopo 67 and mutants Fluorescence measurement was performed using Tecan Infinity 200 Pro Microplate Reader using black - 96 plates. The protein was excited at 270 nm (tryptophan) at 25 °C. The emission was recorded between 300 and 600 nm wavelength. The spectra band width was taken 5 and 10 nm for excitation and emission spectra respectively. Each data point reported is an average of 3 determinants. The wild type EcTopo 67, D111A, D113A, E115A (single mutants) and D111A-D113A, D111AE115A, D113A-E115A (double mutants) were used at 0.1 mg/mL concentrations (each) in 20 mM potassium phosphate, pH 7.4, 20 mM KCl in presence of 6 mM MgCl2. Proteins are titrated with PPEF at molar ratios [1:0, 1:0.2, 1:0.4, 1:0.6, 1:0.8, 1:1, 1:2, 1:3 and 1:4]. All the measurements were corrected for the spectrum of the buffer solution used. 2.9. Isothermal titration calorimetry (ITC) of EcTopo 67 and mutants with PPEF

2.6. Assay to measure DNA cleavage–religation equilibrium of EcTopo67 ITC experiments were carried out on a Microcal-ITC200 Calorimeter (Malvern Instruments Ltd.Malvern, Worcestershire, United Kingdom) at temperatures 298 K. The interaction between wild type and D111A, D113A, E115A, D111A-D113A, D111A-E115A, D113A-E115A mutants of EcTopo IA protein and PPEF in 20 mM potassium phosphate, pH 7.4, 20 mM KCl was determined in presence of 6 mM MgCl2. Before loading, the protein sample and ligand PPEF were thoroughly degassed. Prior to ITC experiment, instrument was calibrated with running titration keeping same buffer in the cell and syringe. The titration cell was filled with a protein sample of 5 μM in 20 mM potassium phosphate, pH 7.4, 20 mM KCl and 6 mM MgCl2. The syringe was loaded with 200 μM PPEF/Hoechst-33,342 solutions in the same buffer. Titrations of protein

The effect of PPEF on the DNA cleavage–religation equilibrium of EcTopo67 and mutant proteins was assayed using a 32P-labelled 59 bp oligonucleotide substrate at the 5′-end [25]. The labelled DNA (50 ng) was incubated with 100 ng of EcTopo 67 in 5 mL of 10 mM Tris, pH 8.0, at 37 °C for 30 min to allow DNA cleavage. PPEF was then added in increasing concentrations (0.25, 0.5, 1, 1.25. 1.5,2 μm) to each reaction and reaction mixtures were left for 10 min on ice followed by addition of 2 mM MgCl2 to determine whether PPEF can inhibit the shift in cleavage–religation equilibrium towards religation upon the addition of Mg2+. After further incubation at 37 °C for 5 min, the reaction was terminated by the addition of 6.5 mL of sequencing gel loading buffer 1526

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

Fig. 2. Analysis of cleavage products formed from 32P-labelled at the 5′-end single-stranded DNA by electrophoresis in a sequencing gel. (A) PPEF affects the cleavage–religation equilibrium of EcTopo67: Lane 1, 32P-labelledat the 5′-end single-stranded DNA; lane 2, 32P-labelled at the 5′-end single-stranded DNA with enzyme; lanes 3–8, 32P-labelled at the 5′-end single-stranded DNA with enzyme in the presence of 0.25, 0.5, 1.0, 1.25, 1.5 and 2 mM PPEF, Lane 9, 32P-labelled at the 5′-end single-stranded DNA was incubated with enzyme in the presence of 2 mM MgCl2 respectively. (B) DNA cleavage and religation by single mutant: Topoisomerase cleavage reactions were first incubated with 10 mM Tris for 30 min. 2 mM MgCl2 was then added to religate the cleaved complex. Aliquots of reactions were stopped after 15 min and electrophoresed in a 15% sequencing gel. (C) DNA cleavage and religation by double mutant:Topoisomerase cleavage reactions were first incubated with 10 mM Tris for 30 min. 2 mM MgCl2 was then added to religate the cleaved complex. Reactions were stopped after 15 min and electrophoresed in a 15% sequencing gel. The levels of DNA substrate and cleavage product were analysed. S- single-stranded DNA, C- Cleaved DNA.

sample with PPEF were carried out by injecting 2 μL aliquots of 200 μM PPEF from rotating syringe at a speed of 307 rpm. Total 20 syringe injections containing PPEF were titrated into cell containing protein sample at 180 s time interval between repeated injections. The ITC equilibrium options were set for fast and auto mode. ITC data was analysed with Origin 7.0 and the binding parameters were determined by fitting to a one-site binding model. The one-site binding model was used to fit the integrated data to obtain the stoichiometry and binding constants. The binding affinity (Ka) values were obtained and the corresponding ΔG values were calculated from the equation:

∆G = −RTlnK a

(Hoechst 33342 and PPEF) were constructed manually by ChemDraw15.0. Ligand protonation states were manually assigned. As aconsequence, all of the ligand molecules have +1 net charge. The ligands were geometrically optimized in vacuum by Maestro. Each of ligands was docked against the same grid using extra-precision (XP) sampling, reward intra-molecular hydrogen bonds, post-docking minimization, and maximum of five poses per docking were taken as output. All poses were ranked using Glide's XP docking scoring function. The best docking pose for each ligand was selected and submitted as our pose prediction.

