Preferential inputs from cholecystokinin-positive neurons to the somatic compartment of parvalbumin-expressing neurons in the mouse primary somatosensory cortex

Accepted Manuscript Research report Preferential Inputs from Cholecystokinin-Positive Neurons to the Somatic Compartment of Parvalbumin-Expressing Neurons in the Mouse Primary Somatosensory Cortex Hiroyuki Hioki, Jaerin Sohn, Hisashi Nakamura, Shinichiro Okamoto, Jungwon Hwang, Yoko Ishida, Megumu Takahashi, Hiroshi Kameda PII: DOI: Reference:

S0006-8993(18)30286-5 https://doi.org/10.1016/j.brainres.2018.05.029 BRES 45812

To appear in:

Brain Research

Received Date: Revised Date: Accepted Date:

2 June 2017 10 May 2018 19 May 2018

Please cite this article as: H. Hioki, J. Sohn, H. Nakamura, S. Okamoto, J. Hwang, Y. Ishida, M. Takahashi, H. Kameda, Preferential Inputs from Cholecystokinin-Positive Neurons to the Somatic Compartment of ParvalbuminExpressing Neurons in the Mouse Primary Somatosensory Cortex, Brain Research (2018), doi: https://doi.org/ 10.1016/j.brainres.2018.05.029

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Title Preferential Inputs from Cholecystokinin-Positive Neurons to the Somatic Compartment of Parvalbumin-Expressing Neurons in the Mouse Primary Somatosensory Cortex Hiroyuki Hiokia,b,*, Jaerin Sohnb,c,d, Hisashi Nakamurab,e, Shinichiro Okamotoa,b, Jungwon Hwanga,b, Yoko Ishidaa,b, Megumu Takahashib, Hiroshi Kamedaf

a

Department of Cell Biology and Neuroscience, Juntendo University Graduate School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan b

Department of Morphological Brain Science, Graduate School of Medicine, Kyoto University, Yoshida-Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan c Division of Cerebral Circuitry, National Institute for Physiological Sciences, 5-1 Higashiyama Myodaiji, Okazaki, Aichi 444-8787, Japan d Research Fellow of Japan Society for the Promotion of Science (JSPS), 5-3-1 Kojimachi, Chiyoda-ku, Tokyo 102-0083, Japan e Department of Anatomy, Kawasaki Medical School, 577 Matsushima, Kurashiki, Okayama 701-0192, Japan f Department of Physiology, Teikyo University School of Medicine, 2-11-1 Kaga, Itabashi-ku, Tokyo 173-8605, Japan

*

Correspondence author: Hiroyuki Hioki, M.D., Ph.D. Department of Cell Biology and Neuroscience, Juntendo University Graduate School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan Phone: 81 (Japan)-3-5802-1025 (Ext. 3505), Fax: 81-3-5800-0245 E-mail: [email protected]

Abstract Parvalbumin-positive (PV+) neurons in the cerebral cortex, mostly corresponding to fast-spiking basket cells, have been implicated in higher-order brain functions and psychiatric disorders. We previously demonstrated that the somatic compartment of PV+ neurons received inhibitory inputs mainly from vasoactive intestinal polypeptide (VIP)+ neurons, whereas inhibitory inputs to the dendritic compartment were derived mostly from PV+ and somatostatin (SOM)+ neurons. However, a substantial number of the axosomatic inputs have remained unidentified. Here we show preferential innervation of the somatic compartment of PV+ neurons by cholecystokinin (CCK)+ neurons in the mouse primary somatosensory cortex. CCK+ neurons, a minor population of GABAergic neurons (3.2%), displayed no colocalization with PV or SOM immunoreactivity but partial overlap with VIP immunoreactivity (27.7%). Confocal laser scanning microscopy observation of CCK+ synaptic inputs to PV+ neurons revealed that CCK+ neurons preferred the somatic compartment to the dendritic compartment of PV+ neurons and provided approximately 33% of the axosomatic inhibitory inputs to PV+ neurons. Additionally, 20.9% and 12.1% of the axosomatic inputs were derived from CCK+/VIP+ and CCK+/VIP-negative (–) neurons, presumably double bouquet and large basket cells, respectively. Furthermore, the densities of the axosomatic inputs from CCK+ and/or VIP+ neurons to PV+ neurons were not significantly different among the cortical layers. The present findings suggest that, by preferentially innervating the cell bodies of PV+ neurons, both CCK+/VIP– basket and CCK+/VIP+ double bouquet cells might efficiently interfere with action potential generation of PV+ neurons, and that the two types of CCK+ neurons might have a large impact on cortical activity through PV+ neuron inhibition.

Keywords: gephyrin, inhibitory synapse, interneuron, microcircuit, neocortex, transgenic mice. 2

1. Introduction The mammalian neocortex primarily contains two types of neurons, glutamatergic pyramidal cells and γ-aminobutyric acid-ergic (GABAergic) non-pyramidal cells (DeFelipe and Farinas, 1992; Peters and Jones, 1984). Although GABAergic inhibitory neurons comprise a small population in the neocortex, approximately 20% of neurons (Beaulieu, 1993),

they

exhibit

huge

diversity

in

terms

of

morphological

characteristics,

electrophysiological properties, and neurochemical markers (Ascoli et al., 2008; Cauli et al., 2000; DeFelipe, 1993; DeFelipe et al., 2013; Gupta et al., 2000; Jiang et al., 2015; Kubota et al., 2011; Kubota, 2014; Markram et al., 2004). Neurochemical markers based on gene expression profiles have become the standard way of classifying GABAergic neurons, since each cell type can be readily identified by immunostaining and visualized by genetic engineering (e.g., knock-in and transgenic animals) (Taniguchi, 2014). Parvalbumin- (PV+), somatostatin- (SOM+), and vasoactive intestinal polypeptide-positive (VIP+) neurons constitute distinct subpopulations of GABAergic neurons (Gonchar and Burkhalter, 1997; Rudy et al., 2011; Xu et al., 2010). Individual cell types classified by the chemical characteristics largely correspond to unique morphological and electrophysiological properties (Kubota, 2014): PV+ neurons are mostly fast-spiking (FS) basket cells (Blatow et al., 2003; Burkhalter, 2008; Kawaguchi and Kondo, 2002; Markram et al., 2004); SOM+ neurons mainly display layer (L) 1-targeting axonal arborization, called Martinotti cells with regular spiking properties (Kawaguchi and Kubota, 1996; Ma et al., 2006; McGarry et al., 2010; Wang et al., 2004); and VIP+ neurons show vertically-extended dendritic and axonal morphologies, characterized as bipolar, bitufted, or double-bouquet cells (Pronneke et al., 2015; Sohn et al., 2016). PV+ neurons, mostly corresponding to FS basket cells, constitute about 40% of GABAergic neurons in the neocortex (Cauli et al., 1997; Cauli et al., 2000; Hu et al., 2014;

