- Email: [email protected]
Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa
G Model
ARTICLE IN PRESS
ZOOL-25569; No. of Pages 5
Zoology xxx (2017) xxx–xxx
Contents lists available at ScienceDirect
Zoology journal homepage: www.elsevier.com/locate/zool
Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa Domenico Fulgione ∗ , Martina Trapanese, Maria Buglione, Daniela Rippa, Gianluca Polese, Viviana Maresca, Valeria Maselli Department of Biology, University of Naples Federico II, Campus Monte S. Angelo, 80126 Naples, Italy
a r t i c l e
i n f o
Article history: Received 20 September 2016 Received in revised form 10 May 2017 Accepted 10 May 2017 Available online xxx Keywords: Sus scrofa Olfactory sensory neurons Pre-birth learning
a b s t r a c t Animals recognize their surrounding environments through the sense of smell by detecting thousands of chemical odorants. Wild boars (Sus scrofa) completely depend on their ability to recognize chemical odorants: to detect food, during scavenging and searching partners, during breeding periods and to avoid potential predators. Wild piglets must be prepared for the chemical universe that they will enter after birth, and they show intense neuronal activity in the olfactory mucosa. With this in mind, we investigated the morpho-functional embryonic development of the olfactory mucosa in the wild boar (in five stages before birth). Using mRNA expression analysis of olfactory marker protein and neuropeptide Y, involved in the function of olfactory sensory neurons, we show early activation of the appropriate genes in the wild boar. We hypothesize olfactory pre-birth development in wild boar is highly adaptive. © 2017 Elsevier GmbH. All rights reserved.
1. Introduction Olfaction plays a central role in wildlife adaptation, representing the most important and crucial sense for most mammals through a complex pathway starting in the olfactory epithelium (Nguyen et al., 2012). The relevance of olfaction during searching for food and intraspecific communication has been extensively investigated (Filsinger and Fabes, 1985; Rinaldi, 2007). Furthermore, even before birth, maternal amniotic odor can stimulate the fetus, particularly in kin recognition (Schaal and Orgeur, 1992), but the exact mechanism has not yet been elucidated. Young animals can start learning which food types are healthy and nutritious from the mother before weaning (Oostindjer et al., 2011) and even before birth. In humans, at about 30 weeks amniotic fluid flows through the nasal and oral cavities to help the fetus “to smell” (Schaal et al., 1995); before that time tissues plug up the nasal cavities. It has also been observed that there is a highly selective neonatal response to familiar amniotic fluid odors, consistent with the hypothesis of detection and storage of the unique chemosensory information available to the fetus in the prenatal environment (Schaal et al., 1998). Interestingly, domestic piglets are most attracted to the odors associated with maternal feces and skin secretions at 12 h of age with a very acute ability to discriminate between mother and non-mother odors (Morrow-Tesch and McGlone, 1990). In sev-
∗ Corresponding author. E-mail address: [email protected] (D. Fulgione).
eral non-human mammals, the fetus is capable of olfactory learning and in some species neonates are attracted to the odor of amniotic fluid as a consequence of fetal exposure (i.e. prenatal olfactory learning) (Varendi et al., 1996). Studies on prenatal flavor learning have shown that the offspring of several species, such as humans and rats, show a preference to, or reduced aversion against, flavors to which they have been exposed before birth (Bilko et al., 1994; Hudson and Distel, 1999; Schaal et al., 2000; Mennella et al., 2001). A cross-species comparison among humans, rodents and sheep confirmed fetal olfactory learning (Schaal and Orgeur, 1992). In the porcine genome a large olfactory receptor gene family has been found: over 1,301 olfactory receptor genes and 343 partial olfactory receptor genes (Groenen et al., 2012). This large number of genes could explain the ability to perceive a large spectrum of odors in Sus, implying a strong reliance on abilities such as scavenging for food or looking for a mate, for both the pig and the wild boar (Pearce and Hughes, 1987; Kristensen et al., 2001; Mendl et al., 2002; McLeman et al., 2005, 2008). The wild boar is the most widespread ungulate in the world (Larson et al., 2005). Since the 1960s, wild boars have undergone a worldwide population expansion that has increased their overall geographic distribution as well as their population density in many areas within their range (Apollonio et al., 2010; Maselli et al., 2016). This spectacular demographic expansion was due to its adaptability (Rosell et al., 1998; Fulgione et al., 2016), its ability to invade different environments almost indiscriminately and human introduction (Abaigar et al., 1994; Baskin and Danell, 2003; Schley and Roper, 2003; Acevedo et al., 2006; Maselli et al., 2014b). It is impor-
http://dx.doi.org/10.1016/j.zool.2017.05.003 0944-2006/© 2017 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003
G Model ZOOL-25569; No. of Pages 5
ARTICLE IN PRESS D. Fulgione et al. / Zoology xxx (2017) xxx–xxx
2
tant to point out that the two Sus scrofa forms dwell in very different habitats: wild boar inhabits forest and natural habitats, whereas pig lives in a man-made environment, depleted of biodiversity and offering fewer sensory stimuli (Kareiva et al., 2007). Probably domestication affects the olfactory abilities of some species, especially with respect to the detection and processing of environmental odorants in the female (Bisch-Knaden et al., 2014). In some mammals, there has been a strong reduction in the sense of smell and of brain size associated with domestication (Lega et al., 2015; Maselli et al., 2014b). Therefore, it seems that wild piglets, when compared with domestic pigs, must be ready for the chemical universe they will inhabit. Here we report for the first time on differences in the morpho-functional dynamics of the prenatal olfactory mucosa in the wild boar. 2. Materials and methods 2.1. Sample collection Data on the litter size of wild boar are not easy to obtain because field observations can be inaccurate or incorrect, so hunted animals (especially pregnant) were used in our study (see also Gaillard et al., 1987; Fernández-Llario et al., 1999; Fernández-Llario and MateosQuesada, 2005; Maselli et al., 2016). In developing these studies, sows must be sacrificed without knowing whether or not they are pregnant and which developmental stage the fetuses have reached. This makes it very difficult to collect data according to a precise time sequence. In the present study, the age of fetuses was defined after shooting by their weight (± 0.01 g). Given a suid gestation period of 120 days (Vericad, 1983), the age of the fetuses (T) in days was determined using the Vericad formula established in the wild boar by Huggett and Widdas (1951): T = (Ps1/3 + 2.337)/0.097, where Ps is the average fresh weight (g) of the fetus within the litter (Vericad, 1983). We analyzed 25 wild boar fetuses, all from different litters, 5 for each developmental stage. Our activities were carried out in the Cilento, Vallo di Diano and Alburni National Park (CVD, South Italy, 181,000 ha) in accordance with Italian national laws (157/92 and 394/91 Laws). All field protocols were approved by the Ministry of Environment (ISPRA, prot. n 24581 20/07/2014). The animals studied originated from a culling plan carried out in the National Park to control wild boar abundance and were culled by specialized hunters. 2.2. Hybridization assay In Sus scrofa hybridization between wild and domestic forms may locally reach high levels, as observed in some populations in Italy. In order to separate any hybrids in our samples, we used the melanocortin receptor 1 (MC1R) locus as genetic maker associated with introgression and hybridization (Fulgione et al., 2016). From each wild boar sample, we extracted total genomic DNA by using the QIAamp DNA Mini Kit (QIAGEN, Valencia, CA, USA), according to the manufacturer’s instructions. The entire coding region of the MC1R gene was amplified and sequenced by using primer combinations (Maselli et al., 2014a). All sequences were compared with the wild-type references (accession number KF780580; Fulgione et al., 2016) and all wild boar samples with one or more mutations were defined as hybrids and not considered in subsequent analyses. 2.3. RNA extraction Olfactory mucosa sections were collected from fresh samples, isolating the whole olfactory epithelium using the RNAlater RNA Stabilization Reagent (QIAGEN) for immediate stabilization of RNA in tissues.
Table 1 Sequence of primers and size of amplicons used in the semi-quantitative and quantitative PCR. NPY, neuropeptide Y; OMP, olfactory marker protein; ActB, beta-actin; PCNA, proliferating cell nuclear antigen. Primer
Sequence 5 –3
Amplicon size
NPY − Forward NPY − Reverse OMP − Forward OMP − Reverse ActB − Forward ActB − Reverse PCNA − Forward PCNA − Reverse
CTCGGCGTTGAGACATTACA CACTTCCCATCACCACACAG ACCTCACCAACCTCATGACC CCCGAAGGAGATGAGGAAAT AGAGCGCAAGTACTCCGTGT AAAGCCATGCCAATCTCATC AGTGAGAAGGCCTGGCAGTA CTTTGCAGCCAATCTCCTTC
157 bp 170 bp 210 bp 222 bp
Total RNA was extracted from the olfactory epithelium using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s instructions, and genomic DNA contamination was eliminated by using RNase-free DNase (QIAGEN) for 15 min. The RNA concentration and purity were quantified using NanoDrop 2000c (Thermo Scientific, Wilmington, DE, USA) and we selected pure total RNA with an A260/A280 ratio of 2 ± 0.2. The quality was determined by 1% agarose gel electrophoresis. The reverse transcription of 2 g total RNA to cDNA was carried out using the Access RT-PCR System Kit (Promega, Fitchburg, WI, USA). Cycling parameters included a single-step cycle at 45 ◦ C for 45 min followed by 95 ◦ C for 2 min. 2.4. Gene expression We assayed the variation in gene expression of the olfactory marker protein (OMP), neuropeptide Y (NPY), and the proliferating cell nuclear antigen (PCNA) by using the primers described in Table 1. OMP is a protein involved in signal transduction, found in mature olfactory receptor neurons of all vertebrates and is a modulator of the olfactory signal-transduction cascade. OMP is starting to become expressed by mature primary olfactory sensory neurons as early as during development in mice (Farbman et al., 1980; Monti-Graziadei et al., 1980; Lee et al., 2011). NPY is a 36 amino acid peptide that mediates its action via six identified G-proteincoupled (Y1–6) receptors. In the peripheral olfactory system NPY is expressed in sustentacular cells (Hansel et al., 2001), a subpopulation of the microvillar cells (Montani et al., 2006), in the olfactory ensheathing glia (Ubink and Hökfelt, 2000), and in the nervus terminalis where it appears to modulate the olfactory epithelial activity of hungry animals (Mousley et al., 2006). It participates in the regulation of hunger, and in the modulation of the vasoconstrictor response triggered by noradrenergic neurons (Di Bona, 2002). A significant reduction in the olfactory neuronal precursor proliferation occurs in NPY-deficient mice (Hansel et al., 2001) and in NPY Y1 receptor knockout mice (Doyle et al., 2008). Thus, NPY is a good candidate neurotrophic factor with which to test our hypothesis on the differential sense of smell in Sus scrofa. PCNA plays an essential role in multiple cell cycle pathways, including DNA replication, DNA elongation and DNA excision repair (Kelman, 1997). PCNA is required throughout development and maternally encoded PCNA is essential for embryogenesis (Henderson et al., 1994). PCNA is highly conserved and has been identified in a range of eukaryotes (Kelman, 1997). PCNA expression provides a useful endogenous molecular marker to monitor cell proliferation in various types of tissues (Citterio et al., 1992; Dietrich, 1993; Iatropoulos and Williams, 1996; Chieffi et al., 2000). We analyzed a fragment of 170 bp of the coding region of the OMP gene, 157 bp of the coding region of the NPY gene and 220 bp of the coding region of the PCNA gene. For each experiment, data were normalized to the expression of the Actin B (ActB) housekeeping gene. Each sample was tested and run in duplicate.
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003
G Model ZOOL-25569; No. of Pages 5
ARTICLE IN PRESS D. Fulgione et al. / Zoology xxx (2017) xxx–xxx
3
Fig. 1. Expression level of functional markers in fetuses of wild boar at various stages: olfactory marker protein (OMP) and neuropeptide Y (NPY) in the olfactory mucosa; a marker of cell proliferation (proliferating cell nuclear antigen, PCNA); beta-actin (ActB), used as a normalizer. The box to the right shows quantitative gene expression, by real time PCR, for NPY and OMP just before birth.
We performed a semi-quantitative polymerase chain reaction (PCR) on all wild boar RNA extracted using 30 cycles at 94 ◦ C for 30 s, 60 ◦ C for 1 min and 68 ◦ C for 2 min. A final extension step was performed at 68 ◦ C for 7 min. PCR products were visualized by 1.5% agarose gel electrophoresis by staining with ethidium bromide, and then the relative brightness of each amplicon (band) was quantified using image analysis software (Green and Sambrook, 2012). To assay the relative amount of mRNA of the two considered markers of olfaction, we performed a quantitative reverse transcription (RT)-PCR in wild boar at the end of the gestation period, using the PCR cycler Rotor-Gene Q (QIAGEN) with 2 x Rotor-Gene SYBR Green Mix (QIAGEN) including 1 M forward and reverse primers with 0.1 g cDNA per reaction. The PCR cycling profile consisted of a cycle at 95 ◦ C for 30 s and 45 three-step cycles at 95 ◦ C for 15 s, at 60 ◦ C for 30 s and at 72 ◦ C for 20 s. Quantitative RT-PCR analysis was conducted by using the 2(−DC(T)) method (Livak and Schmittgen, 2001). As negative controls, “no reverse transcriptase” and “no template” samples were tested and confirmed to be negative. Amplification curves, melting curves, and cycle threshold values (Ct values) were analyzed using Rotor-Gene Q Series Software (QIAGEN). Ct values were presented as means ± SEM. All PCR products were confirmed by electrophoresis using 1% agarose gels with 0.1 mg/ml ethidium bromide for nonspecific amplification with negative controls.
3. Results In wild boar, we observed a morphological development of the fetus similar to that of the pig fetus (Foxcroft et al., 2006). The formation of eyelids and the external ears or pinnae started on the 74th day while the olfactory mucosa was found even at the earliest stages. Moreover, development of the head was enhanced in the rostral region (Fig. 1). Even at the earliest developmental stage studied here (day 53), the olfactory organ was already organized as a potentially functional epithelium within the nasal cavity. The semi-quantitative PCR on the mRNA of the olfactory mucosa showed an increase of OMP and NPY transcripts in the growth stages, from day 53 up to day 110. However, this was more evident for OMP than NPY mRNA transcripts, the latter showing a relative decline from day 74 onwards. PCNA had a uniform distribution at all stages, indicating continuous cell proliferation without significant changes of expression (Fig. 1). Moreover, the differential expression of OMP and NPY genes was analyzed by real-time PCR on RNA from the olfactory mucosa samples before and at birth (day 110), using actin expression to normalize the amount of mRNA in NPY and OMP (Fig. 1). OMP was expressed three times as much as actin, NPY 1.8 times as much (Fig. 1)
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003
G Model ZOOL-25569; No. of Pages 5
ARTICLE IN PRESS D. Fulgione et al. / Zoology xxx (2017) xxx–xxx
4
4. Discussion
References
Many studies have examined prenatal, perinatal and postnatal flavor learning in invertebrate and vertebrate groups (Brannon, 1972; Isingrini et al., 1985; Caubet et al., 1992; Hepper and Waldman, 1992; Sneddon et al., 1998; Schaal et al., 2000; Sneddon et al., 2001; Hepper and Wells, 2006; Hepper et al., 2013; Hepper, 2015), pig included (Oostindjer et al., 2009, 2010, 2011). However, little is known about the development of the prenatal olfactory system in wild boar. In our work we contribute to understanding this fascinating topic with a molecular approach considering gene expression. In our earlier work (Maselli et al., 2014a) we showed a higher olfactory ability in wild boar than in pig and free living pig, using functional gene markers. Using the same markers, now we shed new light on the pre-birth functionality of the olfactory mucosa. The constant diffuse presence of PCNA transcripts during embryogenesis reveals that it is a period of active cell proliferation (Mathews et al., 1984; Henderson et al., 1994; Maga and Hübscher, 2003). Within the olfactory mucosa, cell proliferation seems to occur while the olfactory sensory neurons mature as demonstrated by the presence of OMP and NPY transcripts. The presence of transcripts suggests that “the sense of smell” in wild boar is evident already at an early stage (day 53). In the rat, where the gestation period is about 22–23 days, OMP is reported to first appear in the receptors at day 21 (93% of the gestation period) (Gesteland et al., 1982), and strong NPY mRNA expression was found only at day 20 (89% of its gestation period) (Ubink and Hökfelt, 2000), i.e. both at the final stage of prenatal development. In the wild boar (120 days of gestation) the presence of transcripts of NPY and OMP at day 53 (44% of the gestation period) is rather precocious as compared to other mammals. Even though both OMP and NPY transcripts are present in all stages examined, the expression level of OMP increases more than that of NPY throughout pregnancy as quantified in the final stage (Fig. 1). Given that OMP is strictly related to the olfactory sensor neurons’ maturity and functionality (Margolis, 1972; Lee et al., 2011) our results can be interpreted in the light of prenatal learning in the amniotic fluid (Varendi et al., 1996). This chemical preknowledge acquired before birth will be refined by the behaviors and the parental care of the sow during the post-natal period, as in the case of piglets that repeatedly contacted the mother’s snout while she was eating (Petersen et al., 1990). Flavor in the amniotic fluid is very attractive and positive for young animals because it is in association with the mother’s positive context (Schaal et al., 1995; Mennella and Beauchamp, 2002; Arias and Chotro, 2007). In fact, young animals will more readily accept foods containing flavors to which they have been exposed via the maternal diet, before and after birth. In pigs, flavor learning has a positive effect on piglet growth, food intake, and behavior, reducing stress during re-exposure in a challenging environment (Oostindjer et al., 2011). Our data for the prenatal stage confirm other studies on prenatal, perinatal and postnatal flavor learning in pigs (Oostindjer et al., 2009, 2010, 2011). This potential pre-knowledge of the chemical environment into which the animal is born may confer an increased fitness and also may be the basis for the rapid expansion of wild boar populations in different and continuously changing environments (Bieber and Ruf, 2005).