(1) 3. Results

The entropic contribution was calculated from.

TΔS = ΔH − ΔG

(2)

3.1. Cloning, site directed mutagenesis, expression and purification of wild type and mutant EcTopo 67 protein

where ΔG is the change in standard free energy, R is a universal gas constant (R = 1.987 cal. Mol−1 K−1), T is temperature (in Kelvin) and Ka is association constant.

We have cloned, expressed and purified catalytic domain of E. coli topoisomerase gene from E. coli K12 genome (Supplementary Fig. S1). Alanine substitution mutants were constructed by site-directed mutagenesis (Supplementary Fig. S2). Expression of the alanine substitution mutants in EcTopo 67 was confirmed by SDS gel electrophoresis of the soluble lysates followed by coomassie blue staining (Supplementary Fig. S3). The acidic triad residues Asp111, Asp113, and Glu115 participate in metal coordination, which is important for religation of DNA. From the computational results and the biochemical assays being discussed in the earlier report, it was proposed that Mg2+ chelation by PPEF and its interaction in the vicinity of acidic triad is responsible for inhibition of the enzymatic activity. To further validate the hypothesis, the work was further extended by creating alanine substituted mutants of the acidic triad (Supplementary Fig. S2). The crystal structure of 67 kDa domain indicates the importance of acidic triad Asp111, Asp113 and Glu115 in stabilizing the conformation of EcTopo 67.

2.10. Molecular docking of PPEF to EcTopo 67 and six mutant proteins Selected crystal structure 1ECL was obtained from Protein Data Bank which further prepared using the Protein Preparation Wizard in Maestro [26]. Protein Structures were further prepared using the PrepWiz module implanted in Schrodinger suite. The proteins were first preprocessed where bond orders and hydrogens are assigned, zero order bonds to metals and disulphide bonds are created. All ionizable residues of wild type, single and double mutated proteins were assigned theirprotonation states using Epik assuming a pH of 7.0, which was employed in the binding assay. A mutation at D111, D113 and E115 was done by BIOVIA Discovery Studio [27]. All crystallographic water and ions were removed. In order to avoid steric clashes, hydrogens of remaining protein (with or without ligand) structures were minimized using OPLS_2005 force field [28] while the heavy atoms were restrained using an RMSD cut off of 0.3 Å. The 3D structures of all ligands 1527

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

PPEF was observed in case of single mutant proteins D111A, D113A and E115A as well as double mutant D111A-D113A, D113A-E115A and D111A-E115A (Fig. 4); which can be related to the previous reports [17] that the acidic residues are involved in the interaction of Mg2+ which further induces very little conformational change required for the catalytic activity of the enzyme. The emmission peak was observed ~325 nm for tryptophan in all cases, which is found to be quenched with successive addition of PPEF as well as Hoechst33342. An induced signal around 425–525 nm was observed due to concentration increment of ligand (Inset Fig. 4B–G).We did the titration of increasing concentration of PPEF in presence and absence of MgCl2. The maximum decrease in fluorescence emission occurred in wild type EcTopo 67 in the presence of MgCl2 as compared to mutated protein with the increasing concentration of PPEF. (Fig. 5A), on the other hand in the absence of MgCl2, wild type and single mutants showed decrease in fluorescence intensity, but little change was observed in the fluorescence intensity of double mutants (Fig. 5B) suggesting PPEF is not allowing the shift in cleavage–religation equilibrium of DNA: topoisomerase complex. The change in the fluorescence of all three double mutants in presence of PPEF with and without Mg2+ is not that significant suggesting PPEF is acting at acidic triad of topoisomerase IA and trapping the cleaved DNA and not allowing the religation to occur. Hence, PPEF can be termed as topoisomerase poisons.

3.2. Evaluate the cleavage–religation equilibrium of EcTopo67 and six mutants Topoisomerase poisons stimulate enzyme-mediated DNA scission by two non-mutually exclusive mechanisms. Drugs can act by impairing the ability of the enzyme to religate cleaved DNA and/or by enhancing the forward rate of DNA cleavage [15]. Hence, cleavage, religation assays were performed to determine the activity of EcTopo67 and its mutants. Wild-type EcTop67 does not require Mg2+ for DNA cleavage (Fig. 2, lane 2). However the cleavage-religation equilibrium for wildtype EcTopo67 is shifted towards religation in the presence of 2 mM Mg2+ as indicated by the disappearance of the cleavage product (Fig. 2 lane 9) and the addition of PPEF (lanes 6–8) block the religation of DNA cleavage product. The interaction between PPEF and the EcTopo67 complex may stabilize the covalent complex and shift the cleavage religation equilibrium, leading to the accumulation of DNA cleavage product in the presence of Mg2+. In contrast, all six alanine substitution mutants were capable of DNA cleavage in the absence of Mg2+. However, the level of cleaved product was increased with increasing concentration of protein and PPEF (Supplementary Fig. S4). The PPEF competes with Mg2+ for relegation activity, proving that PPEF is a poison inhibitor. Multiple experiments were carried out to determine the effect of mutations on the rate and extent of religation of DNA. As mentioned earlier, wild type EcTopo67 does not require Mg2+ for cleavage, but requires divalent ions for religation [29]. Addition of Mg2+ post cleavage experiment, relegation was not observed at all in the case of single and double mutants (Fig. 2B & C). The reason of no religation of the cleavage product was the mutation in the acid triad where Mg2+ binds. This suggests that mutation at acidic triad severely affected the ability of the mutant to religate the cleaved DNA.

3.4. Thermodynamic insight of PPEF-EcTopo67and its mutants by isothermal calorimetry To study the interaction of PPEF with EcTopo 67 and its single and double point mutated proteins, we analysed the thermodynamic parameters, using isothermal titration calorimetry (ITC). We compared the affinity constant (Ka), change in enthalpy change (ΔH), change in entropy (ΔS) and free energy change (ΔG) of wild type and mutants, presented in (Table 1). Thermograms showing appropriate heat derived from the injection of identical amounts of PPEF as well as Hoechst 33342 into the wild type and mutant EcTopo 67are presented in (Fig. 6). Wild type EcTopo 67bound to PPEF and Hoechst-33,342 exhibited single binding event. The reaction was found to be exothermic with negative enthalpy. The binding affinity of PPEF to EcTopo 67 (Ka) was observed to be 7.32 × 106 M−1 and the enthalpy of binding (ΔH) was observed to be −27.43 kcal mol−1 whereas for Hoechst-33,342 the affinity found bit less with a value 2.45 × 106 M−1. The negative sign in both cases reflects that, the reaction was exothermic and enthalpy driven. The hydrogen bonding and van der Waals interaction between proteins with PPEF is assumed to contribute for the negative enthalpy. The values obtained for (−TΔS) and ΔG is +19.21 and − 8.23 kcal mol−1, respectively for PPEF and EcTopo 67interaction. The strong enthalpic contributions made the binding free energy (ΔGo) favourable. Further, higher Ka values for EcTopo 67 indicates higher binding as compared to singly mutants D111A, D113A and E115A in which the affinity constants were found as 0.89 × 106, 0.13 × 106and 0.11 × 106 M−1 respectively (Fig. 7). ΔG was observed to be most negative in case of topoisomerase IA indicating most favourable binding compared to the mutants. With double mutant protein as Ka value in case of D111A-D113A against PPEF was found with 100 fold less value (0.03 × 106 M−1), similar trends were observed with D113A-E115A (0.09 × 106 M−1) and with D111A-E115A (0.02 × 106 M−1). The Ka values observed indicate less effective binding with mutated sequence as compared to wild type EcTopo 67. ΔG was also observed to be most negative in case of wild type EcTopo 67as compared to its mutants indicating most favourable binding. The calculated values indicate, EcTopo 67-PPEF interaction is favoured by H-bondings, van der Waals forces etc. whereas, D113A-PPEF, D111A-PPEF and E115A-PPEF and the other three doubly mutated sequences interact unfavourably due to their unfavourable conformational changes. As control we have taken Hoechst-33,342, and we found Hoechst-33,342 binds with mutated EcTopo 67 proteins in a better

3.3. CD and fluorescence studies suggest that PPEF binds at acidic triad site of EcTopo67 Here, we monitored the effect of Hoechst-33,342 and PPEF on EcTopo 67's secondary structure by far-UV CD spectroscopy. We observed decrease in the negative CD signal of EcTopo 67 between 220 and 260 nm overall. We opted to study the effect of mutations at different position of wild type EcTopo67 with changing ligand concentrations. The conformation of the single mutants i.e. D111A, D113A and E115A as well as double mutant-D111A-D113A, D113A-E115A and D111A-E115A were observed with a five-fold high concentration of ligands. Addition of ligands led to little conformation change in wild type EcTopo 67. Similarly, with mutant proteins we did not observe significant change except hyperchromic negative shift (Fig. 3). The CD spectrumin 20 mM potassium phosphate, pH 7.4, 20 mMKCl and 6 mM MgCl2 of the EcTopo 67 showed a negative peak at 225 nm, which is in line with the presence of reasonable content of secondary structure. Addition of Hoechst-33,342 and PPEF lead to small conformation change in EcTopo67 with no prominent hypsochromic as well as bathochromic shifts. PPEF and its parent analogue Hoechst-33342 both showed similar changes (Supplementary Fig. S5) with increasing concentration with EcTopo 67as well as its single and double mutants. On the basis of CD spectra we cannot comment much about the binding interaction of PPEF with EcTopo67 (Fig. 3A). The crystal structure of 67 kDa domain indicates the importance of acidic triad D111, D113 and E115 in stabilizing the conformation of EcTopo IA [30]. Further to undergo the catalytic process these conserved residues interact with the Mg2+, responsible for the conformational changes by replacing the original H-bond and forming new Hbonds with water molecules. Alanine substitution showed quenching of fluorescence intensity (Fig. 4) in all single and double mutant proteins as compared to wild type EcTopo 67 as mutant proteinslose the binding capacity with Mg2+ at 25 °C. Thus in the presence of 6 mM Mg2+ the tryptophan fluorescence quenching with increasing concentration of 1528