Kawaguchi and Kubota, 1993; Kawaguchi, 1995; Kawaguchi and Kubota, 1998; Kawaguchi and Kondo, 2002; Zaitsev et al., 2005; Zaitsev et al., 2009). In the mouse neocortex, FS chandelier and non-FS multipolar bursting cells, two minor populations of PV+ neurons, were reportedly located at the border of L1 and L2 (Blatow et al., 2003; Jiang et al., 2015; Woodruff et al., 2009). PV+ FS basket cells preferentially innervate the perisomatic region of pyramidal cells, and efficiently suppress action potential generation in the cerebral cortex (Freund, 2003; Freund and Katona, 2007; Somogyi et al., 1998; Tamas et al., 1997; Thomson et al., 1996; Thomson and Lamy, 2007). Furthermore, PV+ neurons contribute to the generation and maintenance of gamma oscillations (Bartos et al., 2007; Cardin et al., 2009; Hestrin and Galarreta, 2005; Sohal et al., 2009; Somogyi and Klausberger, 2005; Whittington et al., 1995). As a result of this gamma-band activity, PV+ neurons are assumed to be involved in higher-order brain functions including memory (Bartos et al., 2007; Letzkus et al., 2011), and psychiatric disorders such as autism spectrum disorders (Orekhova et al., 2007; Sohal, 2012) and schizophrenia (Bissonette et al., 2015; Gonzalez-Burgos et al., 2015; Lewis et al., 2005; Lewis et al., 2012). Thus, revelation of the precise structural rules of the PV+ neuron network should be essential for the fundamental understanding of brain functions and mental disorders (Hu et al., 2014). Recently, we have generated bacterial artificial chromosome (BAC) transgenic mice to efficiently visualize the dendrites and cell bodies of PV+ neurons (Kameda et al., 2012), and revealed the compartmental organization of cell-type specific inhibitory inputs to PV+ neurons in the mouse primary somatosensory cortex (S1) (Hioki et al., 2013; Hioki, 2015). The somatic compartment of PV+ neurons mainly received inhibitory inputs from VIP+ neurons, whereas the dendritic compartment was mostly innervated by PV+ and SOM+ neurons. However, a substantial number (26.4%) of the axosomatic inhibitory inputs to PV+ neurons have remained unidentified. This result raised the further question of which types of

4

GABAergic neurons, other than PV+, SOM+ and VIP+ neurons, provide the axosomatic inhibitory inputs to PV+ neurons. Since the axosomatic inputs block the action potential generation much more efficiently than the axodendritic ones (Miles et al., 1996), precise configuration of site-specific inputs should be revealed to understand the regulation mechanism(s) of PV+ neuron excitability. In the hippocampus, morphological and electrophysiological techniques have shown that PV+ neurons receive inhibitory inputs from cholecystokinin (CCK)+ GABAergic neurons (Acsady et al., 2000; Foldy et al., 2007; Karson et al., 2008; Karson et al., 2009). The synaptic inputs from CCK+ neurons to the somata and proximal dendrites of PV+ neurons were clearly demonstrated, but the inputs to the distal dendrites were not intensively examined in those studies. In the neocortex, as in the hippocampus, a small population of GABAergic neurons expresses CCK. CCK+ neurons are negative for PV or SOM immunoreactivity, but a part of CCK+ neurons also express VIP (Demeulemeester et al., 1988; Kawaguchi and Kubota, 1998; Kawaguchi, 2001; Kawaguchi and Kondo, 2002; Kosaka et al., 1987; Kubota et al., 2011). Neocortical CCK+ neurons can then be further divided into two types by morphological features and immunoreactivity for VIP; VIP+ small cells with bipolar or bitufted dendrites and VIP-negative (–) large cells with multipolar or bitufted dendrites (Kawaguchi and Kondo, 2002; Kubota and Kawaguchi, 1997). It has remained unclear whether PV+ neurons directly receive inhibitory inputs from CCK+ neurons in the neocortex as well in the hippocampus, and if so, whether CCK+ neurons innervate the distal portion of PV+ dendrites. In the present study, we visualized CCK+ axon terminals and inhibitory postsynaptic sites by immunofluorescence staining in the BAC transgenic mice, in which the distal dendrites of PV+ neurons are well visualized. We then quantitatively analyzed inhibitory inputs from CCK+ neurons to the somatic and dendritic compartments of PV+

5

neurons using confocal laser scanning microscopy. Furthermore, we examined the colocalization of CCK and VIP immunoreactivities, not only on the cell bodies but also on the axosomatic inputs to PV+ neurons.

6

2. Results 2.1 Production and characterization of guinea pig anti-VIP antibody For multiple immunofluorescence staining, we produced anti-VIP antibody. Antibody against VIP was raised in guinea pig, and affinity-purified on the antigen columns. In the Western blot analysis with mouse brain extract, guinea pig and rabbit (commercial one) antibodies against VIP detected no band, maybe due to the small molecular weight of VIP (4 kDa). We then prepared human embryonic kidney (HEK) 293 cells expressing GFP-VIP fusion protein or GFP, and performed Western blotting analysis with the extract of HEK 293 cells (Fig. 1A). Both guinea pig and rabbit antibodies against VIP recognized protein bands of 30 kDa (arrowheads in Fig. 1A), which correspond to the predicted molecular weight of GFP-VIP fusion protein. On the other hand, with the extract of HEK 293 cells containing GFP, no band was observed. In the immunohistochemical application, adjacent sections were immunostained with guinea pig or rabbit antibody against VIP. In the S1, CCK immunoreactivity was observed not only in the cell bodies and proximal dendrites but also in the axon terminals across cortical layers with both antibodies (Fig. 1B1–C3). In the suprachiasmatic nucleus (SCN; Fig. 1D1–E3) and central nucleus of the amygdala (CeA; Fig. 1F1–G3), both antibodies detected intense immunoreactivities in the axon terminal-like structures but not in the cell bodies. These observations are in good agreement with the previous reports (Loren et al., 1979; Roberts et al., 1980; Sims et al., 1980), and there was no obvious difference in the immunoreactivities between guinea pig or rabbit antibody against VIP.

2.2 CCK+ neurons in the mouse S1 The cell bodies of CCK+ neurons were distributed mainly in L2/3 of the S1, and almost all of them displayed the signals for glutamate decarboxylase 67 kDa isoform 7

(GAD67) mRNA (Fig. 2A1–A3; Table1). Conversely, only 3.2% of GAD67-expressing neurons were positive for CCK (Table 1). In addition, CCK+ neurons were immunoreactive for GABA. We also found that some CCK+ axon terminal-like structures showed the immunoreactivity for vesicular GABA transporter (VGAT), which is one of the markers for inhibitory axon terminals (Chaudhry et al., 1998). The other CCK+/VGAT– terminals might be derived from neocortical excitatory neurons (Burgunder and Young, 1990) or thalamic neurons (Schiffmann and Vanderhaeghen, 1991). These results indicate that CCK+ neurons constitute a small subpopulation of GABAergic neurons in the S1. We then examined the colocalization of immunoreactivities for CCK and PV, SOM, or VIP in the cell bodies. As previously reported in the rat (Gonchar and Burkhalter, 1997; Kawaguchi and Kondo, 2002) and cat neocortex (Demeulemeester et al., 1991), CCK+ neurons were negative for PV and SOM (Fig. 2B1–C3). Conversely, CCK and VIP immunoreactivities were frequently colocalized in L1–3 (Fig. 2D1–D3). Although the number of CCK+ and/or VIP+ neurons were quite a few in L1, 33.3% of CCK+ and 16.7% of VIP+ neurons were immunoreactive for VIP and CCK, respectively. In L2/3, where most VIP+ neurons were also distributed (Table 1), 42.7% of CCK+ neurons displayed immunoreactivity for VIP, and 13.6% of VIP+ neurons for CCK. In L4–6, the colocalization rate was low; around 10% of CCK+ neurons or 7% of VIP+ neurons were immunoreactive for VIP or CCK, respectively. In total, 27.7% (148/530) of CCK+ neurons were positive for VIP, and 11.3% (148/1350) of VIP+ neurons showed immunoreactivity for CCK (Fig. 2E; Table 1). Consequently, CCK+/VIP–, CCK+/VIP+, and CCK–/VIP+ neurons constituted 2.3%, 0.9%, and 8.8% of GABAergic neurons, respectively.