Abaigar, T., del Barrio, G., Vericard, J.R., 1994. Habitat preference of wild boar (Sus scrofa L., 1758) in a Mediterranean environment. Indirect evaluation by signs. Mammalia 58, 201–210. Acevedo, P., Escudero, M.A., Munoz, R., Gorta´ızar, C., 2006. Factors affecting wild boar abundance across an environmental gradient in Spain. Acta Theriol. 51, 327–336. Apollonio, M., Andersen, R., Putman, R., 2010. European Ungulates and their Management in the 21st Century. Cambridge University Press, Cambridge. Arias, C., Chotro, M.G., 2007. Amniotic fluid can act as an appetitive unconditioned stimulus in preweanling rats. Dev. Psychobiol. 49, 139–149. Baskin, L.M., Danell, K., 2003. Ecology of Ungulates: A Handbook of Species in Eastern Europe and Northern and Central Asia. Springer-Verlag, Berlin. Bieber, C., Ruf, T., 2005. Population dynamics in wild boar Sus scrofa: ecology, elasticity of growth rate and implications for the management of pulsed resource consumers. J. Appl. Ecol. 42, 1203–1213. Bilko, A., Altbacker, V., Hudson, R., 1994. Transmission of food preference in the rabbit: the means of information transfer. Physiol. Behav. 56, 907–912. Bisch-Knaden, S., Daimon, T., Shimada, T., Hansson, B.S., Sachse, S., 2014. Anatomical and functional analysis of domestication effects on the olfactory system of the silkmoth Bombyx mori. Proc. R. Soc. Lond. B 281, 20132582. Brannon, E.L., 1972. Mechanisms controlling migration of sockeye salmon fry. Int. Proc. Salmon Fish Comm. Bull. 21, 1–86. Caubet, Y., Jaisson, P., Lenoir, A., 1992. Preimaginal induction of adult behaviour in insects. Q. J. Exp. Psychol. B 44, 165–178. Chieffi, P., Franco, R., Fulgione, D., Staibano, S., 2000. PCNA in the testis of the frog, Rana esculenta: a molecular marker of the mitotic testicular epithelium proliferation. Gen. Comp. Endocrinol. 119, 11–16. Citterio, S., Sgorbati, S., Levi, M., Maria Colombo, B., Sparvoli, E., 1992. PCNA and total nuclear protein content as markers of cell proliferation in pea tissue. J. Cell Sci. 102, 71–78. Di Bona, G.F., 2002. Neuropeptide Y. Am. J. Physiol. Regul. Integr. Comp. Physiol. 283, R635–R636. Dietrich, D., 1993. Toxicological and pathological applications of proliferating cell nuclear antigen (PCNA): a novel endogenous marker for cell proliferation. Crit. Rev. Toxicol. 23, 77–109. Doyle, K.L., Karl, T., Hort, Y., Duffy, L., Shine, J., Herzog, H., 2008. Y1 receptors are critical for the proliferation of adult mouse precursor cells in the olfactory neuroepithelium. J. Neurochem. 105, 641–652. Farbman, A.I., Scholz, D., Emanuel, D., Margolis, F., 1980. Maturation of olfactory receptor cell terminals. In: van der Starre, H. (Ed.), Olfaction and Taste. Information Retrieval Ltd., London, pp. 147–150. Fernández-Llario, P., Carranza, J., Mateos-Quesada, P., 1999. Sex allocation in a polygynous mammal with large litters: the wild boar. Anim. Behav. 58, 1079–1084. Fernández-Llario, P., Mateos-Quesada, P., 2005. Influence of rainfall on the breeding biology of wild boar (Sus scrofa) in a Mediterranean ecosystem. Folia Zool. 54, 240–248. Filsinger, E.E., Fabes, R.A., 1985. Odor communication, pheromones and human families. J. Marriage Fam. 47, 349–359. Foxcroft, G.R., Dixon, W.T., Novak, S., Putman, C.T., Town, S.C., Vinsky, M.D., 2006. The biological basis for prenatal programming of postnatal performance in pigs. J. Anim. Sci. 84 (Suppl), E105–E112. Fulgione, D., Rippa, D., Buglione, M., Trapanese, M., Petrelli, S., Maselli, V., 2016. Unexpected but welcome. Artificially selected traits may increase fitness in wild boar. Evol. Appl. 9, 769–776. Gaillard, J.M., Vassant, J., Klein, F., 1987. Quelques caractéristiques de la dynamique des populations de sanglier (Sus scrofa) en milieu chassé. Gibier Faune Sauvage 4, 31–47. Gesteland, R.C., Yancey, R.A., Farbman, A.I., 1982. Development of olfactory receptor neuron selectivity in the rat fetus. Neuroscience 7, 3127–3136. Green, M.R., Sambrook, J., 2012. Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Groenen, M.A.M., Archibald, A.L., Uenishi, H., Tuggle, C.K., Takeuchi, Y., Rothschild, M.F., Rogel-Gaillard, C., Park, C., Milan, D., Megens, H.-J., Li, S., Larkin, D.M., Kim, H., Frantz, L.A.F., Caccamo, M., Ahn, H., Aken, B.L., Anselmo, A., Anthon, C., Auvil, L., Badaoui, B., Beattie, C.W., Bendixen, C., Berman, D., Blecha, F., Blomberg, J., Bolund, L., Bosse, M., Botti, S., Bujie, Z., Bystrom, M., Capitanu, B., Carvalho-Silva, D., Chardon, P., Chen, C., Cheng, R., Choi, S.-H., Chow, W., Clark, R.C., Clee, C., Crooijmans, R.P.M.A., Dawson, H.D., Dehais, P., De Sapio, F., Dibbits, B., Drou, N., Du, Z.-Q., Eversole, K., Fadista, J., Fairley, S., Faraut, T., Faulkner, G.J., Fowler, K.E., Fredholm, M., Fritz, E., Gilbert, J.G.R., Giuffra, E., Gorodkin, J., Griffin, D.K., Harrow, J.L., Hayward, A., Howe, K., Hu, Z.-L., Humphray, S.J., Hunt, T., Hornshoj, H., Jeon, J.-T., Jern, P., Jones, M., Jurka, J., Kanamori, H., Kapetanovic, R., Kim, J., Kim, J.-H., Kim, K.-W., Kim, T.-H., Larson, G., Lee, K., Lee, K.-T., Leggett, R., Lewin, H.A., Li, Y., Liu, W., Loveland, J.E., Lu, Y., Lunney, J.K., Ma, J., Madsen, O., Mann, K., Matthews, L., McLaren, S., Morozumi, T., Murtaugh, M.P., Narayan, J., Truong Nguyen, D., Ni, P., Oh, S.-J., Onteru, S., Panitz, F., Park, E.-W., Park, H.-S., Pascal, G., Paudel, Y., Perez-Enciso, M., Ramirez-Gonzalez, R., Reecy, J.M., Rodriguez-Zas, S., Rohrer, G.A., Rund, L., Sang, Y., Schachtschneider, K., Schraiber, J.G., Schwartz, J., Scobie, L., Scott, C., Searle, S., Servin, B., Southey, B.R., Sperber, G., Stadler, P., Sweedler, J.V., Tafer, H., Thomsen, B., Wali, R., Wang, J., Wang, J., White, S., Xu, X., Yerle, M., Zhang, G., Zhang, J., Zhang, J., Zhao, S., Rogers, J., Churcher, C., Schook, L.B., 2012. Analyses of pig genomes provide insight into porcine demography and evolution. Nature 491, 393–398.
Acknowledgements We thank the Cilento, Vallo of Diano and Alburni National Park for providing logistical facilities, and the specialized hunters for kindly helping us with sample collection. We thank Prof. William Winlow for the English revision and the anonymous reviewers for their constructive comments.
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003
G Model ZOOL-25569; No. of Pages 5
ARTICLE IN PRESS D. Fulgione et al. / Zoology xxx (2017) xxx–xxx
Hansel, D.E., Eipper, B.A., Ronnett, G.V., 2001. Neuropeptide Y functions as a neuroproliferative factor. Nature 410, 940–944. Henderson, D.S., Banga, S.S., Grigliatti, T.A., Boyd, J.B., 1994. Mutagen sensitivity and suppression of position-effect variegation result from mutations in mus209, the Drosophila gene encoding PCNA. EMBO J. 13, 1450–1459. Hepper, P., 2015. Behavior during the prenatal period: adaptive for development and survival. Child Dev. Persp. 9, 38–43. Hepper, P.G., Waldman, B., 1992. Embryonic olfactory learning in frogs. Quart. J. Exp. Psychol. 44, 179–197. Hepper, P.G., Wells, D.L., 2006. Perinatal olfactory learning in the domestic dog. Chem. Senses 31, 207–212. Hepper, P.G., Wells, D.L., Dornan, J.C., Lynch, C., 2013. Long-term flavor recognition in humans with prenatal garlic experience. Dev. Psychobiol. 55, 568–574. Hudson, R., Distel, H., 1999. The flavor of life: perinatal development of odor and taste preferences. Schweiz. Med. Wochenschr. 129, 176–181. Huggett, A., Widdas, W.F., 1951. The relationship between mammalian foetal weight and conception age. J. Physiol. 114, 306–317. Iatropoulos, M.J., Williams, G.M., 1996. Proliferation markers. Exp. Toxicol. Pathol. 48, 175–181. Isingrini, M., Lenoir, A., Jaisson, P., 1985. Preimaginal learning as a basis of colonybrood recognition in the ant Cataglyphis cursor. Proc. Natl. Acad. Sci. USA 82, 8545–8547. Kareiva, P., Watts, S., McDonald, R., Boucher, T., 2007. Domesticated nature: shaping landscapes and ecosystems for human welfare. Science 316, 1866–1869. Kelman, Z., 1997. PCNA: structure, function, and interactions. Oncogene 14, 629–640. Kristensen, H.H., Jones, R.B., Schofield, C.P., White, R.P., Wathes, C.M., 2001. The use of olfactory and other cues for social recognition by juvenile pigs. Appl. Anim. Behav. Sci. 72, 321–333. Larson, G., Dobney, K., Albarella, U., Fang, M., Matisoo-Smith, E., Robins, J., Lowden, S., Finlayson, H., Brand, T., Willerslev, E., Rowley-Conwy, P., Andersson, L., Cooper, A., 2005. Worldwide phylogeography of wild boar reveals multiple centers of pig domestication. Science 307, 1618–1621. Lee, A.C., He, J., Ma, M., 2011. Olfactory marker protein is critical for functional maturation of olfactory sensory neurons and development of mother preference. J. Neurosci. 31, 2974–2982. Lega, C., Raia, P., Rook, L., Fulgione, D., 2015. Size matters: a comparative analysis of pig domestication. The Holocene 26, 1–6. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-CT method. Methods 25, 402–408. Maga, G., Hübscher, U., 2003. Proliferating cell nuclear antigen (PCNA): a dancer with many partners. J. Cell Sci. 116, 3051–3060. Margolis, F.L., 1972. A brain protein unique to the olfactory bulb. Proc. Natl. Acad. Sci. USA 69, 1221–1224. Maselli, V., Polese, G., Larson, G., Raia, P., Forte, N., Rippa, D., Ligrone, R., Vicidomini, R., Fulgione, D., 2014a. A dysfunctional sense of smell: the irreversibility of olfactory evolution in free-living pigs. Evol. Biol. 41, 229–239. Maselli, V., Rippa, D., Russo, G., Ligrone, R., Soppelsa, O., D’Aniello, B., Raia, P., Fulgione, D., 2014b. Wild boars’ social structure in the Mediterranean habitat. Ital. J. Zool. 81, 610–617. Maselli, V., Rippa, D., De Luca, A., Larson, G., Wilkens, B., Linderholm, A., Masseti, M., Fulgione, D., 2016. Southern Italian wild boar population, hotspot of genetic diversity. Hystrix 27, 11489. Mathews, M.B., Bernstein, R.M., Franza, B.R., Garrels, J.I., 1984. Identity of the proliferating cell nuclear antigen and cyclin. Nature 309, 374–376. McLeman, M.A., Mendl, M., Jones, R.B., White, R., Wathes, C.M., 2005. Discrimination of conspecifics by juvenile domestic pigs, Sus scrofa. Anim. Behav. 70, 451–461. McLeman, M.A., Mendl, M.T., Jones, R.B., Wathes, C.M., 2008. Social discrimination of familiar conspecifics by juvenile pigs, Sus scrofa: development of a non-invasive method to study the transmission of unimodal and bimodal cues between live stimuli. Appl Anim. Behav. Sci. 115, 123–137. Mendl, M., Randle, K., Pope, S., 2002. Young female pigs can discriminate individual differences in odours from conspecific urine. Anim. Behav. 64, 97–101.
5
Mennella, J.A., Beauchamp, G.K., 2002. Flavor experiences during formula feeding are related to preferences during childhood. Early Hum. Dev. 68, 71–82. Mennella, J.A., Jagnow, C.P., Beauchamp, G.K., 2001. Prenatal and postnatal flavor learning by human infants. Pediatrics 107, E88–E88. Montani, G., Tonelli, S., Elsaesser, R., Paysan, J., Tirindelli, R., 2006. Neuropeptide Y in the olfactory microvillar cells. Eur. J. Neurosci. 24, 20–24. Monti-Graziadei, G.A., Stanley, R.S., Graziadei, P.P.C., 1980. The olfactory marker protein in the olfactory system of the mouse during development. Neuroscience 5, 1239–1252. Morrow-Tesch, J., McGlone, J.J., 1990. Sources of maternal odors and the development of odor preferences in baby pigs. J. Anim. Sci. 68, 3563–3571. Mousley, A., Polese, G., Marks, N.J., Eisthen, H.L., 2006. Terminal nerve-derived neuropeptide Y modulates physiological responses in the olfactory epithelium of hungry axolotls (Ambystoma mexicanum). J. Neurosci. 26, 7707–7717. Nguyen, D., Lee, K., Choi, H., Choi M.-k. Le, M., Song, N., Kim, J.-H., Seo, H., Oh, J.W., Lee, K., Kim, T.-H., Park, C., 2012. The complete swine olfactory subgenome: expansion of the olfactory gene repertoire in the pig genome. BMC Genom. 13, 584. Oostindjer, M., Bolhuis, J.E., van den Brand, H., Kemp, B., 2009. Prenatal flavor exposure affects flavor recognition and stress-related behavior of piglets. Chem. Senses 34, 775–787. Oostindjer, M., Bolhuis, J.E., van den Brand, H., Roura, E., Kemp, B., 2010. Prenatal flavor exposure affects growth, health and behavior of newly weaned piglets. Physiol. Behav. 99, 579–586. Oostindjer, M., Bolhuis, J.E., Simon, K., van den Brand, H., Kemp, B., 2011. Perinatal flavour learning and adaptation to being weaned: all the pig needs is smell. PLoS ONE 6, e25318. Pearce, G.P., Hughes, P.E., 1987. An investigation of the roles of boar-component stimuli in the expression of proceptivity in the female pig. Appl. Anim. Behav. Sci. 18, 287–299. Petersen, V., Recen, B., Vestergaard, K., 1990. Behaviour of sows and piglets during farrowing under free-range conditions. Appl. Anim. Behav. Sci. 58, 267–279. Rinaldi, A., 2007. The scent of life. EMBO Rep. 8, 629–633. Rosell, C., Carretero, M.A., Bassols, E., 1998. Seguimiento de la evolución demogra´ıfica del jabalí (Sus scrofa) y efectos del incremento de presión cinegética en el Parque Natural de la Zona Volcánica de la Garrotxa. Galemys Bol. SECEM 10, 59–74. Schaal, B., Orgeur, P., 1992. Olfaction in utero: can the rodent model be generalized? Quart J. Exp. Psychol. 44, 245–278. Schaal, B., Orgeur, P., Rognon, C., 1995. Odor sensing in the human fetus: anatomical, functional and chemo-ecological bases. In: Lecanuet, J.P., Fifer, W.P., Krasnegor, N., Smotherman, W.P. (Eds.), Prenatal Development: A Psychobiological Perspective. Lawrence Erlbaum Associates, Hillsdale, NJ, pp. 205–237. Schaal, B., Marlier, L., Soussignan, R., 1998. Olfactory function in the human fetus: evidence from selective neonatal responsiveness to the odor of amniotic fluid. Behav. Neurosci. 112, 1438–1449. Schaal, B., Marlier, L., Soussignan, R., 2000. Human foetuses learn odours from their pregnant mother’s diet. Chem. Senses 25, 729–737. Schley, L., Roper, T.J., 2003. Diet of wild boar Sus scrofa in Western Europe, with particular reference to consumption of agricultural crops. Mammal. Rev. 33, 43–56. Sneddon, H., Hadden, R., Hepper, P.G., 1998. Chemosensory learning in the chicken embryo. Physiol. Behav. 64, 133–139. Sneddon, H., Hepper, P.G., Manolis, C., 2001. Embryonic chemosensory learning in the saltwater crocodile Crocodylus porosus. In: Grigg, G.C., Seebacher, F., Franklin, C.E. (Eds.), Crocodilian Biology and Evolution. Surrey Beatty, Chipping Norton, Australia, pp. 378–382. Ubink, R., Hökfelt, T., 2000. Expression of neuropeptide Y in olfactory ensheathing cells during prenatal development. J. Comp. Neurol. 423, 13–25. Varendi, H., Porter, R.H., Winberg, J., 1996. Attractiveness of amniotic fluid odor: evidence of prenatal olfactory learning? Acta Paediatr. 85, 1223–1227. Vericad, R., 1983. Estimación de la edad fetal y períodos de concepción y parto del jabalí (Sus scrofa) en los Pirineos occidentales. XV Congresso. Int. Fauna Cinegética y Silvestre, Trujillo, 811–820.