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

Fig. 3. CD Signature scan showing conformational change with increasing concentration of PPEF: (A) CD signatures of all mutant proteins used with EcTopo 67; PPEF concentration is increasing up to 1: 5 ratio on (B) EcTopo 67 and on single mutants (C) D111A, (D) D113A, (E) E115A double mutant proteins (F) D111A-D113A, (G) D111A-E115A and (H) D113A-E115A. Proteins are titrated with PPEF at molar ratios [1:0, 1:0.5, 1:1, 1:2, 1:3 and 1:5]; Buffer used in the titration: 20 mM potassium phosphate, pH 7.4, 20 mM KCl in presence of 6 mM MgCl2. 1529

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

Fig. 4. Intrinsic tryptophan fluorescence showing decrease in intensity: (A) Fluorescence intensity scan of all mutant proteins used with EcTopo 67; of wild type (B) EcTopo 67 and on single mutants (C) D111A, (D) D113A, (E) E115A double mutant proteins (F) D111A-D113A, (G) D111A-E115A and (H) D113A-E115A. Excitation at 270 nm; Proteins are titrated with PPEF at molar ratios [1:0, 1:0.2, 1:0.4, 1:0.6, 1:0.8, 1:1, 1:2, 1:3 and 1:4] using 20 mM potassium phosphate, pH 7.4, 20 mM KCl in presence of 6 mM MgCl2, as buffer at room temperature. WT: wild type. 1530

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

wild type EcTopo 67 and its six mutant proteins (Supplementary Table S2). The mutations were created at acidic triads i.e.; D111, D113 and E115 in EcTopo 67 manually as none of the crystal structures were available. We have created 3D structures of single mutants D111A, D113A and E115A as well as double mutants D111A-D113A, D113AE115A and D111A-E115A. A better Glide docking scores were found in case of wild type EcTopo 67 (−7.19) as compared to the single mutants D111A (−6.84), D113A (−6.43) and E115A (−7.02). PPEF found to be loosely fit at binding pockets which is near to the acidic triads but does not directly bind with acidic triads. The other interactive residues which are present in near contacts were Glu9, Lys13, His33, Ala111, Glu115, Ile119, Tyr319, Met320, Arg321 and Thr496. The double mutant proteins having two aspartates replaced with alanines showed further decrease in docking scores as compared to wild type protein i.e.; D111A-D113A (−5.87), D113A-E115A (−5.23) and D111A-E115A (−4.88). A strong hydrogen bonding between imidazolo-NH of PPEF was observed with carboxylic groups of D113 and E115. Few van der Waals interactions were observed in most of the docked structures of PPEF & Hoechst 33342 with different amino acids such as Glu9, Asn111, Asp113, Arg19, Tyr319. Replacement of acidic amino acids (D and E) with hydrophobic alanine (A), disfavours the binding of PPEF towards enzyme. In particular, each docking represents not only the best-scored pose of the entire docking run for this ligand, here PPEF/ Hoechst-33,342 but also the best-scored pose among a possible set of docked structures (clustering: 2.0 Å) and can thus be regarded as a representative putative binding mode (Supplementary Table S3). Analysis and superimposition of the docking poses reveals that PPEF mostly bind in the same pocket of all mutants including wild type protein. But single/double alanine substitution might have changed their conformation so PPEF interacts differently with surrounding amino acids and that reflects in their docking scores. As a control here, we have chosen Hoechst-33342 for similar docking experiments. The lower docking scores were observed with Hoechst-33342 as compared to the PPEF, with wild-type, single and double mutant EcTopo 67. The docking score of Hoechst-33,342 with wild type EcTopo 67 (−6.12), single mutants D111A (−5.78), D113A (−5.64) and E115A (−5.92); as well as double mutant proteins were observed lower as compared to PPEF. The amino acids Glu9, Pro11, Asn111, Asp113, Glu115, Arg321, Glu313, Ser495 etc. (supplementary

Fig. 5. Fluorescence titration of EcTopo67 and mutants of acidic triad with increasing concentration of PPEF. (A) Fluorescence titration of PPEF with MgCl2 (B) Fluorescence titration of PPEF without MgCl2.

fashion (Supplementary Fig.S7) with a greater Ka values in singly mutated D111A (1.67 × 106 M−1), D113A (0.51 × 106 M−1), E115A (0.08 × 106 M−1), D111A-D113A (0.11 × 106 M−1), D111A-E115A (0.15 × 106 M−1) and D111A-E115A (0.03 × 106 M−1) when the values are compared with PPEF (Table 1).