2.3 Observation of CCK inputs to the dendrites and cell bodies of PV+ neurons After triple immunofluorescence staining for GFP, CCK, and gephyrin in the

8

sections obtained from the transgenic mice, we observed inhibitory inputs from CCK+ neurons (CCK inputs) to PV+ neurons under a confocal laser scanning microscope. The dendrites and cell bodies of PV+ neurons were clearly labeled by somatodendritic membrane-targeted GFP (myrGFP-LDLRCT) in the transgenic mice (Kameda et al., 2012). Gephyrin is one of the scaffold proteins for GABAA and glycine receptors (Fritschy et al., 2008), and is a reliable marker for inhibitory postsynaptic sites as demonstrated by light and electron microscopic observations in the previous studies (Hioki et al., 2013; Li et al., 2012). In the middle portion of each layer, we selected 6 PV+ neurons that could be traced up to dendrites 140 μm away from the cell body in 40-µm-thick sections. We then sampled data on the dendritic compartments 20, 80, and 140 µm along the dendrite away from the cell body. Three-dimensional image stacks of high magnification were captured at the dendritic compartments located at the three different distances from the cell body. Each analyzed dendritic compartment was 14.7–20.1 µm long, and its center was located exactly at 20, 80 or 140 µm from the cell body. We chose one dendrite per cell, and all analyzed dendrites were located in the same layer as the cell bodies. For somatic inputs from CCK+ neurons to PV+ neurons, we randomly selected 3 sites per soma in the thin optical sections that ran through the center of the cell body and acquired three-dimensional image stacks of higher magnification. The close contacts between CCK+ axon terminals and GFP+ somatodendritic membrane of PV+ neurons were observed in the XY, XZ, and YZ planes. We counted those contacts as putative input sites only when gephyrin immunoreactivity was detected at the somatodendritic side of those close contacts (arrowheads in Fig. 3A1–B4).

2.4 Estimation of CCK input density to PV+ neurons After counting CCK input numbers within the three-dimensional image stacks, we

9

estimated the input density [/µm2] by dividing the input number by the surface area of interest [µm2]. The somatodendritic surface area was calculated from image stacks in three-dimensional space as reported previously (Hioki et al., 2013; Sohn et al., 2016). The data obtained from all 24 dendrites and cell bodies in L2–6 were pooled (Fig. 4A), since there was no significant difference in the densities of CCK inputs to the cell bodies and dendrites of PV+ neurons among cortical layers (Table 2). The density of CCK inputs was considerably higher at the somatic compartment than at the dendritic compartment. This clearly indicates that CCK+ neurons preferentially innervate the cell bodies of PV+ neurons instead of the dendrites. We also estimated the number of CCK inputs per single PV+ neuron at each compartment (Table 3), as reported in the previous studies (Hioki et al., 2013; Hioki, 2015; Kameda et al., 2012). Since the surface area of the dendrites was much larger than that of the cell bodies, the total input number was not proportional to the input density. Although the density of GABAergic inputs was higher on the cell bodies than on the dendrites (Fig. 4A), GABAergic inputs per PV+ neuron were approximately 6-fold more numerous on the dendrites (1786.8) than the cell bodies (310.0; Fig. 4B). In contrast, the estimated number of CCK inputs to single PV+ neurons did not greatly differ between the cell bodies (97.9) and dendrites (85.7; Fig. 4B). Consequently, PV+ neurons received 31.8% and 3.4–5.2% of inhibitory inputs from CCK+ neurons at the somatic and dendritic compartments, respectively. This indicates that CCK+ neurons greatly contribute to the axosomatic inhibitory inputs to PV+ neurons.

2.5 CCK and/or VIP inputs to PV+ cell body In the previous study, we demonstrated that VIP inputs also preferred the somatic compartment of PV+ neurons (Hioki et al., 2013). Since some CCK+ neurons are also

10

immunoreactive for VIP as described above (Fig. 2D1–D3; Table 1), the next question was whether or not the axosomatic inputs from CCK+ neurons display VIP immunoreactivity. To address this, we performed quadruple immunofluorescence staining for GFP, CCK, VIP, and gephyrin on the sections obtained from the transgenic mice (Fig. 5A–C4). We randomly chose 84 PV+ neurons (from three mice) in L2–6 of the S1, selected 3 sites per soma, and observed the axosomatic inputs from CCK+ and/or VIP+ neurons by taking three-dimensional image stacks. CCK+/VIP+ axon varicosities made close contacts with the GFP+ somatic membrane of PV+ neurons, and gephyrin immunoreactivity was detected at the somatic side of the contacts (arrowheads in Fig. 5). We also found that CCK+/VIP– or CCK–/VIP+ axon terminals made contacts with areas of gephyrin immunoreactivity on the GFP+ somatic membrane of PV+ neurons (double arrowheads or arrows in Fig. 5). We then calculated the input densities of CCK+ and/or VIP+ axosomatic inputs to PV+ neurons and prepared scatter plots (Fig. 6A–C). The density of CCK inputs appeared independent of the cortical depth (Fig. 6A), and there was no statistically significant difference among cortical layers. The density of VIP inputs was 1.8 times higher than that of CCK inputs, and we also found no significant difference among cortical layers (Fig. 6B). CCK+/VIP+ inputs accounted for 63.3% of CCK inputs and 34.9% of VIP inputs, and no difference was detected among cortical layers (Fig. 6C).

11

3. Discussion In the present study, we provided the first evidence that CCK+ neurons preferentially innervate the somatic compartment of PV+ neurons in the mouse S1 by analyzing the inhibitory inputs to PV+ neurons including the distal dendrites. Although CCK+ neurons constituted only a small fraction (3.2%) of GABAergic neurons, single PV+ neurons received 8.7% (183.7/2124.0) of inhibitory inputs from CCK+ neurons (Fig. 4B), and about 30% of the axosomatic inhibitory inputs to PV+ neurons were derived from CCK+ neurons (Fig. 6D). It is also notable that the overlap of CCK and VIP immunoreactivities was more frequently observed in the axosomatic inputs to PV+ neurons than in the cell bodies of GABAergic neurons (Figs. 1E, 6D). Although CCK+/VIP+ neurons comprised only 0.9% of GABAergic neurons, 20.9% of the axosomatic inputs to PV+ neurons were derived from CCK+/VIP+ neurons. On the other hand, CCK+/VIP– and CCK–/VIP+ neurons, constituting 2.3% and 8.8% of GABAergic neurons, provided 12.1% and 39.0% of inhibitory inputs to the somatic compartment of PV+ neurons, respectively. The preferential innervation of PV+ neurons, especially in the somatic compartment, by CCK+ and/or VIP+ neurons suggests that the design of neocortical microcircuits composed of PV+ neurons is not random but specific in terms of cell types and input sites.

3.1 Axosomatic inhibitory inputs to PV+ neurons Inhibitory synapses show no distance-dependent scaling, which increases conductance at the distal-dendritic segments and normalizes the impact in soma, and the effect of inhibition has been considered to be primarily local according to cable theory (Andrasfalvy and Mody, 2006; Spruston, 2008). As a result, perisomatic inhibitions precisely control the timing of action potential generation, whereas dendritic inhibitions modify the 12

local excitatory postsynaptic potentials (EPSPs) evoked by glutamatergic inputs (Miles et al., 1996; Williams and Stuart, 2003). It is thus likely that CCK+ and/or VIP+ neurons efficiently inhibit the activity of PV+ neurons by the axosomatic inputs. This inhibition of PV+ neurons might lead to an increase in pyramidal cell excitability, since PV+ FS basket cells innervate the perisomatic segments of pyramidal cells and strongly regulate the activity of pyramidal cells (Freund and Katona, 2007; Somogyi et al., 1998; Tamas et al., 1997; Tanaka et al., 2011; Thomson et al., 1996; Thomson and Lamy, 2007). Indeed, optogenetic and whole cell recording techniques at a cellular spatial resolution have shown that VIP+ neurons facilitate the activity of pyramidal cells via inhibition of other types of inhibitory neurons such as PV+ and SOM+ neurons (Fu et al., 2014; Lee et al., 2013; Pfeffer et al., 2013; Pi et al., 2013; Zhang et al., 2014). Although the present study revealed that CCK+ and/or VIP+ neurons provided the vast majority (72.0%) of the axosomatic inputs to PV+ neurons, 16.2% of the axosomatic inputs remain unidentified and might be derived from other types of GABAergic neurons. GABAergic neurons other than PV+ and SOM+ neurons are highly heterogeneous and many markers have been reported besides VIP and CCK, including calretinin (CR) (Kubota et al., 1994), choline acetyltransferase (Bayraktar et al., 1997), corticotropin-releasing factor (Demeulemeester et al., 1988), preprotachykinin B

(Kaneko and Mizuno, 1988),

preproenkephalin (Taki et al., 2000), µ-opioid receptor (Taki et al., 2000), and vesicular glutamate transporter 3 (Hioki et al., 2004). The morphological, electrophysiological, and neurochemical characteristics of CR+ neurons have been intensively investigated (Cauli et al., 2014), since CR+ neurons do not express PV or SOM, and account for a comparatively large population in the rat neocortex. However, several studies have established that some CR+ neurons in the mouse neocortex also displayed SOM immunoreactivity (Cauli et al., 2014; Gonchar et al., 2007; Sohn et al.,

13

2014; Xu et al., 2006). Moreover, although late-spiking cells including neurogliaform cells and L1 interneurons have been reported to directly innervate basket cells (Jiang et al., 2013; Jiang et al., 2015; Letzkus et al., 2011), no neurochemical marker is available to visualize those neurons in the mouse neocortex. Further classification and identification of GABAergic neurons are anticipated with novel approaches such as ‘patch-seq,’ which integrates whole-cell recordings with single-cell RNA sequencing (Fuzik et al., 2015). In addition, it was surprising that the densities of the axosomatic inputs from CCK+ and/or VIP+ neurons to PV+ neurons were not statistically different among the cortical layers (Fig. 6A–C), though CCK+/VIP+ cell bodies were more frequently distributed in L2/3 than in the deeper layers (Table 1). We have also revealed in the previous study that the densities of PV, SOM, and VIP inputs to PV neurons showed no significant differences among the cortical layers at any somatodendritic location (Hioki et al., 2013). These findings suggest that there is a specific rule in the connectivity on PV+ neurons regardless of the laminar structure of the neocortex.

3.2 CCK-expressing neurons in the neocortex In situ hybridization histochemistry detected CCK mRNA in neocortical excitatory neurons as well (Burgunder and Young, 1990; Hokfelt et al., 2002; Ingram et al., 1989; Schiffmann and Vanderhaeghen, 1991; Watakabe et al., 2012). It was also reported that pyramidal cells expressed CCK mRNA by single-cell multiplex reverse transcription polymerase chain reaction (RT-PCR) (Cauli et al., 1997; Cauli et al., 2000). However, CCK immunoreactivity has been found only in GABAergic neurons and utilized as one of the markers for GABAergic neurons negative for either PV or SOM in the rat and cat neocortex (Demeulemeester et al., 1988; Kawaguchi and Kubota, 1998; Kawaguchi, 2001; Kawaguchi and Kondo, 2002; Kosaka et al., 1987; Kubota et al., 2011). It has been reported that CCK+

14

neurons were very scarcely observed in the rodent neocortex (Xu et al., 2010), and approximately 5% of GABAergic neurons expressed CCK in the frontal and visual cortices (Gonchar et al., 2007; Uematsu et al., 2008). The present findings that almost all CCK+ neurons expressed GAD67 mRNA and that CCK+ neurons constituted only a small fraction of GABAergic neurons in the mouse S1 agree with those previous reports. It was, however, reported that more than 10% of GFP-positive cells co-expressed CCK in GAD65-GFP transgenic mice in the neocortex (Lopez-Bendito et al., 2004). In this mouse strain, only ~71% of GFP-expressing cells were positive for GABA, and inversely, only ~51 % of GABA-positive cells expressed GFP in the neocortex. Furthermore, ~94% of CCK+ neurons expressed GFP in the transgenic mouse line, whereas ~5% and ~2% of PV+ and SOM+ neurons expressed GFP, respectively. These observations indicate that GFP was expressed not in all GABAergic neurons but in a specific composition of both GABAergic and glutamatergic neurons. Therefore, it is likely that the fraction of CCK+ neurons in all GABAergic neurons was overestimated in the transgenic mouse line. Further study should be carefully conducted to determine the number of CCK+ neurons in each cortical area.

3.3 CCK+ axon terminals in the neocortex CCK mRNA was also expressed in the subcortical regions projecting to the neocortex, such as the thalamic nuclei (Hokfelt et al., 1991; Schiffmann and Vanderhaeghen, 1991; Voigt and Uhl, 1988). Thus, CCK+ axon terminals might be derived not only from neocortical GABAergic neurons but also from neocortical and thalamic excitatory neurons. Indeed, electron microscopy revealed that CCK+ axon terminals made both symmetric and asymmetric synapses in the neocortex (Hendry et al., 1983; Peters et al., 1983). In the present study, we observed a high density of CCK+ axon terminals in the neocortex, most of which did not make close contacts with areas of gephyrin immunoreactivity (see Fig. 3 and 5).

15

Gephyrin is a scaffolding protein for GABAA and glycine receptors at inhibitory synapses (Fritschy et al., 2008). We previously confirmed the reliability of gephyrin immunoreactivity as a marker for postsynaptic inhibitory sites by light and electron microscopic observations (Hioki et al., 2013; Li et al., 2012). Since we counted CCK inputs to PV+ neurons with the aid of gephyrin immunoreactivity in the present analysis, those inputs are assumed to be derived mostly, if not completely, from CCK+ GABAergic neurons but not cortical and thalamic excitatory neurons. In addition, since CCK is one of the neuropeptides targeted to dense core vesicles in axon terminals (van den Pol, 2012), the possibility should be considered that the poor penetration of the antibody would cause the incomplete labeling of the axon terminals, which affect the perisomatic and dendritic inputs differently.

3.4 Two types of CCK+ GABAergic neurons in the neocortex CCK+ GABAergic neurons in the neocortex have been roughly divided into two subtypes by the morphological and neurochemical characteristics, and by the different responses with the administration of cholinergic agonist (Kawaguchi, 1997; Porter et al., 1999). Small cells with bipolar or bitufted dendrites display VIP immunoreactivity, whereas large cells with multipolar or bitufted dendrites are immunonegative for VIP but positive for the type 1 cannabinoid receptor (CB1) (Bodor et al., 2005; Kawaguchi and Kubota, 1997; Kubota and Kawaguchi, 1997). Cholinergic stimulation induces only a slow depolarization to small CCK+ neurons, whereas large CCK+ neurons displayed a biphasic response, a hyperpolarization followed by a slow depolarization (Kawaguchi, 1997). Large CCK+ neurons are known to be basket cells, which innervate the perisomatic segments of neocortical pyramidal cells and efficiently control the timing of the action potentials of pyramidal cells, as with PV+ basket cells (Freund et al., 1986; Freund, 2003; Hendry et al., 1983; Kawaguchi and Kubota, 1997; Kawaguchi and Kondo, 2002; Wang et al.,

16

2002). These two types of basket cells, large CCK+ and PV+ neurons, differ in firing properties. PV+ basket cells display a FS firing pattern, whereas large CCK+ basket cells have a regular-spiking or burst-spiking pattern (Kawaguchi and Kubota, 1998). Although the functional differences of the two major types of inhibitory neurons targeting perisomatic region of pyramidal cells remain uncertain, PV+ basket cells may behave as conductors for cortical network oscillations, and large CCK+ basket cells may modulate the synchronous ensemble activities in the cerebral cortex (Buzsaki, 1996; Freund, 2003; Freund and Katona, 2007; Whissell et al., 2015). These two basket cell types have been assumed to act independently in neuronal networks, but CCK+ and PV+ basket cells were recently shown to be directly interconnected in the hippocampus (Acsady et al., 2000; Karson et al., 2009). The present study elucidated that CCK+/VIP– neurons, presumably basket cells, preferentially targeted the somatic compartment of PV+ neurons in the neocortex. This suggests that large CCK+ basket cells might directly interfere with the synchronous activity generated by PV+ basket cells in the neocortex. Small CCK+ neurons, mostly corresponding to double bouquet cells in the neocortex, have narrow descending axons running across the cortical layers (Freund et al., 1986; Kawaguchi and Kubota, 1997; Kawaguchi and Kondo, 2002), as with VIP+ bipolar cells (Bayraktar et al., 2000; Connor and Peters, 1984; Kawaguchi and Kubota, 1996; Pronneke et al., 2015; Sohn et al., 2017). Although the roles of CCK+/VIP+ neurons in the regulation of network in the hippocampus and neocortex remain unclear, these vertically oriented axonal plexuses might be suitable for translaminar inhibition of other neurons. Vertically running axons of CCK+/VIP+ as well as CCK–/VIP+ neurons thus may inhibit PV+ neurons in both the superficial and deep cortical layers, and the activity of pyramidal cells may increase within a columnar or subcolumnar structure through the inhibition of PV+ neurons.

17

3.5 Cholinergic modulation of CCK+ and/or VIP+ neurons in the neocortex Cholinergic inputs to the neocortex play crucial roles in cognitive functions by altering brain activity states (Metherate et al., 1992). The excitability of VIP+ neurons is controlled not only by cortical inputs but also by neuromodulators such as acetylcholine (Kepecs and Fishell, 2014; Mesik et al., 2015). Stimulation of cholinergic neurons in the basal forebrain, causing strong cortical desynchronization, activated VIP+ neurons and/or L1 interneurons via nicotinic receptors (Alitto and Dan, 2012; Fu et al., 2014). These activations by cholinergic inputs are implicated in associative fear learning and enhancement of sensory information processing by disinhibition of pyramidal cells through PV+ neuron inhibition (Fu et al., 2015; Letzkus et al., 2011; Letzkus et al., 2015). On the other hand, cholinergic modulation of CCK+ neurons has been investigated in acute slices. After the administration of cholinergic agonists, large CCK+ neurons displayed a biphasic response, a hyperpolarization followed by a slow depolarization (Kawaguchi, 1997). These neurons were immunonegative for VIP and assumed to be basket cells according to the axonal morphology. Small CCK+ neurons with narrow descending axons, however, specifically double bouquet cells, exhibited only a slow depolarization (Kawaguchi, 1997). In addition, nicotinic receptor agonists induced excitation in CCK+/VIP+ neurons, presumably double bouquet cells, but not in pyramidal cells or PV+ FS cells (Porter et al., 1999). These findings suggest that cholinergic inputs might modulate the cortical activity in vivo through large CCK+ basket cells and small CCK+ double bouquet cells. Although CCK+ neurons are a minor population of GABAergic neurons (3.2%), they may have a large impact on cortical activity via the axosomatic inputs to PV+ neurons and play an important role in higher-order brain functions, as with VIP+ neurons

18

4. Experimental Procedure All animal care and use were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and the Committee for Animal Care and Use and the Committee for Recombinant DNA Study at Kyoto and Juntendo University approved all experiments. Adult male C57BL/6 mice (8–12 weeks; Japan SLC, Hamamatsu, Japan), adult male transgenic mice (8–12 weeks), and female guinea pigs (200 g; Shimizu Experimental Materials, Kyoto, Japan) were used. The transgenic mice express somatodendritic membrane-targeted green fluorescent protein (myrGFP-LDLRct) specifically in PV+ neurons, and the dendrites and cell bodies of PV+ neurons are entirely visualized in the mice (Kameda et al., 2012). All efforts were made to minimize animal suffering and number of animals used.

4.1 Tissue preparation Transgenic and wild type mice were deeply anesthetized by intraperitoneal injection of chloral hydrate (7 mg/10 g body weight), and perfused transcardially with 20 ml of 5 mM phosphate-buffered 0.9% saline (PBS; pH 7.4), followed by perfusion for 5 min with the same volume of 4% formaldehyde, 75%-saturated picric acid, and 0.1 M Na2HPO4 (adjusted to pH 7.2 with NaOH). The brains were removed and post-fixed for 4 hr at 20–25ºC with the same fixative. After cryoprotection with 30% sucrose in 0.1 M sodium phosphate buffer (PB; pH7.4), the brains were cut into 40-µm-thick coronal sections on a freezing microtome. For in situ hybridization histochemistry, we instead used 4% formaldehyde in 0.1 M PB as a fixative and post-fixed the brain blocks with the same fixative for 3 days at 4˚C in three wild type mice. After cryoprotection with 30% sucrose in 0.1 M PB, the brains were cut into 40-µm-thick coronal sections on a freezing microtome.

19

4.2 Production of antibody against VIP VIP (HSDAVFTDNYTRLRKQMAVKKYLNSILN) was synthesized with the addition of N- or C-terminal cysteine for coupling of the peptide with a carrier protein. The peptide was conjugated with an equal weight of maleimide-activated bovine serum albumin (Pierce, Rockford, IL) through the N- or C-terminal cysteine. Guinea pigs were immunized by intracutaneous injections of each conjugate (0.5 mg/animal) in Freund’s complete adjuvant (Difco, Detroit, MI), and of the same amount in incomplete adjuvant 4 weeks later. The sera were collected 2 weeks after the second immunization and purified to a crude γ-globulin fraction by ammonium sulfate fractionation (50% saturation). The polyclonal antibodies were further processed by affinity chromatography on a SulfoLink gel (Pierce) coupled with each peptide (2 mg peptide/ml gel). The specific antibodies were eluted from the columns with 0.1 M glycine-HCl (pH 2.5). No difference in immunostaining was observed between VIP antibodies to which either N- or C-terminal cysteine had been added, and a mixture of the antibodies was utilized in the present study.

4.3 Characterization of guinea pig antibody against VIP We amplified GFP and GFP-VIP fusion sequences by polymerase chain reaction (PCR) with following primer sets; AAAAGAATTCGCCACCATGGTGAGCAAGGG / TTTTGCGGCCGCTTACTTGTACAGCTCGTCCA

for

GFP;

and

AAAAGAATTCGCCACCATGGTGAGCAAGGG

/

AAAAGCGGCCGCTTAATTCAGGATGGAGTTCAGGTATTTCTTCACAGCCATTTGCT TTCTGAGGCGGGTGTAGTTATCTGTGAAGACGGCATCAGAGTGCTTGTACAGCTCG TC for GFP-VIP. The PCR products were then inserted into the EoRI/NotI sites of pCAGEN (Addgene plasmid 11160), resulting in pCAG-GFP and pCAG-GFP-VIP. The plasmids were transfected into HEK293T cells (RCB2202, Riken, Japan) by

20

using Lipofectamine™ 2000 (Life Technologies, Carlsbad, CA). Two days after the transfection, whole-cell protein containing GFP (26 kDa) or GFP-VIP (30 kDa) was extracted with CelLytic™ MT (Sigma-Aldrich, St. Louis, MO). The whole-cell protein solution was mixed with EzApply (AE-1430; Atto, Tokyo, Japan) at a ratio of 1:1, boiled for 5 min and electrophoresed in a 10–20% gradient polyacrylamide gel (E-T1020L; Atto). Electrophoresed proteins were further transferred onto a polyvinylidene difluoride membrane (Millipore, Billerica, MA). After blocking with Block-Ace (Dainippon Sumitomo Pharma, Osaka, Japan), the membranes were incubated overnight at room temperature with 1 µg/ml guinea pig or rabbit (20077; ImmunoStar, Hudson, WI) antibody against VIP, and then for 1 hr with alkaline phosphatase-conjugated goat antibody to guinea pig IgG (0.1 µg/ml, AP108A; Millipore) or to rabbit IgG (0.05 µg/ml, AP156A; Millipore). The antibodies were diluted with PBS containing 10% (v/v) Block-Ace and 0.2% (v/v) Tween-20. The membranes were finally

developed

with

0.375

mg/ml

nitroblue

tetrazolium

and

0.188

mg/ml

5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; Roche Applied Science, Basel, Switzerland) in 0.1 M Tris-HCl (pH9.5), 0.1 M NaCl and 50 mM MgCl2. All incubations were performed at 20–25ºC and followed by three rinses for 10 min each with PBS containing 0.3% (v/v) Triton X-100 (PBS-X). Adjacent coronal sections were incubated overnight with 1 µg/ml guinea pig or rabbit antibody against VIP in PBS-X containing

0.25%

λ-carrageenan

and

1%

normal

goat

serum

(PBS-XCG).

Lambda-carrageenan was used to make the incubation medium highly viscous and contribute to avoidance of uneven binding of antibodies to sections (Kaneko and Mizuno, 1988). The sections were subsequently incubated for 2 hr with 5 µg/mL AlexaFluor (AF) 488-conjugated antibody against guinea pig IgG (A-11073; Life Technologies) or rabbit IgG (A-11034; Life Technologies). After counterstaining with 10 µg/ml of propidium iodide (PI), the sections were mounted on gelatinized glass slides and coverslipped with 50% (v/v) glycerol and 2.5%

21

(w/v) triethylenediamine (antifading reagent) in PBS. When the primary antibody was pre-incubated with an excess amount of the antigen peptide, no immunoreactivity was observed in murine tissue sections

4.4 Combined labeling of immunofluorescence staining and fluorescent in situ hybridization The following hybridization procedure was carried out as reported previously (Hioki et al., 2010; Hioki et al., 2013; Ma et al., 2011; Sohn et al., 2014). Briefly, free-floating sections obtained from the wild type mice were hybridized for 16–20 hr at 60˚C with 1 µg/mL digoxigenin (DIG)-labeled sense or antisense riboprobe (Roche Applied Science, Mannheim, Germany) for GAD67 (nucleotides 855−1788 in GenBank accession no. XM_133432.2) (Tamamaki et al., 2003) in a hybridization buffer. After washes and ribonuclease A (RNase A) treatment, the sections were incubated overnight with a mixture of 1:1000-diluted alkaline phosphatase (AP)-conjugated anti-DIG sheep antibody (11-093-274-910; Roche Applied Science) and 1:500-diluted rabbit anti-CCK antibody (20078; ImmunoStar). The sections were then incubated for 2 hr with 5 µg/mL AlexaFluor (AF) 488-conjugated antibody against rabbit IgG, and finally reacted overnight at 4˚C with a 2-hydroxy-3-naphtoic acid-2’-phenylanilide phosphate Fluorescence Detection kit (HNPP/FastRed; Roche Diagnostics). After counterstaining with NeuroTrace blue, the sections were mounted on 3-aminopropyltriethoxysilan-coated glass slides and coverslipped with CC/Mount (K002; Diagnostic Biosystems, Pleasanton, CA). We detected no higher signals with the sense probe than the background labeling. The

fluorescence-labeled

sections

were

observed

under

an

Axiophot

epifluorescence microscope (Zeiss, Oberkochen, Germany) with appropriate filter sets for AF488 (excitation, 450–490 nm; emission, 515–565 nm), and FastRed (excitation, 530–585

22

nm; emission, ≥ 615 nm). Pseudocolor images were taken by QICAM FAST digital monochrome camera (QImaging), modified (± 20% contrast and brightness enhancement) in software Canvas X (ACD Systems, Saanichton, Canada), and saved as TIFF files. Cortical lamination was determined in reference to counterstaining with NeuroTrace blue.

4.5 Double immunofluorescence staining for GABAergic neurons The brain sections obtained from the wild type mice were incubated overnight with 1:500-diluted rabbit anti-CCK antibody and one of either 1:4000-diluted guinea pig anti-GABA (AB175; Millipore), 1 µg/mL guinea pig anti-vesicular GABA transporter (VGAT; 131004; Synaptic Systems, Göttingen, Germany), 1:4000-diluted mouse anti-PV antibody (P-3088; Sigma-Aldrich), 1:100-diluted rat anti-SOM antibody (MAB354; Millipore), or 1 µg/mL guinea pig anti-VIP antibody in PBS-XCG. The sections were subsequently incubated for 2 hr with a mixture of 5 µg/mL AF488-conjugated goat antibody against mouse IgG (A-11029; Life Technologies), guinea pig IgG, or rat IgG (A-11006; Life Technologies) and 5 µg/mL AF594-conjugated goat antibody against rabbit IgG (A-11037; Life Technologies) in PBS-XCG. After counterstaining with NeuroTrace blue, the sections were mounted on gelatinized glass slides and coverslipped with 50% (v/v) glycerol and 2.5% (w/v) triethylenediamine (antifading reagent) in PBS. The fluorescence-labeled sections were observed under an Axiophot epifluorescence microscope as described above.

4.6 Triple or quadruple immunofluorescence labeling The brain sections obtained from the transgenic mice were incubated overnight with the following mixtures of antibodies: 1) 1.0 µg/ml guinea pig anti-GFP antibody (Nakamura et al., 2008), 1.0 µg/ml mouse anti-gephyrin antibody (147003; Synaptic Systems), and 1:500-diluted rabbit anti-CCK antibody; or 2) 20 µg/ml chicken anti-GFP antibody

23

(GFP-1020; Aves Labs, Tigard, OR), 1.0 µg/ml mouse anti-gephyrin antibody, 1:500-diluted rabbit anti-CCK antibody, and 1.0 µg/ml guinea pig anti-VIP antibody in PBS-XCG. The sections were then incubated overnight with following combinations of secondary antibodies: 1) 5 µg/ml AF488-conjugated antibody against guinea pig IgG (A-11073; Life Technologies), 5 µg/ml AF568-conjugated antibody against mouse IgG (A-11031; Life Technologies), and 5 µg/ml AF647-conjugated antibody against rabbit IgG (A-21245; Life Technologies); or 2) 10 µg/ml CF™405S-conjugated antibody against guinea pig IgG (20356; Biotium Inc., Hayward, CA), 5 µg/ml AF488-conjugated antibody against chicken IgG (A-11039; Life Technologies), 5 µg/ml AF568-conjugated antibody against mouse IgG, and 5 µg/ml AF647-conjugated antibody against rabbit IgG. After confocal laser scanning microscopic observation, the sections were counterstained with NeuroTrace blue to determine cortical lamination.

4.7 Confocal laser scanning microscopy Triple- or quadruple-stained sections were observed under a Leica TCS SP8 confocal laser scanning microscope (Leica Microsystems, Wetzlar, Germany) with a 63× oil-immersion objective lens (HCX PL APO, NA = 1.40; Leica) and HyD detector (integrative mode) at the pinhole of a 1.0 Airy disk unit. Image size was 512 × 512 pixels, and the zoom factor was set to 1, 16, or 32, which corresponded to a pixel dimension of 465, 29.06, or 14.53 nm in both the X and Y directions. CF™405S, AF488, AF568, and AF647 were excited with 405-, 488-, 543-, and 633-nm laser beams and observed through 410–499-, 500–580-, 590–650-, and 660–850-nm emission prism windows, respectively. Up to 150 images with a Z-interval of 122 nm were acquired per stack and deconvolved using Huygens Essential software (version 3.7; Scientific Volume Imaging, Hilversum, The Netherlands) with the following parameters: microscopic type, confocal; back projected pinhole diameter, 238 nm; lens objective NA, 1.4; lens immersion refractive index, 1.515; medium refractive index,

24

1.515; excitation wavelength, 488, 543 or 633 nm; emission wavelength, 519, 603 or 668 nm; vertical mapping function, log; algorithm, classical maximum likelihood estimation; background estimation mode, lowest; relative background, 0%; maximum iteration number, 40; signal-to-noise ratio, 3–10; quality threshold, 0.1; iteration mode, fast; photobleaching correction, auto; and brick layout, auto. All confocal images were modified (≤ 40% contrast enhancement) in Canvas X software and saved as 8-bit/color TIFF files.

4.8 Synaptic input density calculation The somatic and dendritic surface area of interest was estimated in three-dimensional space, as previously reported (Kameda et al., 2012; Hioki et al., 2013; Sohn et al., 2016). Briefly, we randomly selected three sites per soma, and the somatic membrane of three analyzed sites was almost perpendicular to XY plane. For each optical section, we measured the somatic length (the outline of the cell body) with LSM 5 Image Examiner software (Carl Zeiss), multiplied it by the optical thickness (122 nm), and calculated the surface area of three sites [Sc] as follows: Sc = Σ3 sites {somatic length [L] × [thickness of the optical section in Z-axis (122nm)]. The surface area of a dendritic segment [Sd] could be calculated by the following formula: Sd = π × cross-section area [A] (See Supplementary Figure 1 in Sohn et al., 2016). The sectional area [A] was measured with LSM 5 Image Examiner software. The number of putative synaptic inputs was divided by the surface area of the somatic [Sc] or dendritic [Sd] membrane for the density estimation of synaptic inputs [/µm2].

4.9 Total number estimation of CCK inputs to a single PV+ neuron The

somatodendritic

structures

of

PV+

neurons

were

reconstructed

three-dimensionally in the previous study (Kameda et al., 2012). To estimate the total 25

numbers of CCK inputs to PV+ neurons from the input density, we utilized morphological parameters such as sectional area of the cell body, the total dendritic surface area of y µm from the cell body, and the distribution probability (%) of PV+ neurons in each layer, from the previous data (Kameda et al., 2012). The data obtained from all 24 dendrites and cell bodies were pooled. The number of inputs to the cell bodies in each layer was estimated by the following formula, presuming the cell body to be spherical: [the input density per surface area (CB in Table 2)] × 4 × [sectional area of the cell body (Kameda et al., 2012)]. The number of inputs to the dendrites in each layer was calculated by the formula: D20 × A0–50, D80 × A50–110 and D140 × A≥110, where Dx = [the input density per surface area around x µm from the cell body (dendrite in Table 2)] and Ay = [the total dendritic surface area of y µm from the cell body (Kameda et al., 2012)]. Finally, the average number of GABAergic inputs per PV neuron in all layers was estimated by the following formula: ∑layer{[the mean number of inputs per PV neurons in each layer] × [the distribution probability (%) of PV+ neurons in each layer (Kameda et al., 2012)]}.

4.10 Statistical analysis Multiple comparisons were performed with Tukey’s multiple comparison test after one-way analysis of variance (ANOVA) (Prism4.0c; GraphPad Software Inc., San Diego, CA).

26

Acknowledgements The authors are deeply grateful to Prof. Takeshi Kaneko for his helpful discussions and insights. This work was supported by Grants-in-Aid for Scientific Research from The Ministry of Education, Culture, Sports, Science, and Technology (MEXT) and Japan Society for the Promotion of Science (JSPS) for JSPS Fellows (17J04137 to J.S.); for Early-Carrer Scientists (18K14844 to J.S.); for Scientific Research (16H04663 to H.H.); for Exploratory Research (17K19451 to H.H.); and for Scientific Research on Innovative Areas, “Adaptive Circuit Shift” (15H01430 to H.H.), and “Resonance Biology” (18H04743 to H.H.), and by the program for Brain Mapping by Integrated Neurotechnologies for Disease Studies (Brain/MINDS) from Japan Agency for Medical Research and Development (AMED) (JP18dm0207064 to H.H.). In addition, this work was partially supported by a grant from the Fujiwara Memorial Foundation to H.H.

Author Contributions H.H. designed the study; H.H., J.S., H.N., S.O., J.H., Y.I., and M.T. executed experiments; H.H., J.S., H.N., M.T., and H.K. analyzed the data; H.H., J.S., and H.K. wrote the manuscript. All authors discussed the results and concurred on the contents of this manuscript.

Conflict of Interest The authors declare no potential conflicts of interest.

27

References Acsady, L., Katona, I., Martinez-Guijarro, F.J., Buzsaki, G., Freund, T.F., 2000. Unusual target selectivity of perisomatic inhibitory cells in the hilar region of the rat hippocampus. J Neurosci. 20, 6907-6919. Alitto, H.J., Dan, Y., 2012. Cell-type-specific modulation of neocortical activity by basal forebrain input. Front Syst Neurosci. 6, 79. Andrasfalvy, B.K., Mody, I., 2006. Differences between the scaling of miniature IPSCs and EPSCs recorded in the dendrites of CA1 mouse pyramidal neurons. J Physiol. 576, 191-196. Ascoli, G.A., Alonso-Nanclares, L., Anderson, S.A., Barrionuevo, G., Benavides-Piccione, R., Burkhalter, A., Buzsaki, G., Cauli, B., Defelipe, J., Fairen, A., Feldmeyer, D., Fishell, G., Fregnac, Y., Freund, T.F., Gardner, D., Gardner, E.P., Goldberg, J.H., Helmstaedter, M., Hestrin, S., Karube, F., Kisvarday, Z.F., Lambolez, B., Lewis, D.A., Marin, O., Markram, H., Munoz, A., Packer, A., Petersen, C.C., Rockland, K.S., Rossier, J., Rudy, B., Somogyi, P., Staiger, J.F., Tamas, G., Thomson, A.M., Toledo-Rodriguez, M., Wang, Y., West, D.C., Yuste, R., 2008. Petilla terminology: nomenclature of features of GABAergic interneurons of the cerebral cortex. Nat Rev Neurosci. 9, 557-568. Bartos, M., Vida, I., Jonas, P., 2007. Synaptic mechanisms of synchronized gamma oscillations in inhibitory interneuron networks. Nat Rev Neurosci. 8, 45-56. Bayraktar, T., Staiger, J.F., Acsady, L., Cozzari, C., Freund, T.F., Zilles, K., 1997. Co-localization of vasoactive intestinal polypeptide, gamma-aminobutyric acid and choline acetyltransferase in neocortical interneurons of the adult rat. Brain Res. 757, 209-217. Bayraktar, T., Welker, E., Freund, T.F., Zilles, K., Staiger, J.F., 2000. Neurons immunoreactive for vasoactive intestinal polypeptide in the rat primary somatosensory cortex: morphology and spatial relationship to barrel-related columns. J Comp Neurol. 420, 291-304. Beaulieu, C., 1993. Numerical data on neocortical neurons in adult rat, with special reference to the GABA population. Brain Res. 609, 284-292. Bissonette, G.B., Schoenbaum, G., Roesch, M.R., Powell, E.M., 2015. Interneurons are necessary for coordinated activity during reversal learning in orbitofrontal cortex. Biol Psychiatry. 77, 454-464. Blatow, M., Rozov, A., Katona, I., Hormuzdi, S.G., Meyer, A.H., Whittington, M.A., Caputi, A., Monyer, H., 2003. A novel network of multipolar bursting interneurons generates theta frequency oscillations in neocortex. Neuron. 38, 805-817. 28

Bodor, A.L., Katona, I., Nyiri, G., Mackie, K., Ledent, C., Hajos, N., Freund, T.F., 2005. Endocannabinoid signaling in rat somatosensory cortex: laminar differences and involvement of specific interneuron types. J Neurosci. 25, 6845-6856. Burgunder, J.M., Young, W.S., 3rd, 1990. Cortical neurons expressing the cholecystokinin gene in the rat: distribution in the adult brain, ontogeny, and some of their projections. J Comp Neurol. 300, 26-46. Burkhalter, A., 2008. Many specialists for suppressing cortical excitation. Front Neurosci. 2, 155-167. Buzsaki, G., 1996. The hippocampo-neocortical dialogue. Cereb Cortex. 6, 81-92. Cardin, J.A., Carlen, M., Meletis, K., Knoblich, U., Zhang, F., Deisseroth, K., Tsai, L.H., Moore, C.I., 2009. Driving fast-spiking cells induces gamma rhythm and controls sensory responses. Nature. 459, 663-667. Cauli, B., Audinat, E., Lambolez, B., Angulo, M.C., Ropert, N., Tsuzuki, K., Hestrin, S., Rossier, J., 1997. Molecular and physiological diversity of cortical nonpyramidal cells. J Neurosci. 17, 3894-3906. Cauli, B., Porter, J.T., Tsuzuki, K., Lambolez, B., Rossier, J., Quenet, B., Audinat, E., 2000. Classification of fusiform neocortical interneurons based on unsupervised clustering. Proc Natl Acad Sci U S A. 97, 6144-6149. Cauli, B., Zhou, X., Tricoire, L., Toussay, X., Staiger, J.F., 2014. Revisiting enigmatic cortical calretinin-expressing interneurons. Front Neuroanat. 8, 52. Chaudhry, F.A., Reimer, R.J., Bellocchio, E.E., Danbolt, N.C., Osen, K.K., Edwards, R.H., Storm-Mathisen, J., 1998. The vesicular GABA transporter, VGAT, localizes to synaptic vesicles in sets of glycinergic as well as GABAergic neurons. J Neurosci. 18, 9733-9750. Connor, J.R., Peters, A., 1984. Vasoactive intestinal polypeptide-immunoreactive neurons in rat visual cortex. Neuroscience. 12, 1027-1044. DeFelipe, J., Farinas, I., 1992. The pyramidal neuron of the cerebral cortex: morphological and chemical characteristics of the synaptic inputs. Prog Neurobiol. 39, 563-607. DeFelipe, J., 1993. Neocortical neuronal diversity: chemical heterogeneity revealed by colocalization studies of classic neurotransmitters, neuropeptides, calcium-binding proteins, and cell surface molecules. Cereb Cortex. 3, 273-289. DeFelipe, J., Lopez-Cruz, P.L., Benavides-Piccione, R., Bielza, C., Larranaga, P., Anderson, S., Burkhalter, A., Cauli, B., Fairen, A., Feldmeyer, D., Fishell, G., Fitzpatrick, D., Freund, T.F., Gonzalez-Burgos, G., Hestrin, S., Hill, S., 29

Hof, P.R., Huang, J., Jones, E.G., Kawaguchi, Y., Kisvarday, Z., Kubota, Y., Lewis, D.A., Marin, O., Markram, H., McBain, C.J., Meyer, H.S., Monyer, H., Nelson, S.B., Rockland, K., Rossier, J., Rubenstein, J.L., Rudy, B., Scanziani, M., Shepherd, G.M., Sherwood, C.C., Staiger, J.F., Tamas, G., Thomson, A., Wang, Y., Yuste, R., Ascoli, G.A., 2013. New insights into the classification and nomenclature of cortical GABAergic interneurons. Nat Rev Neurosci. 14, 202-216. Demeulemeester, H., Vandesande, F., Orban, G.A., Brandon, C., Vanderhaeghen, J.J., 1988. Heterogeneity of GABAergic cells in cat visual cortex. J Neurosci. 8, 988-1000. Demeulemeester, H., Arckens, L., Vandesande, F., Orban, G.A., Heizmann, C.W., Pochet, R., 1991. Calcium binding proteins and neuropeptides as molecular markers of GABAergic interneurons in the cat visual cortex. Exp Brain Res. 84, 538-544. Foldy, C., Lee, S.Y., Szabadics, J., Neu, A., Soltesz, I., 2007. Cell type-specific gating of perisomatic inhibition by cholecystokinin. Nat Neurosci. 10, 1128-1130. Freund, T.F., Magloczky, Z., Soltesz, I., Somogyi, P., 1986. Synaptic connections, axonal and dendritic patterns of neurons immunoreactive for cholecystokinin in the visual cortex of the cat. Neuroscience. 19, 1133-1159. Freund, T.F., 2003. Interneuron Diversity series: Rhythm and mood in perisomatic inhibition. Trends Neurosci. 26, 489-495. