- Email: [email protected]
Precision-cut hamster liver slices as an ex vivo model to study amoebic liver abscess
Experimental Parasitology 126 (2010) 117–125
Contents lists available at ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Precision-cut hamster liver slices as an ex vivo model to study amoebic liver abscess Pilar Carranza-Rosales a,*, María Guadalupe Santiago-Mauricio a, Nancy Elena Guzmán-Delgado b, Javier Vargas-Villarreal a, Gerardo Lozano-Garza a, Javier Ventura-Juárez c, Isaías Balderas-Rentería a, Javier Morán-Martínez a, A. Jay Gandolfi d a División de Biología Celular y Molecular, Centro de Investigación Biomédica del Noreste, Instituto Mexicano del Seguro Social, Administración de Correos No. 4, Apartado Postal 020, Colonia Independencia, Monterrey, NL, CP 64720, Mexico b Departamento de Patología, Unidad Médica de Alta Especialidad # 34, Instituto Mexicano del Seguro Social, Monterrey, N L, CP 64730, Mexico c Departamento de Morfología, Centro de Ciencias Básicas, Universidad Autónoma de Aguascalientes, CP 20131, Aguascalientes, Ags, Mexico d Department of Pharmacology and Toxicology, University of Arizona, 1723 E. Mabel Street, Tucson, AZ 85724, USA
a r t i c l e
i n f o
Article history: Received 7 January 2010 Received in revised form 22 March 2010 Accepted 12 April 2010 Available online 20 April 2010 Keywords: Entamoeba histolytica Protozoa Hamster Liver slices Ex vivo model Amoebic liver abscess
a b s t r a c t Entamoeba histolytica is the etiological agent of amoebiasis, the second cause of global morbidity and mortality due to parasitic diseases in humans. In approximately 1% of the cases, amoebas penetrate the intestinal mucosa and spread to other organs, producing extra-intestinal lesions, among which amoebic liver abscess (ALA) is the most common. To study ALA, in vivo and in vitro models are used. However, animal models may pose ethical issues, and are time-consuming and costly; and cell cultures represent isolated cellular lineages. The present study reports the infection of precision-cut hamster liver slices with Entamoeba histolytica trophozoites. The infection time-course, including tissue damage, parallels findings previously reported in the animal model. At the same time amoebic virulence factors were detected in the infected slices. This new model to study ALA is simple and reproducible, and employs less than 1/3 of the hamsters required for in vivo analyses. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Amoebiasis is the infection caused by Entamoeba histolytica and is the second cause of global morbidity and mortality due to parasitic diseases in humans. It causes more than 100,000 deaths each year and is responsible for 50 million cases of diarrhea each year (WHO, 2009; Huston, 2004). E. histolytica inhabits the large intestine, but approximately in 1% of the cases, trophozoites penetrate the intestinal mucosa and spread to other organs, producing extra-intestinal amoebiasis, among which amoebic liver abscess (ALA) is the most common (Bernal Redondo, 2001; Adams and Macleod, 1977). Due to the fact that there is no animal model to reproduce the whole life cycle of E. histolytica, in vivo studies are conducted separately by using models for intestinal or hepatic amoebiasis (Tsutsumi and Shibayama, 2006). The first laboratory animal that was used successfully to induce ALA was the hamster (Reinertson and Thompson, 1951); subsequent studies have con-
* Corresponding author. Address: Centro de Investigación Biomédica del Noreste, Instituto Mexicano del Seguro Social, Administración de Correos No. 4, Apartado Postal 020, Colonia Independencia, Monterrey, Nuevo León, CP 64720, Mexico. Fax: +52 81 8190 4035. E-mail address: [email protected] (P. Carranza-Rosales). 0014-4894/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2010.04.005
firmed its high susceptibility and uniformity of the induced lesions (Tanimoto et al., 1971). Gerbils are also susceptible to develop ALA. However, in this species E. histolytica trophozoites are less virulent than in hamsters (Shibayama-Salas et al., 1997). With regard to the use of mice to induce ALA formation, mice with severe combined immunodeficiency have been used to study factors involved in protective immunity (Cieslak et al., 1992). Because of the above mentioned, hamsters are more commonly used in studies of molecular biology, immunopathogenesis, pharmacology, antiamoebic drugs, vaccines, and morphological assays during the development of ALA (Tsutsumi and Shibayama, 2006). As an alternative to in vivo models, in vitro models have been used to elucidate various mechanisms of the pathogenicity of E. histolytica (López-Vancell et al., 2000; Singh et al., 2004; Lee et al., 2008). Although the results of in vitro experiments are valuable, they do not reflect the in vivo complexity. Precision-cut tissue slices represent an intermediate ex vivo model between cell cultures and in vivo models. This model is based on the mechanical preparation of tissue slices with similar diameter and thickness between each slice, which can be grown under controlled conditions while permitting the reduction of the number of animals required for in vivo studies (Brendel et al., 1993; Bach et al., 1996). The advantage of liver slices over isolated hepatocytes, or hepatic cell
118
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
lines, is the ease of preparation, the presence of virtually all the cells forming the organ from which they are obtained, and the presence of intercellular and cell-extracellular matrix interactions (Parrish et al., 1995). Because tissue slices keep the organ architecture and functionality, they allow the study of drug metabolism in periods of hours to days (Thohan et al., 2001). The use of liver slices to study the metabolism or toxicity of endogenous and exogenous substrates is perhaps the most dominant application of this system, but they have also been used to study early events in chemically-induced carcinogenesis (Parrish et al., 1995), activation of stellate cells (Van de Bovenkamp et al., 2005; Verril et al., 2002), apoptosis induced by xenobiotics (Moronvalle-Halley et al., 2005), and genotoxicity resulting from exposure to pro-carcinogens (Plazar et al., 2007). Recently, Catania et al. (2007) proposed the use of small slices (tissue chips) to reduce even more the number of animals, to increase the similarity between slices and to increase the number of samples, thus allowing a greater number of experiments from the same animal. Despite the many applications of precision-cut liver slices, its use for studying mechanisms of infection has not been reported. In the present work, we report for the first time the infection of precision-cut hamster liver slices (PCHLS) with virulent trophozoites of Entamoeba histolytica. In this new ex vivo infection model, it was possible to observe the sequence of morphological events during the development of infection, the induction of liver abscesses, and the damage observed in hamsters. At the same time, virulence factors like cysteine proteinases 1 and 5, and amoebapore, which play critical roles in the pathogenicity of Entamoeba histolytica were detected in the infected liver slices. As our observations with PCHLS are comparable to the situation in vivo, this technique represents a new alternative model to study ALA. 2. Material and methods 2.1. Entamoeba histolytica culture Highly virulent trophozoites of E. histolytica strain HM1-IMSS were maintained axenically in PEHPS medium (Said-Fernández et al., 1988). The inoculum was prepared from 72 h amoebic cultures in logarithmic phase of growth. Virulence of this strain was previously tested by inoculating trophozoites directly into the hamster liver and confirmation of ALA production after one week. This virulent strain was used in all the infection experiments. 2.2. PCHLS preparation Precision-cut hamster liver slices were prepared from 2 mo old male Syrian golden hamster (Mesocricetus auratus). Hamsters were sacrificed with an overdose of sodium pentobarbital (6 mg/100 g) and treated following institutional and international guidelines for humanitarian care of animals used in experimental work. Once the hamster was unconscious, the liver was quickly removed and placed into ice-cold Krebs–Henseleit buffer (KB buffer) and the hepatic lobes were separated with a scalpel and cored into 10 mm diameter cylinders. The cores were then sliced in oxygenated KB buffer (4 °C, 95:5 O2:CO2) into 250–300 lm thick slices, using the Brendel Vitron tissue slicer (Vitron, Tucson, AZ, USA). In order to optimize the obtained livers, 4 mm precision-cut tissue chips were prepared from the original 10 mm liver slices, as previously described in detail by Catania et al. (2007). Tissue chips were gently placed onto 24-well polystyrene microplates with 1 ml per well of DMEM/F12 medium and pre-incubated 1 h at 37 °C on a cell culture incubator in order to stabilize the tissue slices because of the mechanical stress they suffered during the slicing process. After this pre-incubation, the slices were infected with Entamoeba
histolytica trophozoites as described below. The maintenance and care of experimental animals complied with the Instituto Mexicano del Seguro Social and Ley General de Salud (México) regulations, as well as with International guidelines for the humane use of laboratory animals. 2.3. Ex vivo infection Starting from axenic and virulent cultures of E. histolytica trophozoites strain HM1: IMSS in logarithmic phase of growth, a cell count was carried out in a Neubauer chamber in order to determine the number of amoebas/ml of medium. An inoculum of 100,000 trophozoites per slice in 1 ml of culture medium, in 24well microplates was used. The culture media consisted of a mix of DMEM/F12:EHP (1:1) supplemented with 2.24 g/l sodium bicarbonate, 50 lg/ml gentamicin, 25 mM glucose, 1% of insulin–transferrin–selenium mix (Sigma Chemical Co.), and 10% fetal bovine serum. EHP is a liver and pancreas extract that is used as the principal ingredient of the culture medium for E. histolytica. Once the slices were infected with the amoebas, the microplate was first incubated static at 37 °C in a humidified atmosphere with 95:5 O2:CO2 for 2 h in order to allow the adherence and penetration of the trophozoites to the hepatic tissue. After this early interaction period, the microplate was incubated in the same conditions, but now with slow agitation of 30–50 rpm. Infected slices were taken at 0, 3, 6, 12, 24, and 48 h, and processed for histopathologic and molecular analysis. Slices without amoebas, in culture media, were used as control. 2.4. Histopathologic analysis After each incubation period the slices were washed with PBS at 37 °C and then were fixed with 10% neutral formalin for 24 h at room temperature. Infected and control slices were embedded in paraffin using and automated tissue processor. Afterwards, paraffin blocks containing the samples were prepared and sections of 5 lm thickness were obtained using a microtome. The sections were stained with hematoxilin & eosin (H&E) and studied under a conventional light microscope. Histopathologic criteria were used in order to establish distinctive morphologic characteristics of the normal tissue and were compared with E. histolytica infected slices. The integrity of the nucleus, cytoplasm, and cellular membranes was evaluated, as well as the interactions between trophozoites and hepatic parenchyma, and grade of cellular damage. In order to better differentiate amoebas infecting hepatic tissue, Grocott-Gomori’s methenamine-silver histochemical staining was performed. Also, for fine details of the interactions between trophozoites and the hepatic parenchyma, infected and control slices were fixed with 2% glutaraldehyde and embedded in epoxic resins. Semi-thin sections (400 nm) were prepared by using an ultramicrotome. Sections were stained with 1% toluidine blue and observed under a conventional light microscope. 2.5. Reverse transcription Total RNA of the infected and control liver slices of hamsters were extracted using the RNeasy kit of Qiagen following the manufacturer instructions. RNA was used for the synthesis of the complementary DNA (cDNA) by the reverse transcription technique using a commercial kit from Promega. The reaction mix consisted of 4 ll of 25 mM MgCl2, 2 ll of 10 reaction buffer, 2 ll of (10 mM) dNTPs, 0.5 ll of RNase inhibitor, 15 U reverse transcriptase of AMV, 1 ll of Oligo-dT, and 1 lg of RNA in a total volume of 20 ll adjusted with nuclease free water. This reaction mix was incubated at 95 °C for 5 min and then, it was inactivated at 5 °C for 5 min.