3.5. Binding to mutated EcTopo 67 with molecular docking We performed molecular docking of PPEF and Hoechst 33342 to

Table 1 Thermodynamics parameter of PPEF interaction with EcTopo 67 and single mutant proteins D111A, D113A, E115A and double mutant proteins D111A-D113A, D111A-E115A and D113A-E115A obtained from ITC.a Ligand

Stoichiometry [Ligand]/[Protein]

Binding Constant (M−1)

ΔH (kcal mol−1)

TΔS (kcal/mol K)

ΔG (kcal mol−1)

EcTopo 67 wild type Hoechst-33342 PPEF

2.34 ± 0.17 2.12 ± 0.42

2.45 ± 0.31 × 106 7.32 ± 0.07 × 106

−36.04 ± 3.45 −27.43 ± 1.68

−28.60 ± 1.16 −19.21 ± 0.87

−7.44 ± 0.25 −8.23 ± 0.51

D111A Hoechst-33342 PPEF

2.42 ± 0.66 2.89 ± 0.53

1.67 ± 0.71 × 106 0.89 ± 1.13 × 106

−56.50 ± 2.53 −49.70 ± 0.95

−49.34 ± 0.96 −43.90 ± 2.13

−7.16 ± 0.11 −6.80 ± 0.25

2.67 ± 0.92 2.90 ± 0.11

0.51 ± 0.13 × 106 0.13 ± 0.53 × 106

−86.67 ± 1.52 −72.64 ± 2.51

−80.02 ± 0.86 −66.12 ± 2.02

−6.65 ± 0.51 −6.52 ± 0.39

3.28 ± 0.71 1.92 ± 0.96

0.08 ± 0.13 × 106 0.11 ± 0.91 × 106

−66.23 ± 1.98 −35.41 ± 0.53

−61.02 ± 0.16 −27.49 ± 1.34

−5.21 ± 0.22 −7.92 ± 0.53

Hoechst-33342 PPEF D111A-E115A

3.14 ± 0.13 1.90 ± 0.11

0.11 ± 0.41 × 106 0.03 ± 0.53 × 106

−71.04 ± 2.81 −42.64 ± 2.51

−66.13 ± 0.96 −36.12 ± 2.02

−5.91 ± 0.15 −6.52 ± 0.39

Hoechst-33342 PPEF D113A-E115A

3.14 ± 0.34 3.07 ± 0.71

0.15 ± 0.41 × 106 0.09 ± 0.21 × 106

−76.34 ± 1.12 −64.45 ± 2.52

−70.20 ± 1.98 −58.63 ± 0.96

−6.14 ± 0.11 −5.82 ± 0.28

Hoechst-33342 PPEF

4.11 ± 0.64 3.78 ± 1.07

0.03 ± 0.18 × 106 0.02 ± 0.48 × 106

−56.04 ± 1.65 −52.43 ± 1.51

−51.15 ± 1.62 −48.19 ± 1.16

−4.89 ± 0.56 −4.24 ± 0.29

D113A Hoechst-33342 PPEF E115A Hoechst-33342 PPEF D111A-D113A

a

The reported Ka and ΔH values are mean ± SD from three experiments. 1531

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

Fig. 6. ITC curve fitting showing effective binding of ligands with EcTopo67: Thermogram showing ITC profile of (A) Hoechst 33342 and (B) PPEF interaction with wild type EcTopo 67. Titration of ligands was carried out at 25 °C. The upper panel shows the heat burst curves for successive injection of Hoechst 33342/PPEF into protein sample. The lower panel represents the corresponding normalized heat signals versus molar ratio fitted to one site model.

reduction in % of α-helix indicates that PPEF interaction with enzyme leads to disruption of the H-bonding which is required to hold its functional form and thus enzyme loses its activity in presence of PPEF. In order to study, the effect of single as well as double point mutations on the change in conformation due to PPEF interactions, fluorescence spectroscopy was done in the presence and absence of Mg2+ at the different concentrations of PPEF. The fluorescence titrations suggest that, at particular 6 mM concentration of Mg2+, the wild type proteins show major quenching in fluorescence as compared to mutants. The intrinsic tryptophan fluorescence spectra of EcTopo 67 showed decrease in fluorescence maxima at higher concentration of PPEF and Hoechst-33,342 irrespective of the presence of Mg2+. The decrease in fluorescence intensity is quite less as compared to wild type with single as well as double mutants in the presence of PPEF clearly suggests that PPEF binds at the DDE motif of wild type EcTopo 67. The present study was also aimed to validate the proposed hypothesis that PPEF bind to the catalytic site of EcTopo 67. In this regard, we performed thermo-analytical studies which suggest PPEF interacts near the vicinity of the acidic triad of E. coli topoisomerase whether wild type or mutated. Result from the ITC shows almost 10-fold reduction in the binding affinity of PPEF with the single alanine substituted mutants D111A, D113A and E115A and with double substituted mutants D111A-D113A, D113A-E115A and D111A-E115A with 100 fold lower values as compared to wild type protein. Overall the binding affinity trend helps us to conclude that binding of PPEF with wild type as well as mutated proteins are sequence dependent and at least a single mutation disfavors the binding process by 10 fold. Increase the number mutation decreased the binding affinity of ligands towards topoisomerases. PPEF and Hoechst-33,342 both bind to the catalytic triad where point mutations were conducted. The molecular docking data correlates the informations obtained from ITC experiments. It validates our finding that single and double point mutations of DDE motif at the active site of EcTopo 67 with alanine decrease the binding affinity of PPEF and Hoechst 33342 towards proteins. The lower docking score obtained from Glide XP obtained in case of single and double mutants of EcTopo 67 is obvious. The acidic triad residues which are conserved throughout the organisms are essential for binding as well as relaxation of proteins. The nearby

Table. S2) are interacting with Hoechst 33342. 4. Discussion Herein, we evaluated and deciphered EcTopo 67-PPEF interaction in order to provide a glimpse on the rational drug design and further develop topoisomerase IA inhibitor as potent antibacterial agent. The core structure of type IA topoisomerases, typically of around 67 kDa in molecular weight, has a characteristic toroidal fold formed by four domains. The toroidal fold was first observed in E. coli topoisomerase I. Despite its ability to recognize the DNA substrate and carry out DNA cleavage and religation, EcTopo 67 cannot catalyse change of linking number in the relaxation of supercoiled DNA. The acidic triad DDE residues in the EcTopo 67 of E. coli topoisomerase I are known to be involved in divalent ion coordination and DNA cleavage-religation. However, conversion of double and single mutants of the acidic triad D111, D113, or E115 to alanine only resulted in partial loss of DNA cleavage activity. E9 appear to be required for DNA cleavage, so, the mutation in acidic triad has less effect in cleavage activity. The cleavage relegation assay in the presence of PPEF showed increase in the cleavage product with the increasing concentration of PPEF and complete inhibition of religation in the presence of PPEF. In this study, we demonstrate that addition of PPEF does not cause drastic conformational changes in enzymes and behaves likewise Hoechst-33342 over addition in an equimolar concentration of each type of proteins irrespective whether it wild type or mutated. The conformation of wild type EcTopo 67 was having mainly anti parallel βsheet and with increasing concentration of ligands do not lead to any marked conformational change. The secondary structure of single mutant-D111A, D113A and E115A, showed different conformations in presence and absence of ligands. D111A, D113A and E115A were found to show β-turn conformation; addition of ligand with increasing concentration leads to reduce the negative signal. Besides, double mutant protein i.e.; D111A-D113A, D113A-E115A and D111A-E115A showed different CD signature. D111A-D113A and D111A-E115A show α-Helix with β-sheet, whereas D113A-E115A shows β-turn in presence and absence of PPEF similar like single mutants. But the percentage α helix, β-sheet and β-turn reduce with increasing concentration of ligands. The 1532

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

Fig. 7. ITC Profiles of all mutant E. coli proteins showing differential affinity of PPEF: Thermograms showing ITC profile of PPEF interaction with single mutants (A) D111A, (B) D113A, (C) E115A and double mutant proteins (D) D111A-D113A, (E) D111A-E115A and (F) D113A-E115A protein-EcTopo 67.Titrations of ligands were carried out at 25 °C. The upper panel shows the heat burst curves for successive injection of PPEF into protein sample. The lower panel represents the corresponding normalized heat signals versus molar ratio fitted to one site model.

representation, Fig. 8C–D). Thus, from the above finding we can draw a conclusion that PPEF loosely fit to the mutated protein which directly reflect the binding affinity found from ITC experiments. This study provides biochemical evidence that DDE motif is an important catalytic site of Topoisomerase I A, which is required for relaxation function of protein. The change of even single amino acid does not make any major change in conformation but disturb the charge potential of binding site and hence the binding affinity towards E. coli topoisomerase pounding such as PPEF having positive charge on nitrogen of N-methylated piperazine ring.

residues present such as Ile119, Tyr319, Arg321 and Thr496 in most of the docked structures were unable to bind the ligand firmly as compared to the wild type protein. Substituent alanine, as a hydrophobic aliphatic amino acid at acidic triad decreases the affinity of positively charged PPEF (net electrostatic charge) with mutated enzyme. The positively charged Aspartic and Glutamic acids generally help to bind PPEF in acidic triad and hinders the religation process which is not found in mutated EcTopo 67 enzymes. The decreased docking scores in the terms of binding affinity of PPEF towards mutated enzymes also shows lesser number of interactive amino acid's presence in the near vicinity of acidic triad as well as in the common binding pocket. The superimposed pictures of PPEF-enzyme complex suggest that PPEF binds at different positions of binding pockets in single mutant proteins as compared to wild type protein (in green ball-stick representation, Fig. 8A–B). PPEF found to relocate at different binding pockets in double mutant proteins: D111A-D113A, D113A-E115A and D111A-E115A as compared to EcTopo 67 (in green ball-stick

5. Conclusion In the present study, we investigated interaction between EcTopo 67 and PPEF in order to find out an approach to the rational drug design as well as to further develop topoisomerase IA inhibitor as potent antibacterial agent. We demonstrate that addition of PPEF does not change 1533

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

Fig. 8. Stereo view of superimposed docked-PPEF in wild type and mutant E. coli Topo IA (PDB ID. 1ECL) proteins showing interactions with PPEF: (A) PPEF docked with Wild type EcTopo 67 (in green coloured ball-stick) along with PPEF with D111A, D113A and E115A (in pink, sky and blue coloured sticks), Ligands showed by white arrows obtained from docking of respective proteins; (B) In sight zoomed view of PPEF docked with EcTopo 67 and single mutants-D111A, D113A and E115A showing interactions with acidic triads (D111, D113 and E115); (C) PPEF docked with Wild type EcTopo 67 (in green coloured ball-stick) along with PPEF with double mutants-D111A-D113A, D111A-E115A and D113A-E115A (in pink, blue and grey coloured sticks), Ligands showed by white arrows obtained from docking of respective proteins; (D) In sight zoomed view of PPEF docked with EcTopo 67 and double mutants showing interactions with acidic triads (D111, D113 and E115) and Y319 is also present near vicinity.

Conflict of interest

drastically the conformation of enzymes over addition in an equi-concentration of each type of proteins irrespective of their sequence whether it is wild type or mutated. With the help of CD, we confirmed that these point mutations change very little in the conformation of enzyme. The fluorescence data also conclude that change in acidic triad affect the binding of PPEF. Increase in the number of mutation decreased the binding affinity of ligands towards topoisomerases. Molecular docking is used here to correlate the data obtained from ITC experiments and found to be helpful in this regard. It validates our finding that after mutations at the active site with single and double points with alanine decrease the binding affinity of ligands with enzymes. Henceforth, we can draw a conclusion that PPEF loosely fit to the mutated proteins as compared to wild type and that directly reflect the binding affinities found from ITC experiments. This study provides biochemical importance of DDE motif which is an essential catalytic site of Topoisomerase I A for relaxation process.

Authors declare no conflict of interest. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.bbagen.2019.05.015. References [1] J.C. Wang, DNA topoisomerases, Annu. Rev. Biochem. 65 (1996) 635–692. [2] J.C. Wang, Cellular roles of DNA topoisomerases: a molecular perspective, Nat. Rev. Mol. Cell Biol. 3 (2002) 430. [3] D.A. Álvarez-Hernández, G.S. Garza-Mayén, R. Vazquez-Lopez, Quinolones, nowadays perspectives and mechanisms of resistance, Rev. Chilena Infectol. 32 (2015) 499–504. [4] Y.C. Tse-Dinh, Targeting bacterial topoisomerases: how to counter mechanisms of resistance, Future Med. Chem. 8 (2016) 1085–1100. [5] Y.C. Tse-Dinh, Targeting bacterial topoisomerase I to meet the challenge of finding new antibiotics, Future Med. Chem. 7 (2015) 459–471. [6] P. Forterre, D. Gadelle, Phylogenomics of DNA topoisomerases: their origin and putative roles in the emergence of modern organisms, Nucleic Acids Res. 37 (2009) 679–692. [7] Y.C. Tse-Dinh, K. Kirkegaard, J.C. Wang, Covalent bonds between protein and DNA formation of phosphotyrosine linkage between certain DNA topoisomerases and DNA, J. Biol. Chem. 255 (1980) 5560–5565. [8] J.T. Stivers, S. Shuman, A.S. Mildvan, Vaccinia DNA topoisomerase I: single-turnover and steady-state kinetic analysis of the DNA strand cleavage and ligation reactions, Biochemistry 33 (1994) 327–339. [9] J.C. Wang, Interaction between DNA and an Escherichia coli protein omega, J. Mol. Biol. 55 (1971) 523–533. [10] Y.C. Tse-Dinh, Biochemistry of bacterial type I DNA topoisomerases, Adv. Pharmacol. 29 (1994) 21–37. [11] S.J. Chen, J.C. Wang, Identification of active site residues in Escherichia coli DNA

Acknowledgements The funding for this work was obtained from SERB, New Delhi (EMR/2017/000454) and DBT (BT/PR20794/MED/29/1057/2016). This work is also partially funded by DST-PURSE phase II, JNU and UPOE Phase II, JNU & ICMR(CAR) project. RS is thankful to Indian Council for Medical Research (ICMR) for providing fellowship as Senior Research Fellow. SS is thankful to DST-DPRP (VI-D&P/546/2016-17/ TDT(c)) for Research Associateship. SP is thankful to UGC & CSIR for providing fellowship as Senior Research Fellow. We want to acknowledge AIRF, Jawaharlal Nehru University, New Delhi & USIC, Delhi University for providing instrumentation facilities. 1534

BBA - General Subjects 1863 (2019) 1524–1535

R. Singh, et al.

topoisomerase I, J. Biol. Chem. 273 (1998) 6050–6056. [12] Y. Pommier, Drugging topoisomerases: lessons and challenges, ACS Chem. Biol. 8 (2013) 82–95. [13] D.I. Andersson, D. Hughes, Antibiotic resistance and its cost: is it possible to reverse resistance? Nat. Rev. Microbiol. 8 (2010) 260. [14] A.H. Corbett, D. Hong, N. Osheroff, Exploiting mechanistic differences between drug classes to define functional drug interaction domains on topoisomerase II, J. Biol. Chem. 268 (1993) 14394–14398. [15] S.J. Froelich-Ammon, N. Osheroff, Topoisomerase poisons: harnessing the dark side of enzyme mechanism, J. Biol. Chem. 270 (1995) 21429–21432. [16] S. Bansal, D. Sinha, M. Singh, B. Cheng, Y.C. Tse-Dinh, V. Tandon, 3, 4Dimethoxyphenyl bis-benzimidazole, a novel DNA topoisomerase inhibitor that preferentially targets Escherichia coli topoisomerase I, J. Antimicrob. Chemother. 67 (2012) 2882–2891. [17] H. Nimesh, S. Sur, D. Sinha, P. Yadav, P. Anand, P. Bajaj, V. Tandon, Synthesis and biological evaluation of novel bisbenzimidazoles as Escherichia coli topoisomerase IA inhibitors and potential antibacterial agents, J. Med. Chem. 57 (2014) 5238–5257. [18] L.F. Liu, DNA topoisomerase poisons as antitumor drugs, Annu. Rev. Biochem. 58 (1989) 351–375. [19] C.X. Zhu, C.J. Roche, N. Papanicolaou, A. DiPietrantonio, Y.C. Tse-Dinh, Site-directed mutagenesis of conserved aspartates, glutamates and arginines in the active site region of Escherichia coli DNA topoisomerase I, J. Biol. Chem. 273 (1998) 8783–8789. [20] Z. Zhang, B. Cheng, Y.C. Tse-Dinh, Crystal structure of a covalent intermediate in DNA cleavage and rejoining by Escherichia coli DNA topoisomerase I, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 6939–6944. [21] C.X. Zhu, Y.C. Tse-Dinh, The acidic triad conserved in type IA DNA topoisomerases

[22]

[23]

[24]

[25]

[26]

[27] [28]

[29]

[30]

1535

is required for binding of Mg (II) and subsequent conformational change, J. Biol. Chem. 275 (2000) 5318–5322. E. Massé, M. Drolet, Escherichia coli DNA topoisomerase I inhibits R-loop formation by relaxing transcription-induced negative supercoiling, J. Biol. Chem. 274 (1999) 16659–16664. D. Sinha, S. Pandey, R. Singh, V. Tiwari, K. Sad, V. Tandon, Synergistic efficacy of Bisbenzimidazole and Carbonyl Cyanide 3-Chlorophenylhydrazone combination against MDR bacterial strains, Sci. Rep. 7 (2017) 44419. S. Bansal, U. Tawar, M. Singh, et al., Old class but new dimethoxy analogue of benzimidazole: a bacterial topoisomerase I inhibitor, Int. J. Antimicrob. Agents 35 (2010) 186–190. G. Narula, T. Annamalai, S. Aedo, B. Cheng, E. Sorokin, A. Wong, Y.C. Tse-Dinh, The strictly conserved arg-321 residue in the active site of Escherichia coli topoisomerase I plays a critical role in DNA rejoining, J. Biol. Chem. 286 (2011) 18673–18680. R.A. Friesner, R.B. Murphy, M.P. Repasky, et al., Extra precisionglide: docking and scoring incorporating a model of hydrophobic enclosure for protein-ligand complexes, J. Med. Chem. 49 (2006) 6177–6196. D. Systemes, BIOVIA, Discovery Studio Modeling Environment. Release 4.5. Dassault Systemes, (2015) (San Diego, CA). D. Shivakumar, J. Williams, Y. Wu, W. Damm, J. Shelley, W. Sherman, Prediction of absolute solvation free energies using molecular dynamics free energy perturbation and the OPLS force field, J. Chem. Theory Comput. 6 (2010) 1509–1519. Y.C. Tse-Dinh, Uncoupling of the DNA breaking and rejoining steps of Escherichia coli type I DNA topoisomerase. Demonstration of an active covalent protein-DNA complex, JBiolChem. 261 (1986) 10931–10935. C.D. Lima, J.C. Wang, A. Mondragón, Three-dimensional structure of the 67K Nterminal fragment of E. coli DNA topoisomerase I, Nature 367 (1994) 138.