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003
ARTICLE IN PRESS
ZOOL-25569; No. of Pages 5
Zoology xxx (2017) xxx–xxx
Contents lists available at ScienceDirect
Zoology journal homepage: www.elsevier.com/locate/zool
Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa Domenico Fulgione ∗ , Martina Trapanese, Maria Buglione, Daniela Rippa, Gianluca Polese, Viviana Maresca, Valeria Maselli Department of Biology, University of Naples Federico II, Campus Monte S. Angelo, 80126 Naples, Italy
a r t i c l e
i n f o
Article history: Received 20 September 2016 Received in revised form 10 May 2017 Accepted 10 May 2017 Available online xxx Keywords: Sus scrofa Olfactory sensory neurons Pre-birth learning
a b s t r a c t Animals recognize their surrounding environments through the sense of smell by detecting thousands of chemical odorants. Wild boars (Sus scrofa) completely depend on their ability to recognize chemical odorants: to detect food, during scavenging and searching partners, during breeding periods and to avoid potential predators. Wild piglets must be prepared for the chemical universe that they will enter after birth, and they show intense neuronal activity in the olfactory mucosa. With this in mind, we investigated the morpho-functional embryonic development of the olfactory mucosa in the wild boar (in five stages before birth). Using mRNA expression analysis of olfactory marker protein and neuropeptide Y, involved in the function of olfactory sensory neurons, we show early activation of the appropriate genes in the wild boar. We hypothesize olfactory pre-birth development in wild boar is highly adaptive. © 2017 Elsevier GmbH. All rights reserved.
1. Introduction Olfaction plays a central role in wildlife adaptation, representing the most important and crucial sense for most mammals through a complex pathway starting in the olfactory epithelium (Nguyen et al., 2012). The relevance of olfaction during searching for food and intraspecific communication has been extensively investigated (Filsinger and Fabes, 1985; Rinaldi, 2007). Furthermore, even before birth, maternal amniotic odor can stimulate the fetus, particularly in kin recognition (Schaal and Orgeur, 1992), but the exact mechanism has not yet been elucidated. Young animals can start learning which food types are healthy and nutritious from the mother before weaning (Oostindjer et al., 2011) and even before birth. In humans, at about 30 weeks amniotic fluid flows through the nasal and oral cavities to help the fetus “to smell” (Schaal et al., 1995); before that time tissues plug up the nasal cavities. It has also been observed that there is a highly selective neonatal response to familiar amniotic fluid odors, consistent with the hypothesis of detection and storage of the unique chemosensory information available to the fetus in the prenatal environment (Schaal et al., 1998). Interestingly, domestic piglets are most attracted to the odors associated with maternal feces and skin secretions at 12 h of age with a very acute ability to discriminate between mother and non-mother odors (Morrow-Tesch and McGlone, 1990). In sev-
∗ Corresponding author. E-mail address: [email protected] (D. Fulgione).
eral non-human mammals, the fetus is capable of olfactory learning and in some species neonates are attracted to the odor of amniotic fluid as a consequence of fetal exposure (i.e. prenatal olfactory learning) (Varendi et al., 1996). Studies on prenatal flavor learning have shown that the offspring of several species, such as humans and rats, show a preference to, or reduced aversion against, flavors to which they have been exposed before birth (Bilko et al., 1994; Hudson and Distel, 1999; Schaal et al., 2000; Mennella et al., 2001). A cross-species comparison among humans, rodents and sheep confirmed fetal olfactory learning (Schaal and Orgeur, 1992). In the porcine genome a large olfactory receptor gene family has been found: over 1,301 olfactory receptor genes and 343 partial olfactory receptor genes (Groenen et al., 2012). This large number of genes could explain the ability to perceive a large spectrum of odors in Sus, implying a strong reliance on abilities such as scavenging for food or looking for a mate, for both the pig and the wild boar (Pearce and Hughes, 1987; Kristensen et al., 2001; Mendl et al., 2002; McLeman et al., 2005, 2008). The wild boar is the most widespread ungulate in the world (Larson et al., 2005). Since the 1960s, wild boars have undergone a worldwide population expansion that has increased their overall geographic distribution as well as their population density in many areas within their range (Apollonio et al., 2010; Maselli et al., 2016). This spectacular demographic expansion was due to its adaptability (Rosell et al., 1998; Fulgione et al., 2016), its ability to invade different environments almost indiscriminately and human introduction (Abaigar et al., 1994; Baskin and Danell, 2003; Schley and Roper, 2003; Acevedo et al., 2006; Maselli et al., 2014b). It is impor-
http://dx.doi.org/10.1016/j.zool.2017.05.003 0944-2006/© 2017 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003
G Model ZOOL-25569; No. of Pages 5
ARTICLE IN PRESS D. Fulgione et al. / Zoology xxx (2017) xxx–xxx
2
tant to point out that the two Sus scrofa forms dwell in very different habitats: wild boar inhabits forest and natural habitats, whereas pig lives in a man-made environment, depleted of biodiversity and offering fewer sensory stimuli (Kareiva et al., 2007). Probably domestication affects the olfactory abilities of some species, especially with respect to the detection and processing of environmental odorants in the female (Bisch-Knaden et al., 2014). In some mammals, there has been a strong reduction in the sense of smell and of brain size associated with domestication (Lega et al., 2015; Maselli et al., 2014b). Therefore, it seems that wild piglets, when compared with domestic pigs, must be ready for the chemical universe they will inhabit. Here we report for the first time on differences in the morpho-functional dynamics of the prenatal olfactory mucosa in the wild boar. 2. Materials and methods 2.1. Sample collection Data on the litter size of wild boar are not easy to obtain because field observations can be inaccurate or incorrect, so hunted animals (especially pregnant) were used in our study (see also Gaillard et al., 1987; Fernández-Llario et al., 1999; Fernández-Llario and MateosQuesada, 2005; Maselli et al., 2016). In developing these studies, sows must be sacrificed without knowing whether or not they are pregnant and which developmental stage the fetuses have reached. This makes it very difficult to collect data according to a precise time sequence. In the present study, the age of fetuses was defined after shooting by their weight (± 0.01 g). Given a suid gestation period of 120 days (Vericad, 1983), the age of the fetuses (T) in days was determined using the Vericad formula established in the wild boar by Huggett and Widdas (1951): T = (Ps1/3 + 2.337)/0.097, where Ps is the average fresh weight (g) of the fetus within the litter (Vericad, 1983). We analyzed 25 wild boar fetuses, all from different litters, 5 for each developmental stage. Our activities were carried out in the Cilento, Vallo di Diano and Alburni National Park (CVD, South Italy, 181,000 ha) in accordance with Italian national laws (157/92 and 394/91 Laws). All field protocols were approved by the Ministry of Environment (ISPRA, prot. n 24581 20/07/2014). The animals studied originated from a culling plan carried out in the National Park to control wild boar abundance and were culled by specialized hunters. 2.2. Hybridization assay In Sus scrofa hybridization between wild and domestic forms may locally reach high levels, as observed in some populations in Italy. In order to separate any hybrids in our samples, we used the melanocortin receptor 1 (MC1R) locus as genetic maker associated with introgression and hybridization (Fulgione et al., 2016). From each wild boar sample, we extracted total genomic DNA by using the QIAamp DNA Mini Kit (QIAGEN, Valencia, CA, USA), according to the manufacturer’s instructions. The entire coding region of the MC1R gene was amplified and sequenced by using primer combinations (Maselli et al., 2014a). All sequences were compared with the wild-type references (accession number KF780580; Fulgione et al., 2016) and all wild boar samples with one or more mutations were defined as hybrids and not considered in subsequent analyses. 2.3. RNA extraction Olfactory mucosa sections were collected from fresh samples, isolating the whole olfactory epithelium using the RNAlater RNA Stabilization Reagent (QIAGEN) for immediate stabilization of RNA in tissues.
Table 1 Sequence of primers and size of amplicons used in the semi-quantitative and quantitative PCR. NPY, neuropeptide Y; OMP, olfactory marker protein; ActB, beta-actin; PCNA, proliferating cell nuclear antigen. Primer
Sequence 5 –3
Amplicon size
NPY − Forward NPY − Reverse OMP − Forward OMP − Reverse ActB − Forward ActB − Reverse PCNA − Forward PCNA − Reverse
CTCGGCGTTGAGACATTACA CACTTCCCATCACCACACAG ACCTCACCAACCTCATGACC CCCGAAGGAGATGAGGAAAT AGAGCGCAAGTACTCCGTGT AAAGCCATGCCAATCTCATC AGTGAGAAGGCCTGGCAGTA CTTTGCAGCCAATCTCCTTC
157 bp 170 bp 210 bp 222 bp
Total RNA was extracted from the olfactory epithelium using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s instructions, and genomic DNA contamination was eliminated by using RNase-free DNase (QIAGEN) for 15 min. The RNA concentration and purity were quantified using NanoDrop 2000c (Thermo Scientific, Wilmington, DE, USA) and we selected pure total RNA with an A260/A280 ratio of 2 ± 0.2. The quality was determined by 1% agarose gel electrophoresis. The reverse transcription of 2 g total RNA to cDNA was carried out using the Access RT-PCR System Kit (Promega, Fitchburg, WI, USA). Cycling parameters included a single-step cycle at 45 ◦ C for 45 min followed by 95 ◦ C for 2 min. 2.4. Gene expression We assayed the variation in gene expression of the olfactory marker protein (OMP), neuropeptide Y (NPY), and the proliferating cell nuclear antigen (PCNA) by using the primers described in Table 1. OMP is a protein involved in signal transduction, found in mature olfactory receptor neurons of all vertebrates and is a modulator of the olfactory signal-transduction cascade. OMP is starting to become expressed by mature primary olfactory sensory neurons as early as during development in mice (Farbman et al., 1980; Monti-Graziadei et al., 1980; Lee et al., 2011). NPY is a 36 amino acid peptide that mediates its action via six identified G-proteincoupled (Y1–6) receptors. In the peripheral olfactory system NPY is expressed in sustentacular cells (Hansel et al., 2001), a subpopulation of the microvillar cells (Montani et al., 2006), in the olfactory ensheathing glia (Ubink and Hökfelt, 2000), and in the nervus terminalis where it appears to modulate the olfactory epithelial activity of hungry animals (Mousley et al., 2006). It participates in the regulation of hunger, and in the modulation of the vasoconstrictor response triggered by noradrenergic neurons (Di Bona, 2002). A significant reduction in the olfactory neuronal precursor proliferation occurs in NPY-deficient mice (Hansel et al., 2001) and in NPY Y1 receptor knockout mice (Doyle et al., 2008). Thus, NPY is a good candidate neurotrophic factor with which to test our hypothesis on the differential sense of smell in Sus scrofa. PCNA plays an essential role in multiple cell cycle pathways, including DNA replication, DNA elongation and DNA excision repair (Kelman, 1997). PCNA is required throughout development and maternally encoded PCNA is essential for embryogenesis (Henderson et al., 1994). PCNA is highly conserved and has been identified in a range of eukaryotes (Kelman, 1997). PCNA expression provides a useful endogenous molecular marker to monitor cell proliferation in various types of tissues (Citterio et al., 1992; Dietrich, 1993; Iatropoulos and Williams, 1996; Chieffi et al., 2000). We analyzed a fragment of 170 bp of the coding region of the OMP gene, 157 bp of the coding region of the NPY gene and 220 bp of the coding region of the PCNA gene. For each experiment, data were normalized to the expression of the Actin B (ActB) housekeeping gene. Each sample was tested and run in duplicate.
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003
G Model ZOOL-25569; No. of Pages 5
ARTICLE IN PRESS D. Fulgione et al. / Zoology xxx (2017) xxx–xxx
3
Fig. 1. Expression level of functional markers in fetuses of wild boar at various stages: olfactory marker protein (OMP) and neuropeptide Y (NPY) in the olfactory mucosa; a marker of cell proliferation (proliferating cell nuclear antigen, PCNA); beta-actin (ActB), used as a normalizer. The box to the right shows quantitative gene expression, by real time PCR, for NPY and OMP just before birth.
We performed a semi-quantitative polymerase chain reaction (PCR) on all wild boar RNA extracted using 30 cycles at 94 ◦ C for 30 s, 60 ◦ C for 1 min and 68 ◦ C for 2 min. A final extension step was performed at 68 ◦ C for 7 min. PCR products were visualized by 1.5% agarose gel electrophoresis by staining with ethidium bromide, and then the relative brightness of each amplicon (band) was quantified using image analysis software (Green and Sambrook, 2012). To assay the relative amount of mRNA of the two considered markers of olfaction, we performed a quantitative reverse transcription (RT)-PCR in wild boar at the end of the gestation period, using the PCR cycler Rotor-Gene Q (QIAGEN) with 2 x Rotor-Gene SYBR Green Mix (QIAGEN) including 1 M forward and reverse primers with 0.1 g cDNA per reaction. The PCR cycling profile consisted of a cycle at 95 ◦ C for 30 s and 45 three-step cycles at 95 ◦ C for 15 s, at 60 ◦ C for 30 s and at 72 ◦ C for 20 s. Quantitative RT-PCR analysis was conducted by using the 2(−DC(T)) method (Livak and Schmittgen, 2001). As negative controls, “no reverse transcriptase” and “no template” samples were tested and confirmed to be negative. Amplification curves, melting curves, and cycle threshold values (Ct values) were analyzed using Rotor-Gene Q Series Software (QIAGEN). Ct values were presented as means ± SEM. All PCR products were confirmed by electrophoresis using 1% agarose gels with 0.1 mg/ml ethidium bromide for nonspecific amplification with negative controls.
3. Results In wild boar, we observed a morphological development of the fetus similar to that of the pig fetus (Foxcroft et al., 2006). The formation of eyelids and the external ears or pinnae started on the 74th day while the olfactory mucosa was found even at the earliest stages. Moreover, development of the head was enhanced in the rostral region (Fig. 1). Even at the earliest developmental stage studied here (day 53), the olfactory organ was already organized as a potentially functional epithelium within the nasal cavity. The semi-quantitative PCR on the mRNA of the olfactory mucosa showed an increase of OMP and NPY transcripts in the growth stages, from day 53 up to day 110. However, this was more evident for OMP than NPY mRNA transcripts, the latter showing a relative decline from day 74 onwards. PCNA had a uniform distribution at all stages, indicating continuous cell proliferation without significant changes of expression (Fig. 1). Moreover, the differential expression of OMP and NPY genes was analyzed by real-time PCR on RNA from the olfactory mucosa samples before and at birth (day 110), using actin expression to normalize the amount of mRNA in NPY and OMP (Fig. 1). OMP was expressed three times as much as actin, NPY 1.8 times as much (Fig. 1)
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003
G Model ZOOL-25569; No. of Pages 5
ARTICLE IN PRESS D. Fulgione et al. / Zoology xxx (2017) xxx–xxx
4
4. Discussion
References
Many studies have examined prenatal, perinatal and postnatal flavor learning in invertebrate and vertebrate groups (Brannon, 1972; Isingrini et al., 1985; Caubet et al., 1992; Hepper and Waldman, 1992; Sneddon et al., 1998; Schaal et al., 2000; Sneddon et al., 2001; Hepper and Wells, 2006; Hepper et al., 2013; Hepper, 2015), pig included (Oostindjer et al., 2009, 2010, 2011). However, little is known about the development of the prenatal olfactory system in wild boar. In our work we contribute to understanding this fascinating topic with a molecular approach considering gene expression. In our earlier work (Maselli et al., 2014a) we showed a higher olfactory ability in wild boar than in pig and free living pig, using functional gene markers. Using the same markers, now we shed new light on the pre-birth functionality of the olfactory mucosa. The constant diffuse presence of PCNA transcripts during embryogenesis reveals that it is a period of active cell proliferation (Mathews et al., 1984; Henderson et al., 1994; Maga and Hübscher, 2003). Within the olfactory mucosa, cell proliferation seems to occur while the olfactory sensory neurons mature as demonstrated by the presence of OMP and NPY transcripts. The presence of transcripts suggests that “the sense of smell” in wild boar is evident already at an early stage (day 53). In the rat, where the gestation period is about 22–23 days, OMP is reported to first appear in the receptors at day 21 (93% of the gestation period) (Gesteland et al., 1982), and strong NPY mRNA expression was found only at day 20 (89% of its gestation period) (Ubink and Hökfelt, 2000), i.e. both at the final stage of prenatal development. In the wild boar (120 days of gestation) the presence of transcripts of NPY and OMP at day 53 (44% of the gestation period) is rather precocious as compared to other mammals. Even though both OMP and NPY transcripts are present in all stages examined, the expression level of OMP increases more than that of NPY throughout pregnancy as quantified in the final stage (Fig. 1). Given that OMP is strictly related to the olfactory sensor neurons’ maturity and functionality (Margolis, 1972; Lee et al., 2011) our results can be interpreted in the light of prenatal learning in the amniotic fluid (Varendi et al., 1996). This chemical preknowledge acquired before birth will be refined by the behaviors and the parental care of the sow during the post-natal period, as in the case of piglets that repeatedly contacted the mother’s snout while she was eating (Petersen et al., 1990). Flavor in the amniotic fluid is very attractive and positive for young animals because it is in association with the mother’s positive context (Schaal et al., 1995; Mennella and Beauchamp, 2002; Arias and Chotro, 2007). In fact, young animals will more readily accept foods containing flavors to which they have been exposed via the maternal diet, before and after birth. In pigs, flavor learning has a positive effect on piglet growth, food intake, and behavior, reducing stress during re-exposure in a challenging environment (Oostindjer et al., 2011). Our data for the prenatal stage confirm other studies on prenatal, perinatal and postnatal flavor learning in pigs (Oostindjer et al., 2009, 2010, 2011). This potential pre-knowledge of the chemical environment into which the animal is born may confer an increased fitness and also may be the basis for the rapid expansion of wild boar populations in different and continuously changing environments (Bieber and Ruf, 2005).
Abaigar, T., del Barrio, G., Vericard, J.R., 1994. Habitat preference of wild boar (Sus scrofa L., 1758) in a Mediterranean environment. Indirect evaluation by signs. Mammalia 58, 201–210. Acevedo, P., Escudero, M.A., Munoz, R., Gorta´ızar, C., 2006. Factors affecting wild boar abundance across an environmental gradient in Spain. Acta Theriol. 51, 327–336. Apollonio, M., Andersen, R., Putman, R., 2010. European Ungulates and their Management in the 21st Century. Cambridge University Press, Cambridge. Arias, C., Chotro, M.G., 2007. Amniotic fluid can act as an appetitive unconditioned stimulus in preweanling rats. Dev. Psychobiol. 49, 139–149. Baskin, L.M., Danell, K., 2003. Ecology of Ungulates: A Handbook of Species in Eastern Europe and Northern and Central Asia. Springer-Verlag, Berlin. Bieber, C., Ruf, T., 2005. Population dynamics in wild boar Sus scrofa: ecology, elasticity of growth rate and implications for the management of pulsed resource consumers. J. Appl. Ecol. 42, 1203–1213. Bilko, A., Altbacker, V., Hudson, R., 1994. Transmission of food preference in the rabbit: the means of information transfer. Physiol. Behav. 56, 907–912. Bisch-Knaden, S., Daimon, T., Shimada, T., Hansson, B.S., Sachse, S., 2014. Anatomical and functional analysis of domestication effects on the olfactory system of the silkmoth Bombyx mori. Proc. R. Soc. Lond. B 281, 20132582. Brannon, E.L., 1972. Mechanisms controlling migration of sockeye salmon fry. Int. Proc. Salmon Fish Comm. Bull. 21, 1–86. Caubet, Y., Jaisson, P., Lenoir, A., 1992. Preimaginal induction of adult behaviour in insects. Q. J. Exp. Psychol. B 44, 165–178. Chieffi, P., Franco, R., Fulgione, D., Staibano, S., 2000. PCNA in the testis of the frog, Rana esculenta: a molecular marker of the mitotic testicular epithelium proliferation. Gen. Comp. Endocrinol. 119, 11–16. Citterio, S., Sgorbati, S., Levi, M., Maria Colombo, B., Sparvoli, E., 1992. PCNA and total nuclear protein content as markers of cell proliferation in pea tissue. J. Cell Sci. 102, 71–78. Di Bona, G.F., 2002. Neuropeptide Y. Am. J. Physiol. Regul. Integr. Comp. Physiol. 283, R635–R636. Dietrich, D., 1993. Toxicological and pathological applications of proliferating cell nuclear antigen (PCNA): a novel endogenous marker for cell proliferation. Crit. Rev. Toxicol. 23, 77–109. Doyle, K.L., Karl, T., Hort, Y., Duffy, L., Shine, J., Herzog, H., 2008. Y1 receptors are critical for the proliferation of adult mouse precursor cells in the olfactory neuroepithelium. J. Neurochem. 105, 641–652. Farbman, A.I., Scholz, D., Emanuel, D., Margolis, F., 1980. Maturation of olfactory receptor cell terminals. In: van der Starre, H. (Ed.), Olfaction and Taste. Information Retrieval Ltd., London, pp. 147–150. Fernández-Llario, P., Carranza, J., Mateos-Quesada, P., 1999. Sex allocation in a polygynous mammal with large litters: the wild boar. Anim. Behav. 58, 1079–1084. Fernández-Llario, P., Mateos-Quesada, P., 2005. Influence of rainfall on the breeding biology of wild boar (Sus scrofa) in a Mediterranean ecosystem. Folia Zool. 54, 240–248. Filsinger, E.E., Fabes, R.A., 1985. Odor communication, pheromones and human families. J. Marriage Fam. 47, 349–359. Foxcroft, G.R., Dixon, W.T., Novak, S., Putman, C.T., Town, S.C., Vinsky, M.D., 2006. The biological basis for prenatal programming of postnatal performance in pigs. J. Anim. Sci. 84 (Suppl), E105–E112. Fulgione, D., Rippa, D., Buglione, M., Trapanese, M., Petrelli, S., Maselli, V., 2016. Unexpected but welcome. Artificially selected traits may increase fitness in wild boar. Evol. Appl. 9, 769–776. Gaillard, J.M., Vassant, J., Klein, F., 1987. Quelques caractéristiques de la dynamique des populations de sanglier (Sus scrofa) en milieu chassé. Gibier Faune Sauvage 4, 31–47. Gesteland, R.C., Yancey, R.A., Farbman, A.I., 1982. Development of olfactory receptor neuron selectivity in the rat fetus. Neuroscience 7, 3127–3136. Green, M.R., Sambrook, J., 2012. Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Groenen, M.A.M., Archibald, A.L., Uenishi, H., Tuggle, C.K., Takeuchi, Y., Rothschild, M.F., Rogel-Gaillard, C., Park, C., Milan, D., Megens, H.-J., Li, S., Larkin, D.M., Kim, H., Frantz, L.A.F., Caccamo, M., Ahn, H., Aken, B.L., Anselmo, A., Anthon, C., Auvil, L., Badaoui, B., Beattie, C.W., Bendixen, C., Berman, D., Blecha, F., Blomberg, J., Bolund, L., Bosse, M., Botti, S., Bujie, Z., Bystrom, M., Capitanu, B., Carvalho-Silva, D., Chardon, P., Chen, C., Cheng, R., Choi, S.-H., Chow, W., Clark, R.C., Clee, C., Crooijmans, R.P.M.A., Dawson, H.D., Dehais, P., De Sapio, F., Dibbits, B., Drou, N., Du, Z.-Q., Eversole, K., Fadista, J., Fairley, S., Faraut, T., Faulkner, G.J., Fowler, K.E., Fredholm, M., Fritz, E., Gilbert, J.G.R., Giuffra, E., Gorodkin, J., Griffin, D.K., Harrow, J.L., Hayward, A., Howe, K., Hu, Z.-L., Humphray, S.J., Hunt, T., Hornshoj, H., Jeon, J.-T., Jern, P., Jones, M., Jurka, J., Kanamori, H., Kapetanovic, R., Kim, J., Kim, J.-H., Kim, K.-W., Kim, T.-H., Larson, G., Lee, K., Lee, K.-T., Leggett, R., Lewin, H.A., Li, Y., Liu, W., Loveland, J.E., Lu, Y., Lunney, J.K., Ma, J., Madsen, O., Mann, K., Matthews, L., McLaren, S., Morozumi, T., Murtaugh, M.P., Narayan, J., Truong Nguyen, D., Ni, P., Oh, S.-J., Onteru, S., Panitz, F., Park, E.-W., Park, H.-S., Pascal, G., Paudel, Y., Perez-Enciso, M., Ramirez-Gonzalez, R., Reecy, J.M., Rodriguez-Zas, S., Rohrer, G.A., Rund, L., Sang, Y., Schachtschneider, K., Schraiber, J.G., Schwartz, J., Scobie, L., Scott, C., Searle, S., Servin, B., Southey, B.R., Sperber, G., Stadler, P., Sweedler, J.V., Tafer, H., Thomsen, B., Wali, R., Wang, J., Wang, J., White, S., Xu, X., Yerle, M., Zhang, G., Zhang, J., Zhang, J., Zhao, S., Rogers, J., Churcher, C., Schook, L.B., 2012. Analyses of pig genomes provide insight into porcine demography and evolution. Nature 491, 393–398.
Acknowledgements We thank the Cilento, Vallo of Diano and Alburni National Park for providing logistical facilities, and the specialized hunters for kindly helping us with sample collection. We thank Prof. William Winlow for the English revision and the anonymous reviewers for their constructive comments.
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003
G Model ZOOL-25569; No. of Pages 5
ARTICLE IN PRESS D. Fulgione et al. / Zoology xxx (2017) xxx–xxx
Hansel, D.E., Eipper, B.A., Ronnett, G.V., 2001. Neuropeptide Y functions as a neuroproliferative factor. Nature 410, 940–944. Henderson, D.S., Banga, S.S., Grigliatti, T.A., Boyd, J.B., 1994. Mutagen sensitivity and suppression of position-effect variegation result from mutations in mus209, the Drosophila gene encoding PCNA. EMBO J. 13, 1450–1459. Hepper, P., 2015. Behavior during the prenatal period: adaptive for development and survival. Child Dev. Persp. 9, 38–43. Hepper, P.G., Waldman, B., 1992. Embryonic olfactory learning in frogs. Quart. J. Exp. Psychol. 44, 179–197. Hepper, P.G., Wells, D.L., 2006. Perinatal olfactory learning in the domestic dog. Chem. Senses 31, 207–212. Hepper, P.G., Wells, D.L., Dornan, J.C., Lynch, C., 2013. Long-term flavor recognition in humans with prenatal garlic experience. Dev. Psychobiol. 55, 568–574. Hudson, R., Distel, H., 1999. The flavor of life: perinatal development of odor and taste preferences. Schweiz. Med. Wochenschr. 129, 176–181. Huggett, A., Widdas, W.F., 1951. The relationship between mammalian foetal weight and conception age. J. Physiol. 114, 306–317. Iatropoulos, M.J., Williams, G.M., 1996. Proliferation markers. Exp. Toxicol. Pathol. 48, 175–181. Isingrini, M., Lenoir, A., Jaisson, P., 1985. Preimaginal learning as a basis of colonybrood recognition in the ant Cataglyphis cursor. Proc. Natl. Acad. Sci. USA 82, 8545–8547. Kareiva, P., Watts, S., McDonald, R., Boucher, T., 2007. Domesticated nature: shaping landscapes and ecosystems for human welfare. Science 316, 1866–1869. Kelman, Z., 1997. PCNA: structure, function, and interactions. Oncogene 14, 629–640. Kristensen, H.H., Jones, R.B., Schofield, C.P., White, R.P., Wathes, C.M., 2001. The use of olfactory and other cues for social recognition by juvenile pigs. Appl. Anim. Behav. Sci. 72, 321–333. Larson, G., Dobney, K., Albarella, U., Fang, M., Matisoo-Smith, E., Robins, J., Lowden, S., Finlayson, H., Brand, T., Willerslev, E., Rowley-Conwy, P., Andersson, L., Cooper, A., 2005. Worldwide phylogeography of wild boar reveals multiple centers of pig domestication. Science 307, 1618–1621. Lee, A.C., He, J., Ma, M., 2011. Olfactory marker protein is critical for functional maturation of olfactory sensory neurons and development of mother preference. J. Neurosci. 31, 2974–2982. Lega, C., Raia, P., Rook, L., Fulgione, D., 2015. Size matters: a comparative analysis of pig domestication. The Holocene 26, 1–6. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-CT method. Methods 25, 402–408. Maga, G., Hübscher, U., 2003. Proliferating cell nuclear antigen (PCNA): a dancer with many partners. J. Cell Sci. 116, 3051–3060. Margolis, F.L., 1972. A brain protein unique to the olfactory bulb. Proc. Natl. Acad. Sci. USA 69, 1221–1224. Maselli, V., Polese, G., Larson, G., Raia, P., Forte, N., Rippa, D., Ligrone, R., Vicidomini, R., Fulgione, D., 2014a. A dysfunctional sense of smell: the irreversibility of olfactory evolution in free-living pigs. Evol. Biol. 41, 229–239. Maselli, V., Rippa, D., Russo, G., Ligrone, R., Soppelsa, O., D’Aniello, B., Raia, P., Fulgione, D., 2014b. Wild boars’ social structure in the Mediterranean habitat. Ital. J. Zool. 81, 610–617. Maselli, V., Rippa, D., De Luca, A., Larson, G., Wilkens, B., Linderholm, A., Masseti, M., Fulgione, D., 2016. Southern Italian wild boar population, hotspot of genetic diversity. Hystrix 27, 11489. Mathews, M.B., Bernstein, R.M., Franza, B.R., Garrels, J.I., 1984. Identity of the proliferating cell nuclear antigen and cyclin. Nature 309, 374–376. McLeman, M.A., Mendl, M., Jones, R.B., White, R., Wathes, C.M., 2005. Discrimination of conspecifics by juvenile domestic pigs, Sus scrofa. Anim. Behav. 70, 451–461. McLeman, M.A., Mendl, M.T., Jones, R.B., Wathes, C.M., 2008. Social discrimination of familiar conspecifics by juvenile pigs, Sus scrofa: development of a non-invasive method to study the transmission of unimodal and bimodal cues between live stimuli. Appl Anim. Behav. Sci. 115, 123–137. Mendl, M., Randle, K., Pope, S., 2002. Young female pigs can discriminate individual differences in odours from conspecific urine. Anim. Behav. 64, 97–101.
5
Mennella, J.A., Beauchamp, G.K., 2002. Flavor experiences during formula feeding are related to preferences during childhood. Early Hum. Dev. 68, 71–82. Mennella, J.A., Jagnow, C.P., Beauchamp, G.K., 2001. Prenatal and postnatal flavor learning by human infants. Pediatrics 107, E88–E88. Montani, G., Tonelli, S., Elsaesser, R., Paysan, J., Tirindelli, R., 2006. Neuropeptide Y in the olfactory microvillar cells. Eur. J. Neurosci. 24, 20–24. Monti-Graziadei, G.A., Stanley, R.S., Graziadei, P.P.C., 1980. The olfactory marker protein in the olfactory system of the mouse during development. Neuroscience 5, 1239–1252. Morrow-Tesch, J., McGlone, J.J., 1990. Sources of maternal odors and the development of odor preferences in baby pigs. J. Anim. Sci. 68, 3563–3571. Mousley, A., Polese, G., Marks, N.J., Eisthen, H.L., 2006. Terminal nerve-derived neuropeptide Y modulates physiological responses in the olfactory epithelium of hungry axolotls (Ambystoma mexicanum). J. Neurosci. 26, 7707–7717. Nguyen, D., Lee, K., Choi, H., Choi M.-k. Le, M., Song, N., Kim, J.-H., Seo, H., Oh, J.W., Lee, K., Kim, T.-H., Park, C., 2012. The complete swine olfactory subgenome: expansion of the olfactory gene repertoire in the pig genome. BMC Genom. 13, 584. Oostindjer, M., Bolhuis, J.E., van den Brand, H., Kemp, B., 2009. Prenatal flavor exposure affects flavor recognition and stress-related behavior of piglets. Chem. Senses 34, 775–787. Oostindjer, M., Bolhuis, J.E., van den Brand, H., Roura, E., Kemp, B., 2010. Prenatal flavor exposure affects growth, health and behavior of newly weaned piglets. Physiol. Behav. 99, 579–586. Oostindjer, M., Bolhuis, J.E., Simon, K., van den Brand, H., Kemp, B., 2011. Perinatal flavour learning and adaptation to being weaned: all the pig needs is smell. PLoS ONE 6, e25318. Pearce, G.P., Hughes, P.E., 1987. An investigation of the roles of boar-component stimuli in the expression of proceptivity in the female pig. Appl. Anim. Behav. Sci. 18, 287–299. Petersen, V., Recen, B., Vestergaard, K., 1990. Behaviour of sows and piglets during farrowing under free-range conditions. Appl. Anim. Behav. Sci. 58, 267–279. Rinaldi, A., 2007. The scent of life. EMBO Rep. 8, 629–633. Rosell, C., Carretero, M.A., Bassols, E., 1998. Seguimiento de la evolución demogra´ıfica del jabalí (Sus scrofa) y efectos del incremento de presión cinegética en el Parque Natural de la Zona Volcánica de la Garrotxa. Galemys Bol. SECEM 10, 59–74. Schaal, B., Orgeur, P., 1992. Olfaction in utero: can the rodent model be generalized? Quart J. Exp. Psychol. 44, 245–278. Schaal, B., Orgeur, P., Rognon, C., 1995. Odor sensing in the human fetus: anatomical, functional and chemo-ecological bases. In: Lecanuet, J.P., Fifer, W.P., Krasnegor, N., Smotherman, W.P. (Eds.), Prenatal Development: A Psychobiological Perspective. Lawrence Erlbaum Associates, Hillsdale, NJ, pp. 205–237. Schaal, B., Marlier, L., Soussignan, R., 1998. Olfactory function in the human fetus: evidence from selective neonatal responsiveness to the odor of amniotic fluid. Behav. Neurosci. 112, 1438–1449. Schaal, B., Marlier, L., Soussignan, R., 2000. Human foetuses learn odours from their pregnant mother’s diet. Chem. Senses 25, 729–737. Schley, L., Roper, T.J., 2003. Diet of wild boar Sus scrofa in Western Europe, with particular reference to consumption of agricultural crops. Mammal. Rev. 33, 43–56. Sneddon, H., Hadden, R., Hepper, P.G., 1998. Chemosensory learning in the chicken embryo. Physiol. Behav. 64, 133–139. Sneddon, H., Hepper, P.G., Manolis, C., 2001. Embryonic chemosensory learning in the saltwater crocodile Crocodylus porosus. In: Grigg, G.C., Seebacher, F., Franklin, C.E. (Eds.), Crocodilian Biology and Evolution. Surrey Beatty, Chipping Norton, Australia, pp. 378–382. Ubink, R., Hökfelt, T., 2000. Expression of neuropeptide Y in olfactory ensheathing cells during prenatal development. J. Comp. Neurol. 423, 13–25. Varendi, H., Porter, R.H., Winberg, J., 1996. Attractiveness of amniotic fluid odor: evidence of prenatal olfactory learning? Acta Paediatr. 85, 1223–1227. Vericad, R., 1983. Estimación de la edad fetal y períodos de concepción y parto del jabalí (Sus scrofa) en los Pirineos occidentales. XV Congresso. Int. Fauna Cinegética y Silvestre, Trujillo, 811–820.
Please cite this article in press as: Fulgione, D., et al., Pre-birth sense of smell in the wild boar: the ontogeny of the olfactory mucosa. Zoology (2017), http://dx.doi.org/10.1016/j.zool.2017.05.003