119
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
were repeated 30 times, followed by 72 °C for 5 min, and finally at 4 °C to end the reaction.
2.6. PCR cDNA prepared from total RNA extracted from infected and control slices was used to detect amoebapore and cysteine proteinases 1 and 5, well known virulence factors of E. histolytica. Amoebic actin gene was amplified as endogen control. The primers were designed according to nucleotidic sequences reported at the gene bank from the National Center for Biotechnology Information (NCBI) using the Amplify 1.0 software. Primers sequence and other characteristics are listed in Table 1. PCR was carried out in a thermocycler by using the following conditions: (1) 94 °C for 5 min, (2) 94 °C for 30 s, (3) 65 °C for 30 s, (4) 72 °C for 30 s. Steps 2, 3 and 4
3. Results 3.1. Sequential events of the amoebic invasion and abscess induction in PCHLS infected with E. histolytica trophozoites Non-infected control slices showed normal morphology during the 0–48 h experimental times (Fig. 1). During the first 3–12 h post-infection, some trophozoites were observed in the lumen of the central veins, in close contact with endothelial cells, as
Table 1 Primers used for detection of Entamoeba histolytica virulence factors. Gen name Cysteine proteinase 1 Cysteine proteinase 1 Cysteine proteinase 5 Cysteine proteinase 5 Amoebapore (upper) Amoebapore (lower) Actin (upper) Actin (lower)
(upper) (lower) (upper) (lower)
Code
Sequence (50 –30 )
EhCP1U EhCP1L EhCP5U EhCP5L EhAMU EhAPL EhACU EhACL
CATGTAGAAGTGATGTGAAAGC TTCTTTCCCATCAACAACAC TTCAGCAGCAACATATGG ATTTGCTGCTATGACTGAGG AAGGAGAAATCCTCTGCAAC CAAATAGCATTGGCATCAAC AATGAAAGATTCAGATGCCC ATTGATCCTCCAATCCAGAC
Amplicon size (bp) 247 376 216 283
Fig. 1. Representative images of non-infected PCHLS (control). Tissue slices showed normal histology during all the incubation times. Conserved hepatic parenchyma, central veins (CV), and sinusoidal spaces (S), which are distinctive histological characteristics of the normal liver can be observed. After 48 h, signs of hydropic degeneration were seen, however this could be part of the adaptative response to the in vitro culture. H & E staining. Scale bar 100 lm. Images are representative of five independent experiments.
120
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
well as dispersed between dilated hepatic sinusoids (Fig. 2a–c and Fig. 5c). In some cases, the trophozoites were surrounded by lymphocytes and polymorphonuclear leukocytes infiltrating the neighboring sinusoids (Fig. 2d). Subsequently, at 24 h postinfection, there was a considerable increase in the number of trophozoites within the hepatic parenchyma, producing moderated to severe damage of the hepatocytes (Fig. 2e). After 48 h of incubation, the infected liver slices experienced degenerative changes
that evolved to death by necrosis; these changes were characterized by cytoplasmic vacuolization and nuclear damage, with progressive loss of the intercellular junctions (Fig 2e and f). The plasticity of the plasma membrane of the amoeba is remarkable, since they actively produce pseudopodia and change their shape and size to fit the sinusoidal spaces, and occupy small capillary vessels in order to travel through the hepatic tissue (Fig. 2g and h).
Fig. 2. Distinctive morphological steps during infection of PCHLS with trophozoites of E. histolytica. Shortly after post-infection, amoebas (arrows) were observed in close contact with endothelial cells of blood vessels (a, b), then dispersed through the sinusoidal spaces (s). Some sinusoids were dilated and occupied by trophozoites (c), which sometimes were surrounded by inflammatory infiltrates (circles) (d). The inflammatory foci grow in size and shape as incubation time increases. Between 24 and 48 h postinfection, amoebas induced cytoplasmic vacuolization, nuclear damage, loss of intercellular junctions, and necrosis (e, f). Images g and h show detailed aspects on semi-thin sections of interactions between amoebic trophozoites with the hepatocytes (H), and the vascular endothelium (arrow heads). (a–f) H&E staining. Scale bar: (a) 100 lm. Scale bar: (b–f) 20 lm; (b) is a magnification of the insert in (a), (g) and (h)s: semi-thin section stained with toluidine blue. Scale bar: 5 lm. Images are representative of five independent experiments.
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
A notable feature is the formation of clusters of trophozoites, which grow in size between 3 and 12 h of incubation. The tendency
121
to form clusters of amoebas during the first 12 h post-infection is more evident by the Grocott–Gomori’s special staining (Fig. 3).
Fig. 3. Grocott–Gomori’s histochemical staining in PCHLS infected with E. histolytica trophozoites. A tendency to form clusters of amoebas is observed between 3 and 12 h post-infection. Amoebas are stained in brown color against the green color of the hepatic parenchyma. Scale bar of panoramic image, 100 lm. Scale bar of the inserts: 20 lm. Images are representative of five independent experiments.
Fig. 4. Sequential steps in the formation of a microabscess during the ex vivo infection of PCHLS with virulent trophozoites of E. histolytica. Shortly after post-infection an inflammatory infiltrate consisting mainly of lymphocytes and polymorphonuclear leukocytes was observed often surrounding the amoebae (arrows). The inflammatory foci increases in size with increased incubation time. The activation of PMNs is characterized by nuclear degranulation, seen as a ‘‘nuclear dust”. At 24 h post-infection, microabscesses can be seen with the surrounding hepatic tissue necrotic. At this time amebae were rarely seen associated with the microabscess. H&E staining. Scale bar 20 lm. Images are representative of five independent experiments.
122
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
Fig. 5. Entamoeba histolytica behavior in infected PCHLS. The presence of amoebas (arrows) ingesting abundant erythrocytes in the lumen of blood vessels (a, b), and located in the bile ducts (BD) of the portal triads (c, d), was a common during all incubation times. A trophozoite can be observed (c, arrow head) in close contact with the endothelium (E) of the central vein (CV). (a–c) H&E staining. Scale bar: 20 lm, (d) toluidine blue staining on a semi-thin section. Scale bar: 5 lm. Images are representative of five independent experiments.
Nevertheless, the most notable characteristic was the apparition of microabsccess, constituted by inflammatory cells enclosing and lysing some amoebas as part of the tissue response against the parasitic infection. Distinct morphological events were observed during the abscess formation (Fig. 4). Another notable features were the elevated erythrophagic activity of the amoebas, this characteristic was observed during all the experimental times (Fig. 5a and b), as well as the occupation of the bile ducts by viable trophozoites (Fig. 5c and d).
term culture of human colon explants (Bansal et al., 2009). For hepatic amoebiasis, we describe here the use of PCHLS. The advan-
3.2. Molecular analysis Different virulence factors of E. histolytica were detected in infected hamster liver slices (Fig. 6). The detected amplicons corresponded to the expected size of 247, 376, and 216 bp for Cp1, Cp5 and amoebapore, respectively, including the actin endogenous gene for E. histolytica (283 bp).
4. Discussion One of the major problems delaying research in human amoebiasis has been the lack of an animal model in which cysts administered orally produce intestinal and hepatic disease. Nevertheless, progress is being made and reliable intestinal and hepatic infections can be established in separate small animal models (Ackers and Mirelman, 2006). For hepatic amoebiasis, hamsters have been traditionally used, but in the case of intestinal amoebiasis, which is more complex and difficult than hepatic lesions, animal models have been limited. This is probably due to the natural immune resistance of rodents to intestinal inoculation with E. histolytica trophozoites (Tsutsumi and Shibayama, 2006). Recently, an interesting in vitro alternative for investigating the initial steps of mucosal invasion has been described using short-
Fig. 6. PCR analysis of PCHLS infected with Entamoeba histolytica trophozoites. A positive signal specific for E. histolytica virulence factors was detected as soon as 3 h post-infection. RNA was extracted and cDNA was synthesized by reverse transcription. Subsequently the cDNA was amplified by PCR using the primers described in Table 1. M, molecular size marker; N. negative control (non-infected slices); Cp5, cysteine proteinase 5; Cp1, cysteine proteinase 1; Am, amoebapore; Ac, E. histolytica actin. Gel image represents three independent experiments.
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
tage of PCHLS, as compared with cell culture models lies in the integrity of the tissue complex and metabolic capacity. Precision-cut liver slices have many applications, especially to study both cellular and tissue aspects of toxicology and metabolism of the liver (Groneberg et al., 2002; Moronvalle-Halley et al., 2005; Plazar et al., 2007; Yue et al., 2009). Its usefulness as a model of infection has not previously reported. In this paper we report for the first time that an amoebic infection can be established ex vivo in PCHLS and that the changes observed during the infection are similar to those reported in the animal model used for experimental induction of ALA. By using morphological techniques it was possible to study the temporal sequence of amoebic invasion, the interaction of amoebas with liver tissue and the damage caused by E. histolytica in infected slices, while uninfected slices (control), remained viable and healthy for all incubation times (Fig. 1). Trophozoites also remained viable inside the slices, and they maintained elevated erythrophagocytic activity and pseudopodia formation (Fig. 5a and b). Erythrophagocytosis is a distinctive hallmark of E. histolytica trophozoites during infection. According to Orozco et al. (1983), there is a direct relationship between erythrophagia and the pathogenicity of the amoebas. The virulence of E. histolytica has been associated with the ability of these parasites to ingest cells, this behavior confers great advantage during infection because by eating dead or damaged cells, amoebas reduces the infiltration of inflammatory cells and release of toxic cellular compounds (Boettner and Petri, 2005; Boettner et al., 2008). With regard to the progression of liver damage, in their study on the formation of ALA in hamsters, Tsutsumi et al. (1984) found amoebae 30 min post-infection. After the first hour, amoebas were found surrounded by polymorphonuclear cells, and at 3 h inflammatory foci were formed, between 6 and 18 h the inflammatory response was increased, until necrosis of the hepatic tissue was observed. Two days post-infection, necrotic lesions coalesced and extended into the adjacent parenchyma. Meanwhile, Ventura-Juárez et al. (2002) reported that the amoebas are located predominantly in the sinusoidal space 30 min after inoculation of trophozoites through the portal vein. After one hour post-infection, small aggregates of polymorphonuclear cells are observed, these aggregates increases between 3 and 6 h, whereas at 12 and 24 h the lesion size increased and some micro-abscesses and abscesses were formed. In a similar work, Jarillo-Luna et al. (2000a,b) also observed amoebas within sinusoidal spaces during the first 3 h post-infection, but without associated inflammatory reaction. After 3 h, inflammatory foci composed by polymorphonuclear cells were observed; at 6 h some macrophages were detected, the inflammatory infiltrate increased at 12 h post-infection, suggesting that macrophages play an important role in specific and non-specific immune response. According to Tsutsumi et al. (1984), amoebic liver abscess formation after intraportal inoculation of virulent trophozoites of E. histolytica in hamster involves three consecutive phases: acute inflammation, abscess formation, and necrosis. In our work, we found similar results to those described by the above mentioned groups, like sinusoidal localization of the amoebas, and a predominantly acute inflammatory response with formation of micro-abscesses and hepatocyte damage culminating in necrosis of the tissue after 24 and 48 h post-infection. Occasionally there were clusters of histiocytes or macrophages that could correspond to the incipient formation of granulomas (data not shown). We also found amoebas since the first hours after infection; increasing amoebic densities proportionally to the incubation time (see Fig. 2). At 3–6 h post-infection, vascular congestion and small aggregates of polymorphonuclear cells, as well as trophozoites were observed in groups dispersed throughout the hepatic sinusoids or near the portal triads. The fact that Entamoeba trophozoites were organized in clusters, suggests marked local
123
multiplication of the parasite population while invading the tissue (Gianinazzi et al., 2005). The most evident formation of micro-abscesses occurred between 6 and 12 h post-infection (Fig. 4), it was characterized by an acute inflammatory response consisting predominantly of lymphocytes and polymorphonuclear leukocytes which initially were surrounding the amoeba, but at longer times (48 h) they destroyed the trophozoites by lysis. These results are consistent with those reported by Rigothier et al. (2002) who found that the cellular immune response is important in eliminating trophozoites during amoebic invasion. Lysis of hepatocytes also occurs, not only of those that are directly interacting with the amoebas, but also those who are far from them. The latter is similar to that reported by Ventura-Juárez et al. (1997, 2002) who showed that diffusion of amoebic molecules occurs to the endothelium, and hepatocytes located further away die by necrosis. These authors suggest that cytotoxicity can occur due to the secretion of amoebic molecules that can cause toxic effects at a distance, even when there is not close contact between the trophozoites and hepatocytes. A finding that has not been reported for E. histolytica was the presence of amoebae within the biliary ducts (Fig. 5c and d). In a survey work during 1974–1975 on the parasites of aquatic turtles of Tunisia, unidentified nematode larvae were detected on several occasions in the bile ducts (Mishra and Gonzalez, 1978). Entamoeba bovis has also been recovered from the gall bladders and bile ducts of slaughtered beef cattle that had no infection with liver flukes (el-Refaii, 1993). The small liver flukes Clonorchis sp and Opisthorchis sp living in the bile ducts do little harm to the liver (Seitz, 1995). On the other hand, although fascioliasis, caused by Fasciola species, is a disease of herbivorous animals, it may occasionally affect men causing serious hepatic pathological sequences. In chronic infections, the persistence of Fasciola worms in the bile ducts has been documented (Haseeb et al., 2002). Implications about E. histolytica trophozoites in biliary ducts need to be further elucidated. Contrary to those reported by Ebsen et al. (2002), who infected murine lung slices with respiratory syncytial virus and Chlamydophila pneumonia, and found a weak inflammatory response, in the present work we observed the recruitment of inflammatory cells during the course of infection, from the discreet aggregation of polymorphonuclear leukocytes until the formation of microabscesses that may represent the counterpart of the abscesses observed in the animal model (Fig. 4). These results suggest that PCHLS infected with E. histolytica trophozoites may be helpful in assessing immune response phenomena in early steps of infection. In another context, the infection model that we propose to study ALA has the advantage that reduces the number of animals per experiment, this is mainly because the tissue can be optimized and different analysis from the same animal can be done. This is very important if we take into account that in the present study we used only 10 hamsters to perform five separate experiments, each with two animals. In every experiment, three microplates of 24 wells were obtained (72 slices per experiment), which provided sufficient and appropriate material for all necessary replicates, with the additional advantage of reducing experimental variation while it was possible to work simultaneously with various treatments and/or repetitions during the experiment. Other works that have used hamsters as a model to study ALA employ more than 40 or 90 and 100 animals (Tsutsumi and Martinez-Palomo, 1988; Tsutsumi et al., 1984; Shibayama et al., 1998). This highlights the advantage of the tissue slices system with regard to reducing the number of animals for experimentation, one of the principles of the 3 R’s philosophy (Russell and Burch, 1959). By reverse transcription and PCR analysis of the infected PCHLS we detected E. histolytica- specific signals of three virulence factors,
124
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
Cp1, Cp5, and amoebapore (Fig. 6). The first two, are cysteine proteinases involved in the degradation of the colonic mucin and the extracellular matrix. Its absence, or low level expression, results in reduced phagocytic activity, gut inflammation, and liver abscess formation (Que and Reed, 2000; Bruchhaus et al., 2003). Amoebapores exist as mature and potentially active peptides inside cytoplasmic granules of amoebic trophozoites. The activity of amoebapores has been assayed with different target cells, freshly isolated human polymorphonuclear leukocytes, as well as with different bacterial cytoplasmic membranes (Leippe, 1994). It has been associated to cytotoxicity against nucleated cells and erythrocytes, as well as increased liver abscess formation in vivo (Bracha et al., 2003; Leippe et al., 2005). Detection of these virulence factors in infected PCHLS suggests that this model could be used to detect additional molecules involved in the pathophysiology of ALA. Studies are in progress in our laboratory in order to validate the expression of these amoebic molecules in PCHLS infected with E. histolytica trophozoites. Also, this model could be useful for analyzing, at early times of infection, the interaction between E. histolytica and cells of the innate immune response, such as neutrophils and macrophages, which are considered to have contact and participate in the response against amoebas. In this regard, experiments have been carried in order to study the effect of amoebas in mice in which neutrophils were depleted (Velazquez et al., 1998). The extraordinary possibility to add or omit peripheral leukocytes, macrophages, complement molecules, or specific antibodies to the system in a controlled fashion, makes the liver slice culture system particularly well suited to delineate the contribution of invading inflammatory cells to the pathogenesis of hepatic amoebiasis, and to study by high resolution microscopy the interaction of amoebas with the hepatic parenchyma and externally added cells at early times of infection. The main limitation of the PCHLS system is that there is no blood flow after dissection of the liver. However, it is important to remark that the structural morphology of liver parenchyma, and the blood elements that are present at the time of preparation of the liver slices remain viable for up to 2 days. This fact made possible to observe both, the early recruitment of neutrophils and lymphocytes, and the elevated erythrophagic activity of the amoebas during all experimental times. Another disadvantage of this system is the duration of viability of PCHLS, and chronic, or long-term studies are difficult to perform. However, with regard to the last, Behrsing et al. (2003) have succeeded in extending the viability of liver slices for at least 10 days in culture. To do this, they changed some physical parameters during the incubation process, but also supplemented the culture medium with hormones, growth factors, and other chemicals. With this, the system may be more expensive, but opens the possibility to perform long-term experiments. These authors conclude that liver slices merit further investigation as a general model for chronic as well as acute toxicity, and now, for infection studies. In conclusion, the early morphological events observed in infected PCHLS with E. histolytica trophozoites were similar to those reported using in vivo experiments in hamsters. Therefore, PCHLS is an alternative model to study hepatic amoebiasis under controlled conditions, and to further elucidate the pathogenesis of this invasive disease. It constitutes an important advantage when considering studies of early host response to amoebae, virulence factors, or evaluation of chemotherapeutic agents directly on infected tissues, which require large numbers of experimentally infected animals. Moreover, this model could help to research based on comparative genomics, transcriptomics, and proteomics, for a deeper understanding of the parasite’s biology, its relationship with the host, the molecular mechanisms of immunopathology in
amoebiasis, and the development of innovative interventional strategies (Santi-Rocca et al., 2008). Acknowledgments We are deeply grateful to Dr. Javier Torres López from the Coordinación de Investigación en Salud (IMSS), for his valuable support to the ‘‘Tissue Slices” project at the IMSS, and to Efrén Jaramillo Reyna and Samuel Muñoz Sánchez for their initial excellent work standardizing the preparation and cultivation of tissue slices. References Ackers, J.P., Mirelman, D., 2006. Progress in research on Entamoeba histolytica pathogenesis. Current Opinion in Microbiology 9, 367–373. Adams, E.B., Macleod, I.N., 1977. Invasive amebiasis. II. Amebic liver abscess and its complications. Medicine (Baltimore) 56, 325–334. Bach, P.H., Vickers, A.E.M., Fisher, R., Baumann, A., Brittebo, E., Charlile, D.J., Koster, H.J., Lake, B.J., Salmon, F., Sawyer, W.T., Skibinskil, G., 1996. The use of tissue slices for pharmacotoxicology studies. Alternatives to Laboratory Animals 24, 893–923. Bansal, D., Ave, P., Kerneis, S., Frileux, P., Boché, O., Baglin, A.C., Dubost, G., Leguern, A.S., Prevost, M.C., Bracha, R., Mirelma, D., Guillén, N., Labruyére, E., 2009. An exvivo human intestinal model to study Entamoeba histolytica pathogenesis. PLoS Neglected Tropical Diseases 3, e551. Behrsing, H.P., Vickers, A.E.M., Tyson, C.A., 2003. Extended rat liver slice survival and stability monitored using clinical biomarkers. Biochemical and Biophysical Research Communications 312, 209–213. Bernal Redondo, R.M., 2001. Entamoebiosis-amibiasis intestinal. Entamoeba histolytica/Entamoeba dispar. Boletín Médico del Hospital Infantil de México 58, 217–219. Boettner, D.R., Petri, W.A., 2005. Entamoeba histolytica activates host cell caspases during contact-dependent cell killing. Current Topics in Microbiology and Immunology 289, 175–184. Boettner, D.R., Huston, C.D., Linford, A.S., Buss, S.N., Houpt, E., Sherman, N.E., Petri, W.A., 2008. Entamoeba histolytica phagocytosis of human erythrocytes involves PATMK, a member of the transmembrane kinase family. PLoS Pathogens 4, 122– 133. Bracha, R., Nuchamowitz, Y., Mirelman, D., 2003. Transcriptional silencing of an amoebapore gene in Entamoeba histolytica: molecular analysis and effect on pathogenicity. Eukaryotic Cell 2, 295–305. Brendel, K., Fisher, R.L., Krumdieck, C.L., Gandolfi, A.J., 1993. Precision-cut rat liver slice in dynamic organ culture for structure–toxicity studies. Methods in Toxicology 1, 222–230. Bruchhaus, I., Loftus, B.J., Hall, N., Tannich, E., 2003. The intestinal protozoan parasite Entamoeba histolytica contains 20 cysteine protease genes, of which only a small subset is expressed during in vitro cultivation. Eukaryotic Cell 2, 501–509. Catania, J.M., Pershing, A.M., Gandolfi, A.J., 2007. Precision-cut tissue chips as an in vitro toxicology system. Toxicology In Vitro 21, 956–961. Cieslak, P.R., Virgin, I.V., Stanley, S.L., 1992. A severe combined immunodeficient (SICD) mouse model for infection with Entamoeba histolytica. Journal of Experimental Medicine 176, 1605–1609. Ebsen, M., Mogilevski, G., Anhenn, O., Maiworm, V., Theegarten, D., Schwarze, J., Morgenroth, K., 2002. Infection of murine precision cut lung slices (PCLS) with respiratory syncytial virus (RSV) and Chlamydophila pneumonie using the Krumdieck technique. Pathology Research and Practice 198, 747–753. el-Refaii, A.H., 1993. Entamoeba bovis Liebetanz 1905 recorded from large ruminants in Egypt. Journal of the Egyptian Society of Parasitology 23, 239–245. Gianinazzi, C., Schild, M., Müller, N., Leib, S.L., Simon, F., Nuñez, S., Joss, P., Gottestein, B., 2005. Organotypic slice cultures from rat brain tissue: a new approach for Naegleria fowleri CNS infection in vitro. Parasitology 131, 797– 804. Groneberg, D.A., Grosse-Siestrup, C., Fischer, A., 2002. In vitro models to study hepatotoxicity. Toxicological Pathology 30, 394–399. Haseeb, A.N., el-Shazly, A.M., Arafa, M.A., Morsy, A.T., 2002. A review on fascioliasis in Egypt. Journal of the Egyptian Society of Parasitology 32, 317–354. Huston, C.D., 2004. Parasite and hosts contributions to the pathogenesis of amebic colitis. Trends in Parasitology 20, 23–26. Jarillo-Luna, R.A., Campos-Rodríguez, R., Tsutsumi, V., 2000a. Participation of neutrophils, macrophages, and endothelial cells in the amebic liver lesion in the mouse. Archives of Medical Research 31, S101–S103. Jarillo-Luna, R.A., Campos-Rodriguez, R., Tsutsumi, V., 2000b. Morphological changes of liver infected with trophozoites of Entamoeba histolytica. Archives of Medical Research 31, S251–S253. Lee, J., Park, S.J., Yong, T.S., 2008. Effect of iron on adherence and cytotoxicity of Entamoeba histolytica to CHO cell monolayers. Korean Journal of Parasitology 46, 37–40. Leippe, M., 1994. Amoebopores, a family of membranolytic peptides from cytoplasmic granules of Entamoeba histolytica: isolation, primary structure and pore formation in bacterial cytoplasmic membranes. Journal of Molecular Microbiologic Biotechnology 14, 895–904.
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125 Leippe, M., Bruhn, H., Hecht, O., Grötzinger, J., 2005. Ancient weapons: the threedimensional structure of amoebapore A. Trends in Parasitology 21, 5–7. López-Vancell, R., Montfort, I., Pérez-Tamayo, R., 2000. Galactose-specific adhesin and cytotoxicity of Entamoeba histolytica. Parasitology Research 86, 226–231. Mishra, G.S., Gonzalez, J.P., 1978. Parasites of fresh water turtles in Tunisia. Archives de l’Institut Pasteur de Tunis 55, 303–326. Moronvalle-Halley, V., Sacré-Salem, B., Sallez, V., Labbe, G., Gautier, J.G., 2005. Evaluation of cultured, precision-cut rat liver slice as a model to study druginduced liver apoptosis. Toxicology 207, 203–214. Orozco, E., Guarneros, A., Martinez-Palomo, A., Sanchez, T., 1983. Entamoeba histolytica. Phagocitosis as a virulence factor. Journal of Experimental Medicine 158, 1511–1521. Parrish, R.A., Gandolfi, A.J., Brendel, K., 1995. Precision-cut tissue slices: applications in pharmacology and toxicology. Life Sciences 57, 1887–1901. Plazar, J., Hreljac, I., Pirih, P., Filipic, M., Groothuis, G.M., 2007. Detection of xenobiotic-induced DNA damage by the comet assay applied to human and rat precision-cut liver slices. Toxicology In Vitro 21, 1134–1142. Que, X., Reed, S.L., 2000. Cysteine Proteinases and the pathogenesis of amebiasis. Clinical Microbiology Reviews 13, 196–206. Reinertson, J.W., Thompson, P.E., 1951. Experimental amebic hepatitis in hamsters. Proceedings of the Society for Experimental Biology and Medicine 76, 518–520. Rigothier, M.C., Khun, H., Tavares, P., Cardona, A., Huerre, M., Guillén, N., 2002. Fate of Entamoeba histolytica during establishment of amoebic liver abscess analyzed by quantitative radioimaging and histology. Infection and Immunity 70, 3208– 3215. Russell, W.M.S., Burch, R.L., 1959. The principles of humane experimental technique. Metheun and Co. Ltd, London. Said-Fernández, S., Vargas-Villarreal, J., Castro-Garza, J., Mata-Cárdenas, B.D., Navarro-Marmolejo, L., Lozano-Garza, G., Martínez-Rodríguez, H., 1988. PEHPS medium: an alternative for axenic cultivation of Entamoeba histolytica and E. Invadens. Transactions of the Royal Society of Tropical Medicine and Hygiene 82, 249–253. Santi-Rocca, J., Weber, C., Guigon, G., Sismeiro, O., Coppée, J.Y., Guillén, N., 2008. The lysine- and glutamic acid-rich protein KERP1 plays a role in Entamoeba histolytica liver abscess pathogenesis. Cellular Microbiology 10 (1), 202–217. Seitz, H.M., 1995. Parasitic diseases of the liver. Verhandlungen der Deutschen Gesellschaft fur Pathologie 79, 241–248. Shibayama-Salas, M., Navarro-García, F., López-Revilla, R., Martínez-Palomo, A., Tsutsumi, V., 1997. In vivo and in vitro intestinal amebiasis in gerbils. Parasitology Research 83, 170–176. Shibayama, M., Campos-Rodríguez, R., Ramírez-Rosales, A., Flores-Romo, L., Espinosa-Cantellano, M., Martínez-Palomo, A., Tsutsumi, V., 1998. Entamoeba histolytica: liver invasion and abscess production by intraperitoneal inoculation
125
of trophozoites in hamsters, Mesocricetus auratus. Experimental Parasitology 88, 20–27. Singh, D., Naik, S.R., Naik, S., 2004. Contact of Entamoeba histolytica with baby hamster kidney-21 (BHK-21) cell line on cysteine proteinase activity. Indian Journal of Medical Research 119, 157–161. Tanimoto, M., Sepúlveda, B., Vázquez Saavedra, J.A., Landa, I., 1971. Lesiones producidas en el hígado por inoculación de Entamoeba histolytica cultivada en medio axénico. Archivos de Investigación Médica (México) 2, 275–284. Thohan, S., Zurich, M.C., Chung, H., Weiner, M., Kane, A.S., Rosen, G.M., 2001. Tissue slices revisited: evaluation and development of a short-term incubation for integrated drug metabolism. Drug Metabolism and Disposition 29, 1337–1342. Tsutsumi, V., Mena-Lopez, R., Anaya-Velazquez, F., Martinez-Palomo, A., 1984. Cellular bases of experimental amebic liver abscess formation. American Journal of Pathology 117, 81–91. Tsutsumi, V., Martinez-Palomo, A., 1988. Inflammatory reaction in experimental hepatic amebiasis. An ultrastructural study. American Journal of Pathology 130, 112–119. Tsutsumi, V., Shibayama, M., 2006. Experimental amoebiasis: a selected review of some in vivo models. Archives of Medical Research 37, 210–220. Van de Bovenkamp, M., Groothuis, G.M., Draaisma, A.L., Merema, M.T., Bezuijen, J.I., Van Gils, M.J., Meijer, D.K.F., Friedman, S.L., Olinga, P., 2005. Precision-cut liver slices as a new model to study toxicity-induced hepatic stellate cell activation in a physiologic milieu. Toxicological Sciences 85, 632–638. Velazquez, C., Shibayama-Salas, M., Aguirre-Garcia, J., Tsutsumi, V., Calderon, J., 1998. Role of neutrophils in innate resistance to Entamoeba histolytica liver infection in mice. Parasite Immunology 20, 255–262. Ventura-Juárez, J., Campos-Rodríguez, R., Ramírez-Rosales, A., Martínez-Palomo, A., Tsutsumi, V., 1997. Early in vivo interaction of Entamoeba histolytica trophozoites with hepatic parenchymal and inflammatory cells of hamster. Archives of Medical Research 28, S211–S213. Ventura-Juárez, J., Campos-Rodríguez, R., Tsutsumi, V., 2002. Early interactions of Entamoeba histolytica trophozoites with parenchymal and inflammatory cells in the hamster liver: an immunocytochemical study. Canadian Journal of Microbiology 48, 123–131. Verril, C., Davies, J., Millward-Sadler, H., Sundstrom, L., Sheron, N., 2002. Organotypic liver culture in a fluid-air interface using slices of neonatal rat and adult human tissue a model of fibrosis in vitro. Journal of Pharmacological and Toxicological Methods 48, 103–110. WHO (World Health Organization), 2009. State of the art of vaccine research and development. Initiative for Vaccine Research. Yue, J., Dong, G., He, C., Chen, J., Liu, Y., Peng, R., 2009. Protective effects of thiopronin against isoniazid-induced hepatotoxicity in rats. Toxicology 264, 185–191.
Contents lists available at ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Precision-cut hamster liver slices as an ex vivo model to study amoebic liver abscess Pilar Carranza-Rosales a,*, María Guadalupe Santiago-Mauricio a, Nancy Elena Guzmán-Delgado b, Javier Vargas-Villarreal a, Gerardo Lozano-Garza a, Javier Ventura-Juárez c, Isaías Balderas-Rentería a, Javier Morán-Martínez a, A. Jay Gandolfi d a División de Biología Celular y Molecular, Centro de Investigación Biomédica del Noreste, Instituto Mexicano del Seguro Social, Administración de Correos No. 4, Apartado Postal 020, Colonia Independencia, Monterrey, NL, CP 64720, Mexico b Departamento de Patología, Unidad Médica de Alta Especialidad # 34, Instituto Mexicano del Seguro Social, Monterrey, N L, CP 64730, Mexico c Departamento de Morfología, Centro de Ciencias Básicas, Universidad Autónoma de Aguascalientes, CP 20131, Aguascalientes, Ags, Mexico d Department of Pharmacology and Toxicology, University of Arizona, 1723 E. Mabel Street, Tucson, AZ 85724, USA
a r t i c l e
i n f o
Article history: Received 7 January 2010 Received in revised form 22 March 2010 Accepted 12 April 2010 Available online 20 April 2010 Keywords: Entamoeba histolytica Protozoa Hamster Liver slices Ex vivo model Amoebic liver abscess
a b s t r a c t Entamoeba histolytica is the etiological agent of amoebiasis, the second cause of global morbidity and mortality due to parasitic diseases in humans. In approximately 1% of the cases, amoebas penetrate the intestinal mucosa and spread to other organs, producing extra-intestinal lesions, among which amoebic liver abscess (ALA) is the most common. To study ALA, in vivo and in vitro models are used. However, animal models may pose ethical issues, and are time-consuming and costly; and cell cultures represent isolated cellular lineages. The present study reports the infection of precision-cut hamster liver slices with Entamoeba histolytica trophozoites. The infection time-course, including tissue damage, parallels findings previously reported in the animal model. At the same time amoebic virulence factors were detected in the infected slices. This new model to study ALA is simple and reproducible, and employs less than 1/3 of the hamsters required for in vivo analyses. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Amoebiasis is the infection caused by Entamoeba histolytica and is the second cause of global morbidity and mortality due to parasitic diseases in humans. It causes more than 100,000 deaths each year and is responsible for 50 million cases of diarrhea each year (WHO, 2009; Huston, 2004). E. histolytica inhabits the large intestine, but approximately in 1% of the cases, trophozoites penetrate the intestinal mucosa and spread to other organs, producing extra-intestinal amoebiasis, among which amoebic liver abscess (ALA) is the most common (Bernal Redondo, 2001; Adams and Macleod, 1977). Due to the fact that there is no animal model to reproduce the whole life cycle of E. histolytica, in vivo studies are conducted separately by using models for intestinal or hepatic amoebiasis (Tsutsumi and Shibayama, 2006). The first laboratory animal that was used successfully to induce ALA was the hamster (Reinertson and Thompson, 1951); subsequent studies have con-
* Corresponding author. Address: Centro de Investigación Biomédica del Noreste, Instituto Mexicano del Seguro Social, Administración de Correos No. 4, Apartado Postal 020, Colonia Independencia, Monterrey, Nuevo León, CP 64720, Mexico. Fax: +52 81 8190 4035. E-mail address: [email protected] (P. Carranza-Rosales). 0014-4894/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2010.04.005
firmed its high susceptibility and uniformity of the induced lesions (Tanimoto et al., 1971). Gerbils are also susceptible to develop ALA. However, in this species E. histolytica trophozoites are less virulent than in hamsters (Shibayama-Salas et al., 1997). With regard to the use of mice to induce ALA formation, mice with severe combined immunodeficiency have been used to study factors involved in protective immunity (Cieslak et al., 1992). Because of the above mentioned, hamsters are more commonly used in studies of molecular biology, immunopathogenesis, pharmacology, antiamoebic drugs, vaccines, and morphological assays during the development of ALA (Tsutsumi and Shibayama, 2006). As an alternative to in vivo models, in vitro models have been used to elucidate various mechanisms of the pathogenicity of E. histolytica (López-Vancell et al., 2000; Singh et al., 2004; Lee et al., 2008). Although the results of in vitro experiments are valuable, they do not reflect the in vivo complexity. Precision-cut tissue slices represent an intermediate ex vivo model between cell cultures and in vivo models. This model is based on the mechanical preparation of tissue slices with similar diameter and thickness between each slice, which can be grown under controlled conditions while permitting the reduction of the number of animals required for in vivo studies (Brendel et al., 1993; Bach et al., 1996). The advantage of liver slices over isolated hepatocytes, or hepatic cell
118
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
lines, is the ease of preparation, the presence of virtually all the cells forming the organ from which they are obtained, and the presence of intercellular and cell-extracellular matrix interactions (Parrish et al., 1995). Because tissue slices keep the organ architecture and functionality, they allow the study of drug metabolism in periods of hours to days (Thohan et al., 2001). The use of liver slices to study the metabolism or toxicity of endogenous and exogenous substrates is perhaps the most dominant application of this system, but they have also been used to study early events in chemically-induced carcinogenesis (Parrish et al., 1995), activation of stellate cells (Van de Bovenkamp et al., 2005; Verril et al., 2002), apoptosis induced by xenobiotics (Moronvalle-Halley et al., 2005), and genotoxicity resulting from exposure to pro-carcinogens (Plazar et al., 2007). Recently, Catania et al. (2007) proposed the use of small slices (tissue chips) to reduce even more the number of animals, to increase the similarity between slices and to increase the number of samples, thus allowing a greater number of experiments from the same animal. Despite the many applications of precision-cut liver slices, its use for studying mechanisms of infection has not been reported. In the present work, we report for the first time the infection of precision-cut hamster liver slices (PCHLS) with virulent trophozoites of Entamoeba histolytica. In this new ex vivo infection model, it was possible to observe the sequence of morphological events during the development of infection, the induction of liver abscesses, and the damage observed in hamsters. At the same time, virulence factors like cysteine proteinases 1 and 5, and amoebapore, which play critical roles in the pathogenicity of Entamoeba histolytica were detected in the infected liver slices. As our observations with PCHLS are comparable to the situation in vivo, this technique represents a new alternative model to study ALA. 2. Material and methods 2.1. Entamoeba histolytica culture Highly virulent trophozoites of E. histolytica strain HM1-IMSS were maintained axenically in PEHPS medium (Said-Fernández et al., 1988). The inoculum was prepared from 72 h amoebic cultures in logarithmic phase of growth. Virulence of this strain was previously tested by inoculating trophozoites directly into the hamster liver and confirmation of ALA production after one week. This virulent strain was used in all the infection experiments. 2.2. PCHLS preparation Precision-cut hamster liver slices were prepared from 2 mo old male Syrian golden hamster (Mesocricetus auratus). Hamsters were sacrificed with an overdose of sodium pentobarbital (6 mg/100 g) and treated following institutional and international guidelines for humanitarian care of animals used in experimental work. Once the hamster was unconscious, the liver was quickly removed and placed into ice-cold Krebs–Henseleit buffer (KB buffer) and the hepatic lobes were separated with a scalpel and cored into 10 mm diameter cylinders. The cores were then sliced in oxygenated KB buffer (4 °C, 95:5 O2:CO2) into 250–300 lm thick slices, using the Brendel Vitron tissue slicer (Vitron, Tucson, AZ, USA). In order to optimize the obtained livers, 4 mm precision-cut tissue chips were prepared from the original 10 mm liver slices, as previously described in detail by Catania et al. (2007). Tissue chips were gently placed onto 24-well polystyrene microplates with 1 ml per well of DMEM/F12 medium and pre-incubated 1 h at 37 °C on a cell culture incubator in order to stabilize the tissue slices because of the mechanical stress they suffered during the slicing process. After this pre-incubation, the slices were infected with Entamoeba
histolytica trophozoites as described below. The maintenance and care of experimental animals complied with the Instituto Mexicano del Seguro Social and Ley General de Salud (México) regulations, as well as with International guidelines for the humane use of laboratory animals. 2.3. Ex vivo infection Starting from axenic and virulent cultures of E. histolytica trophozoites strain HM1: IMSS in logarithmic phase of growth, a cell count was carried out in a Neubauer chamber in order to determine the number of amoebas/ml of medium. An inoculum of 100,000 trophozoites per slice in 1 ml of culture medium, in 24well microplates was used. The culture media consisted of a mix of DMEM/F12:EHP (1:1) supplemented with 2.24 g/l sodium bicarbonate, 50 lg/ml gentamicin, 25 mM glucose, 1% of insulin–transferrin–selenium mix (Sigma Chemical Co.), and 10% fetal bovine serum. EHP is a liver and pancreas extract that is used as the principal ingredient of the culture medium for E. histolytica. Once the slices were infected with the amoebas, the microplate was first incubated static at 37 °C in a humidified atmosphere with 95:5 O2:CO2 for 2 h in order to allow the adherence and penetration of the trophozoites to the hepatic tissue. After this early interaction period, the microplate was incubated in the same conditions, but now with slow agitation of 30–50 rpm. Infected slices were taken at 0, 3, 6, 12, 24, and 48 h, and processed for histopathologic and molecular analysis. Slices without amoebas, in culture media, were used as control. 2.4. Histopathologic analysis After each incubation period the slices were washed with PBS at 37 °C and then were fixed with 10% neutral formalin for 24 h at room temperature. Infected and control slices were embedded in paraffin using and automated tissue processor. Afterwards, paraffin blocks containing the samples were prepared and sections of 5 lm thickness were obtained using a microtome. The sections were stained with hematoxilin & eosin (H&E) and studied under a conventional light microscope. Histopathologic criteria were used in order to establish distinctive morphologic characteristics of the normal tissue and were compared with E. histolytica infected slices. The integrity of the nucleus, cytoplasm, and cellular membranes was evaluated, as well as the interactions between trophozoites and hepatic parenchyma, and grade of cellular damage. In order to better differentiate amoebas infecting hepatic tissue, Grocott-Gomori’s methenamine-silver histochemical staining was performed. Also, for fine details of the interactions between trophozoites and the hepatic parenchyma, infected and control slices were fixed with 2% glutaraldehyde and embedded in epoxic resins. Semi-thin sections (400 nm) were prepared by using an ultramicrotome. Sections were stained with 1% toluidine blue and observed under a conventional light microscope. 2.5. Reverse transcription Total RNA of the infected and control liver slices of hamsters were extracted using the RNeasy kit of Qiagen following the manufacturer instructions. RNA was used for the synthesis of the complementary DNA (cDNA) by the reverse transcription technique using a commercial kit from Promega. The reaction mix consisted of 4 ll of 25 mM MgCl2, 2 ll of 10 reaction buffer, 2 ll of (10 mM) dNTPs, 0.5 ll of RNase inhibitor, 15 U reverse transcriptase of AMV, 1 ll of Oligo-dT, and 1 lg of RNA in a total volume of 20 ll adjusted with nuclease free water. This reaction mix was incubated at 95 °C for 5 min and then, it was inactivated at 5 °C for 5 min.
119
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
were repeated 30 times, followed by 72 °C for 5 min, and finally at 4 °C to end the reaction.
2.6. PCR cDNA prepared from total RNA extracted from infected and control slices was used to detect amoebapore and cysteine proteinases 1 and 5, well known virulence factors of E. histolytica. Amoebic actin gene was amplified as endogen control. The primers were designed according to nucleotidic sequences reported at the gene bank from the National Center for Biotechnology Information (NCBI) using the Amplify 1.0 software. Primers sequence and other characteristics are listed in Table 1. PCR was carried out in a thermocycler by using the following conditions: (1) 94 °C for 5 min, (2) 94 °C for 30 s, (3) 65 °C for 30 s, (4) 72 °C for 30 s. Steps 2, 3 and 4
3. Results 3.1. Sequential events of the amoebic invasion and abscess induction in PCHLS infected with E. histolytica trophozoites Non-infected control slices showed normal morphology during the 0–48 h experimental times (Fig. 1). During the first 3–12 h post-infection, some trophozoites were observed in the lumen of the central veins, in close contact with endothelial cells, as
Table 1 Primers used for detection of Entamoeba histolytica virulence factors. Gen name Cysteine proteinase 1 Cysteine proteinase 1 Cysteine proteinase 5 Cysteine proteinase 5 Amoebapore (upper) Amoebapore (lower) Actin (upper) Actin (lower)
(upper) (lower) (upper) (lower)
Code
Sequence (50 –30 )
EhCP1U EhCP1L EhCP5U EhCP5L EhAMU EhAPL EhACU EhACL
CATGTAGAAGTGATGTGAAAGC TTCTTTCCCATCAACAACAC TTCAGCAGCAACATATGG ATTTGCTGCTATGACTGAGG AAGGAGAAATCCTCTGCAAC CAAATAGCATTGGCATCAAC AATGAAAGATTCAGATGCCC ATTGATCCTCCAATCCAGAC
Amplicon size (bp) 247 376 216 283
Fig. 1. Representative images of non-infected PCHLS (control). Tissue slices showed normal histology during all the incubation times. Conserved hepatic parenchyma, central veins (CV), and sinusoidal spaces (S), which are distinctive histological characteristics of the normal liver can be observed. After 48 h, signs of hydropic degeneration were seen, however this could be part of the adaptative response to the in vitro culture. H & E staining. Scale bar 100 lm. Images are representative of five independent experiments.
120
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
well as dispersed between dilated hepatic sinusoids (Fig. 2a–c and Fig. 5c). In some cases, the trophozoites were surrounded by lymphocytes and polymorphonuclear leukocytes infiltrating the neighboring sinusoids (Fig. 2d). Subsequently, at 24 h postinfection, there was a considerable increase in the number of trophozoites within the hepatic parenchyma, producing moderated to severe damage of the hepatocytes (Fig. 2e). After 48 h of incubation, the infected liver slices experienced degenerative changes
that evolved to death by necrosis; these changes were characterized by cytoplasmic vacuolization and nuclear damage, with progressive loss of the intercellular junctions (Fig 2e and f). The plasticity of the plasma membrane of the amoeba is remarkable, since they actively produce pseudopodia and change their shape and size to fit the sinusoidal spaces, and occupy small capillary vessels in order to travel through the hepatic tissue (Fig. 2g and h).
Fig. 2. Distinctive morphological steps during infection of PCHLS with trophozoites of E. histolytica. Shortly after post-infection, amoebas (arrows) were observed in close contact with endothelial cells of blood vessels (a, b), then dispersed through the sinusoidal spaces (s). Some sinusoids were dilated and occupied by trophozoites (c), which sometimes were surrounded by inflammatory infiltrates (circles) (d). The inflammatory foci grow in size and shape as incubation time increases. Between 24 and 48 h postinfection, amoebas induced cytoplasmic vacuolization, nuclear damage, loss of intercellular junctions, and necrosis (e, f). Images g and h show detailed aspects on semi-thin sections of interactions between amoebic trophozoites with the hepatocytes (H), and the vascular endothelium (arrow heads). (a–f) H&E staining. Scale bar: (a) 100 lm. Scale bar: (b–f) 20 lm; (b) is a magnification of the insert in (a), (g) and (h)s: semi-thin section stained with toluidine blue. Scale bar: 5 lm. Images are representative of five independent experiments.
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
A notable feature is the formation of clusters of trophozoites, which grow in size between 3 and 12 h of incubation. The tendency
121
to form clusters of amoebas during the first 12 h post-infection is more evident by the Grocott–Gomori’s special staining (Fig. 3).
Fig. 3. Grocott–Gomori’s histochemical staining in PCHLS infected with E. histolytica trophozoites. A tendency to form clusters of amoebas is observed between 3 and 12 h post-infection. Amoebas are stained in brown color against the green color of the hepatic parenchyma. Scale bar of panoramic image, 100 lm. Scale bar of the inserts: 20 lm. Images are representative of five independent experiments.
Fig. 4. Sequential steps in the formation of a microabscess during the ex vivo infection of PCHLS with virulent trophozoites of E. histolytica. Shortly after post-infection an inflammatory infiltrate consisting mainly of lymphocytes and polymorphonuclear leukocytes was observed often surrounding the amoebae (arrows). The inflammatory foci increases in size with increased incubation time. The activation of PMNs is characterized by nuclear degranulation, seen as a ‘‘nuclear dust”. At 24 h post-infection, microabscesses can be seen with the surrounding hepatic tissue necrotic. At this time amebae were rarely seen associated with the microabscess. H&E staining. Scale bar 20 lm. Images are representative of five independent experiments.
122
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
Fig. 5. Entamoeba histolytica behavior in infected PCHLS. The presence of amoebas (arrows) ingesting abundant erythrocytes in the lumen of blood vessels (a, b), and located in the bile ducts (BD) of the portal triads (c, d), was a common during all incubation times. A trophozoite can be observed (c, arrow head) in close contact with the endothelium (E) of the central vein (CV). (a–c) H&E staining. Scale bar: 20 lm, (d) toluidine blue staining on a semi-thin section. Scale bar: 5 lm. Images are representative of five independent experiments.
Nevertheless, the most notable characteristic was the apparition of microabsccess, constituted by inflammatory cells enclosing and lysing some amoebas as part of the tissue response against the parasitic infection. Distinct morphological events were observed during the abscess formation (Fig. 4). Another notable features were the elevated erythrophagic activity of the amoebas, this characteristic was observed during all the experimental times (Fig. 5a and b), as well as the occupation of the bile ducts by viable trophozoites (Fig. 5c and d).
term culture of human colon explants (Bansal et al., 2009). For hepatic amoebiasis, we describe here the use of PCHLS. The advan-
3.2. Molecular analysis Different virulence factors of E. histolytica were detected in infected hamster liver slices (Fig. 6). The detected amplicons corresponded to the expected size of 247, 376, and 216 bp for Cp1, Cp5 and amoebapore, respectively, including the actin endogenous gene for E. histolytica (283 bp).
4. Discussion One of the major problems delaying research in human amoebiasis has been the lack of an animal model in which cysts administered orally produce intestinal and hepatic disease. Nevertheless, progress is being made and reliable intestinal and hepatic infections can be established in separate small animal models (Ackers and Mirelman, 2006). For hepatic amoebiasis, hamsters have been traditionally used, but in the case of intestinal amoebiasis, which is more complex and difficult than hepatic lesions, animal models have been limited. This is probably due to the natural immune resistance of rodents to intestinal inoculation with E. histolytica trophozoites (Tsutsumi and Shibayama, 2006). Recently, an interesting in vitro alternative for investigating the initial steps of mucosal invasion has been described using short-
Fig. 6. PCR analysis of PCHLS infected with Entamoeba histolytica trophozoites. A positive signal specific for E. histolytica virulence factors was detected as soon as 3 h post-infection. RNA was extracted and cDNA was synthesized by reverse transcription. Subsequently the cDNA was amplified by PCR using the primers described in Table 1. M, molecular size marker; N. negative control (non-infected slices); Cp5, cysteine proteinase 5; Cp1, cysteine proteinase 1; Am, amoebapore; Ac, E. histolytica actin. Gel image represents three independent experiments.
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
tage of PCHLS, as compared with cell culture models lies in the integrity of the tissue complex and metabolic capacity. Precision-cut liver slices have many applications, especially to study both cellular and tissue aspects of toxicology and metabolism of the liver (Groneberg et al., 2002; Moronvalle-Halley et al., 2005; Plazar et al., 2007; Yue et al., 2009). Its usefulness as a model of infection has not previously reported. In this paper we report for the first time that an amoebic infection can be established ex vivo in PCHLS and that the changes observed during the infection are similar to those reported in the animal model used for experimental induction of ALA. By using morphological techniques it was possible to study the temporal sequence of amoebic invasion, the interaction of amoebas with liver tissue and the damage caused by E. histolytica in infected slices, while uninfected slices (control), remained viable and healthy for all incubation times (Fig. 1). Trophozoites also remained viable inside the slices, and they maintained elevated erythrophagocytic activity and pseudopodia formation (Fig. 5a and b). Erythrophagocytosis is a distinctive hallmark of E. histolytica trophozoites during infection. According to Orozco et al. (1983), there is a direct relationship between erythrophagia and the pathogenicity of the amoebas. The virulence of E. histolytica has been associated with the ability of these parasites to ingest cells, this behavior confers great advantage during infection because by eating dead or damaged cells, amoebas reduces the infiltration of inflammatory cells and release of toxic cellular compounds (Boettner and Petri, 2005; Boettner et al., 2008). With regard to the progression of liver damage, in their study on the formation of ALA in hamsters, Tsutsumi et al. (1984) found amoebae 30 min post-infection. After the first hour, amoebas were found surrounded by polymorphonuclear cells, and at 3 h inflammatory foci were formed, between 6 and 18 h the inflammatory response was increased, until necrosis of the hepatic tissue was observed. Two days post-infection, necrotic lesions coalesced and extended into the adjacent parenchyma. Meanwhile, Ventura-Juárez et al. (2002) reported that the amoebas are located predominantly in the sinusoidal space 30 min after inoculation of trophozoites through the portal vein. After one hour post-infection, small aggregates of polymorphonuclear cells are observed, these aggregates increases between 3 and 6 h, whereas at 12 and 24 h the lesion size increased and some micro-abscesses and abscesses were formed. In a similar work, Jarillo-Luna et al. (2000a,b) also observed amoebas within sinusoidal spaces during the first 3 h post-infection, but without associated inflammatory reaction. After 3 h, inflammatory foci composed by polymorphonuclear cells were observed; at 6 h some macrophages were detected, the inflammatory infiltrate increased at 12 h post-infection, suggesting that macrophages play an important role in specific and non-specific immune response. According to Tsutsumi et al. (1984), amoebic liver abscess formation after intraportal inoculation of virulent trophozoites of E. histolytica in hamster involves three consecutive phases: acute inflammation, abscess formation, and necrosis. In our work, we found similar results to those described by the above mentioned groups, like sinusoidal localization of the amoebas, and a predominantly acute inflammatory response with formation of micro-abscesses and hepatocyte damage culminating in necrosis of the tissue after 24 and 48 h post-infection. Occasionally there were clusters of histiocytes or macrophages that could correspond to the incipient formation of granulomas (data not shown). We also found amoebas since the first hours after infection; increasing amoebic densities proportionally to the incubation time (see Fig. 2). At 3–6 h post-infection, vascular congestion and small aggregates of polymorphonuclear cells, as well as trophozoites were observed in groups dispersed throughout the hepatic sinusoids or near the portal triads. The fact that Entamoeba trophozoites were organized in clusters, suggests marked local
123
multiplication of the parasite population while invading the tissue (Gianinazzi et al., 2005). The most evident formation of micro-abscesses occurred between 6 and 12 h post-infection (Fig. 4), it was characterized by an acute inflammatory response consisting predominantly of lymphocytes and polymorphonuclear leukocytes which initially were surrounding the amoeba, but at longer times (48 h) they destroyed the trophozoites by lysis. These results are consistent with those reported by Rigothier et al. (2002) who found that the cellular immune response is important in eliminating trophozoites during amoebic invasion. Lysis of hepatocytes also occurs, not only of those that are directly interacting with the amoebas, but also those who are far from them. The latter is similar to that reported by Ventura-Juárez et al. (1997, 2002) who showed that diffusion of amoebic molecules occurs to the endothelium, and hepatocytes located further away die by necrosis. These authors suggest that cytotoxicity can occur due to the secretion of amoebic molecules that can cause toxic effects at a distance, even when there is not close contact between the trophozoites and hepatocytes. A finding that has not been reported for E. histolytica was the presence of amoebae within the biliary ducts (Fig. 5c and d). In a survey work during 1974–1975 on the parasites of aquatic turtles of Tunisia, unidentified nematode larvae were detected on several occasions in the bile ducts (Mishra and Gonzalez, 1978). Entamoeba bovis has also been recovered from the gall bladders and bile ducts of slaughtered beef cattle that had no infection with liver flukes (el-Refaii, 1993). The small liver flukes Clonorchis sp and Opisthorchis sp living in the bile ducts do little harm to the liver (Seitz, 1995). On the other hand, although fascioliasis, caused by Fasciola species, is a disease of herbivorous animals, it may occasionally affect men causing serious hepatic pathological sequences. In chronic infections, the persistence of Fasciola worms in the bile ducts has been documented (Haseeb et al., 2002). Implications about E. histolytica trophozoites in biliary ducts need to be further elucidated. Contrary to those reported by Ebsen et al. (2002), who infected murine lung slices with respiratory syncytial virus and Chlamydophila pneumonia, and found a weak inflammatory response, in the present work we observed the recruitment of inflammatory cells during the course of infection, from the discreet aggregation of polymorphonuclear leukocytes until the formation of microabscesses that may represent the counterpart of the abscesses observed in the animal model (Fig. 4). These results suggest that PCHLS infected with E. histolytica trophozoites may be helpful in assessing immune response phenomena in early steps of infection. In another context, the infection model that we propose to study ALA has the advantage that reduces the number of animals per experiment, this is mainly because the tissue can be optimized and different analysis from the same animal can be done. This is very important if we take into account that in the present study we used only 10 hamsters to perform five separate experiments, each with two animals. In every experiment, three microplates of 24 wells were obtained (72 slices per experiment), which provided sufficient and appropriate material for all necessary replicates, with the additional advantage of reducing experimental variation while it was possible to work simultaneously with various treatments and/or repetitions during the experiment. Other works that have used hamsters as a model to study ALA employ more than 40 or 90 and 100 animals (Tsutsumi and Martinez-Palomo, 1988; Tsutsumi et al., 1984; Shibayama et al., 1998). This highlights the advantage of the tissue slices system with regard to reducing the number of animals for experimentation, one of the principles of the 3 R’s philosophy (Russell and Burch, 1959). By reverse transcription and PCR analysis of the infected PCHLS we detected E. histolytica- specific signals of three virulence factors,
124
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125
Cp1, Cp5, and amoebapore (Fig. 6). The first two, are cysteine proteinases involved in the degradation of the colonic mucin and the extracellular matrix. Its absence, or low level expression, results in reduced phagocytic activity, gut inflammation, and liver abscess formation (Que and Reed, 2000; Bruchhaus et al., 2003). Amoebapores exist as mature and potentially active peptides inside cytoplasmic granules of amoebic trophozoites. The activity of amoebapores has been assayed with different target cells, freshly isolated human polymorphonuclear leukocytes, as well as with different bacterial cytoplasmic membranes (Leippe, 1994). It has been associated to cytotoxicity against nucleated cells and erythrocytes, as well as increased liver abscess formation in vivo (Bracha et al., 2003; Leippe et al., 2005). Detection of these virulence factors in infected PCHLS suggests that this model could be used to detect additional molecules involved in the pathophysiology of ALA. Studies are in progress in our laboratory in order to validate the expression of these amoebic molecules in PCHLS infected with E. histolytica trophozoites. Also, this model could be useful for analyzing, at early times of infection, the interaction between E. histolytica and cells of the innate immune response, such as neutrophils and macrophages, which are considered to have contact and participate in the response against amoebas. In this regard, experiments have been carried in order to study the effect of amoebas in mice in which neutrophils were depleted (Velazquez et al., 1998). The extraordinary possibility to add or omit peripheral leukocytes, macrophages, complement molecules, or specific antibodies to the system in a controlled fashion, makes the liver slice culture system particularly well suited to delineate the contribution of invading inflammatory cells to the pathogenesis of hepatic amoebiasis, and to study by high resolution microscopy the interaction of amoebas with the hepatic parenchyma and externally added cells at early times of infection. The main limitation of the PCHLS system is that there is no blood flow after dissection of the liver. However, it is important to remark that the structural morphology of liver parenchyma, and the blood elements that are present at the time of preparation of the liver slices remain viable for up to 2 days. This fact made possible to observe both, the early recruitment of neutrophils and lymphocytes, and the elevated erythrophagic activity of the amoebas during all experimental times. Another disadvantage of this system is the duration of viability of PCHLS, and chronic, or long-term studies are difficult to perform. However, with regard to the last, Behrsing et al. (2003) have succeeded in extending the viability of liver slices for at least 10 days in culture. To do this, they changed some physical parameters during the incubation process, but also supplemented the culture medium with hormones, growth factors, and other chemicals. With this, the system may be more expensive, but opens the possibility to perform long-term experiments. These authors conclude that liver slices merit further investigation as a general model for chronic as well as acute toxicity, and now, for infection studies. In conclusion, the early morphological events observed in infected PCHLS with E. histolytica trophozoites were similar to those reported using in vivo experiments in hamsters. Therefore, PCHLS is an alternative model to study hepatic amoebiasis under controlled conditions, and to further elucidate the pathogenesis of this invasive disease. It constitutes an important advantage when considering studies of early host response to amoebae, virulence factors, or evaluation of chemotherapeutic agents directly on infected tissues, which require large numbers of experimentally infected animals. Moreover, this model could help to research based on comparative genomics, transcriptomics, and proteomics, for a deeper understanding of the parasite’s biology, its relationship with the host, the molecular mechanisms of immunopathology in
amoebiasis, and the development of innovative interventional strategies (Santi-Rocca et al., 2008). Acknowledgments We are deeply grateful to Dr. Javier Torres López from the Coordinación de Investigación en Salud (IMSS), for his valuable support to the ‘‘Tissue Slices” project at the IMSS, and to Efrén Jaramillo Reyna and Samuel Muñoz Sánchez for their initial excellent work standardizing the preparation and cultivation of tissue slices. References Ackers, J.P., Mirelman, D., 2006. Progress in research on Entamoeba histolytica pathogenesis. Current Opinion in Microbiology 9, 367–373. Adams, E.B., Macleod, I.N., 1977. Invasive amebiasis. II. Amebic liver abscess and its complications. Medicine (Baltimore) 56, 325–334. Bach, P.H., Vickers, A.E.M., Fisher, R., Baumann, A., Brittebo, E., Charlile, D.J., Koster, H.J., Lake, B.J., Salmon, F., Sawyer, W.T., Skibinskil, G., 1996. The use of tissue slices for pharmacotoxicology studies. Alternatives to Laboratory Animals 24, 893–923. Bansal, D., Ave, P., Kerneis, S., Frileux, P., Boché, O., Baglin, A.C., Dubost, G., Leguern, A.S., Prevost, M.C., Bracha, R., Mirelma, D., Guillén, N., Labruyére, E., 2009. An exvivo human intestinal model to study Entamoeba histolytica pathogenesis. PLoS Neglected Tropical Diseases 3, e551. Behrsing, H.P., Vickers, A.E.M., Tyson, C.A., 2003. Extended rat liver slice survival and stability monitored using clinical biomarkers. Biochemical and Biophysical Research Communications 312, 209–213. Bernal Redondo, R.M., 2001. Entamoebiosis-amibiasis intestinal. Entamoeba histolytica/Entamoeba dispar. Boletín Médico del Hospital Infantil de México 58, 217–219. Boettner, D.R., Petri, W.A., 2005. Entamoeba histolytica activates host cell caspases during contact-dependent cell killing. Current Topics in Microbiology and Immunology 289, 175–184. Boettner, D.R., Huston, C.D., Linford, A.S., Buss, S.N., Houpt, E., Sherman, N.E., Petri, W.A., 2008. Entamoeba histolytica phagocytosis of human erythrocytes involves PATMK, a member of the transmembrane kinase family. PLoS Pathogens 4, 122– 133. Bracha, R., Nuchamowitz, Y., Mirelman, D., 2003. Transcriptional silencing of an amoebapore gene in Entamoeba histolytica: molecular analysis and effect on pathogenicity. Eukaryotic Cell 2, 295–305. Brendel, K., Fisher, R.L., Krumdieck, C.L., Gandolfi, A.J., 1993. Precision-cut rat liver slice in dynamic organ culture for structure–toxicity studies. Methods in Toxicology 1, 222–230. Bruchhaus, I., Loftus, B.J., Hall, N., Tannich, E., 2003. The intestinal protozoan parasite Entamoeba histolytica contains 20 cysteine protease genes, of which only a small subset is expressed during in vitro cultivation. Eukaryotic Cell 2, 501–509. Catania, J.M., Pershing, A.M., Gandolfi, A.J., 2007. Precision-cut tissue chips as an in vitro toxicology system. Toxicology In Vitro 21, 956–961. Cieslak, P.R., Virgin, I.V., Stanley, S.L., 1992. A severe combined immunodeficient (SICD) mouse model for infection with Entamoeba histolytica. Journal of Experimental Medicine 176, 1605–1609. Ebsen, M., Mogilevski, G., Anhenn, O., Maiworm, V., Theegarten, D., Schwarze, J., Morgenroth, K., 2002. Infection of murine precision cut lung slices (PCLS) with respiratory syncytial virus (RSV) and Chlamydophila pneumonie using the Krumdieck technique. Pathology Research and Practice 198, 747–753. el-Refaii, A.H., 1993. Entamoeba bovis Liebetanz 1905 recorded from large ruminants in Egypt. Journal of the Egyptian Society of Parasitology 23, 239–245. Gianinazzi, C., Schild, M., Müller, N., Leib, S.L., Simon, F., Nuñez, S., Joss, P., Gottestein, B., 2005. Organotypic slice cultures from rat brain tissue: a new approach for Naegleria fowleri CNS infection in vitro. Parasitology 131, 797– 804. Groneberg, D.A., Grosse-Siestrup, C., Fischer, A., 2002. In vitro models to study hepatotoxicity. Toxicological Pathology 30, 394–399. Haseeb, A.N., el-Shazly, A.M., Arafa, M.A., Morsy, A.T., 2002. A review on fascioliasis in Egypt. Journal of the Egyptian Society of Parasitology 32, 317–354. Huston, C.D., 2004. Parasite and hosts contributions to the pathogenesis of amebic colitis. Trends in Parasitology 20, 23–26. Jarillo-Luna, R.A., Campos-Rodríguez, R., Tsutsumi, V., 2000a. Participation of neutrophils, macrophages, and endothelial cells in the amebic liver lesion in the mouse. Archives of Medical Research 31, S101–S103. Jarillo-Luna, R.A., Campos-Rodriguez, R., Tsutsumi, V., 2000b. Morphological changes of liver infected with trophozoites of Entamoeba histolytica. Archives of Medical Research 31, S251–S253. Lee, J., Park, S.J., Yong, T.S., 2008. Effect of iron on adherence and cytotoxicity of Entamoeba histolytica to CHO cell monolayers. Korean Journal of Parasitology 46, 37–40. Leippe, M., 1994. Amoebopores, a family of membranolytic peptides from cytoplasmic granules of Entamoeba histolytica: isolation, primary structure and pore formation in bacterial cytoplasmic membranes. Journal of Molecular Microbiologic Biotechnology 14, 895–904.
P. Carranza-Rosales et al. / Experimental Parasitology 126 (2010) 117–125 Leippe, M., Bruhn, H., Hecht, O., Grötzinger, J., 2005. Ancient weapons: the threedimensional structure of amoebapore A. Trends in Parasitology 21, 5–7. López-Vancell, R., Montfort, I., Pérez-Tamayo, R., 2000. Galactose-specific adhesin and cytotoxicity of Entamoeba histolytica. Parasitology Research 86, 226–231. Mishra, G.S., Gonzalez, J.P., 1978. Parasites of fresh water turtles in Tunisia. Archives de l’Institut Pasteur de Tunis 55, 303–326. Moronvalle-Halley, V., Sacré-Salem, B., Sallez, V., Labbe, G., Gautier, J.G., 2005. Evaluation of cultured, precision-cut rat liver slice as a model to study druginduced liver apoptosis. Toxicology 207, 203–214. Orozco, E., Guarneros, A., Martinez-Palomo, A., Sanchez, T., 1983. Entamoeba histolytica. Phagocitosis as a virulence factor. Journal of Experimental Medicine 158, 1511–1521. Parrish, R.A., Gandolfi, A.J., Brendel, K., 1995. Precision-cut tissue slices: applications in pharmacology and toxicology. Life Sciences 57, 1887–1901. Plazar, J., Hreljac, I., Pirih, P., Filipic, M., Groothuis, G.M., 2007. Detection of xenobiotic-induced DNA damage by the comet assay applied to human and rat precision-cut liver slices. Toxicology In Vitro 21, 1134–1142. Que, X., Reed, S.L., 2000. Cysteine Proteinases and the pathogenesis of amebiasis. Clinical Microbiology Reviews 13, 196–206. Reinertson, J.W., Thompson, P.E., 1951. Experimental amebic hepatitis in hamsters. Proceedings of the Society for Experimental Biology and Medicine 76, 518–520. Rigothier, M.C., Khun, H., Tavares, P., Cardona, A., Huerre, M., Guillén, N., 2002. Fate of Entamoeba histolytica during establishment of amoebic liver abscess analyzed by quantitative radioimaging and histology. Infection and Immunity 70, 3208– 3215. Russell, W.M.S., Burch, R.L., 1959. The principles of humane experimental technique. Metheun and Co. Ltd, London. Said-Fernández, S., Vargas-Villarreal, J., Castro-Garza, J., Mata-Cárdenas, B.D., Navarro-Marmolejo, L., Lozano-Garza, G., Martínez-Rodríguez, H., 1988. PEHPS medium: an alternative for axenic cultivation of Entamoeba histolytica and E. Invadens. Transactions of the Royal Society of Tropical Medicine and Hygiene 82, 249–253. Santi-Rocca, J., Weber, C., Guigon, G., Sismeiro, O., Coppée, J.Y., Guillén, N., 2008. The lysine- and glutamic acid-rich protein KERP1 plays a role in Entamoeba histolytica liver abscess pathogenesis. Cellular Microbiology 10 (1), 202–217. Seitz, H.M., 1995. Parasitic diseases of the liver. Verhandlungen der Deutschen Gesellschaft fur Pathologie 79, 241–248. Shibayama-Salas, M., Navarro-García, F., López-Revilla, R., Martínez-Palomo, A., Tsutsumi, V., 1997. In vivo and in vitro intestinal amebiasis in gerbils. Parasitology Research 83, 170–176. Shibayama, M., Campos-Rodríguez, R., Ramírez-Rosales, A., Flores-Romo, L., Espinosa-Cantellano, M., Martínez-Palomo, A., Tsutsumi, V., 1998. Entamoeba histolytica: liver invasion and abscess production by intraperitoneal inoculation
125
of trophozoites in hamsters, Mesocricetus auratus. Experimental Parasitology 88, 20–27. Singh, D., Naik, S.R., Naik, S., 2004. Contact of Entamoeba histolytica with baby hamster kidney-21 (BHK-21) cell line on cysteine proteinase activity. Indian Journal of Medical Research 119, 157–161. Tanimoto, M., Sepúlveda, B., Vázquez Saavedra, J.A., Landa, I., 1971. Lesiones producidas en el hígado por inoculación de Entamoeba histolytica cultivada en medio axénico. Archivos de Investigación Médica (México) 2, 275–284. Thohan, S., Zurich, M.C., Chung, H., Weiner, M., Kane, A.S., Rosen, G.M., 2001. Tissue slices revisited: evaluation and development of a short-term incubation for integrated drug metabolism. Drug Metabolism and Disposition 29, 1337–1342. Tsutsumi, V., Mena-Lopez, R., Anaya-Velazquez, F., Martinez-Palomo, A., 1984. Cellular bases of experimental amebic liver abscess formation. American Journal of Pathology 117, 81–91. Tsutsumi, V., Martinez-Palomo, A., 1988. Inflammatory reaction in experimental hepatic amebiasis. An ultrastructural study. American Journal of Pathology 130, 112–119. Tsutsumi, V., Shibayama, M., 2006. Experimental amoebiasis: a selected review of some in vivo models. Archives of Medical Research 37, 210–220. Van de Bovenkamp, M., Groothuis, G.M., Draaisma, A.L., Merema, M.T., Bezuijen, J.I., Van Gils, M.J., Meijer, D.K.F., Friedman, S.L., Olinga, P., 2005. Precision-cut liver slices as a new model to study toxicity-induced hepatic stellate cell activation in a physiologic milieu. Toxicological Sciences 85, 632–638. Velazquez, C., Shibayama-Salas, M., Aguirre-Garcia, J., Tsutsumi, V., Calderon, J., 1998. Role of neutrophils in innate resistance to Entamoeba histolytica liver infection in mice. Parasite Immunology 20, 255–262. Ventura-Juárez, J., Campos-Rodríguez, R., Ramírez-Rosales, A., Martínez-Palomo, A., Tsutsumi, V., 1997. Early in vivo interaction of Entamoeba histolytica trophozoites with hepatic parenchymal and inflammatory cells of hamster. Archives of Medical Research 28, S211–S213. Ventura-Juárez, J., Campos-Rodríguez, R., Tsutsumi, V., 2002. Early interactions of Entamoeba histolytica trophozoites with parenchymal and inflammatory cells in the hamster liver: an immunocytochemical study. Canadian Journal of Microbiology 48, 123–131. Verril, C., Davies, J., Millward-Sadler, H., Sundstrom, L., Sheron, N., 2002. Organotypic liver culture in a fluid-air interface using slices of neonatal rat and adult human tissue a model of fibrosis in vitro. Journal of Pharmacological and Toxicological Methods 48, 103–110. WHO (World Health Organization), 2009. State of the art of vaccine research and development. Initiative for Vaccine Research. Yue, J., Dong, G., He, C., Chen, J., Liu, Y., Peng, R., 2009. Protective effects of thiopronin against isoniazid-induced hepatotoxicity in rats. Toxicology 264, 185–191.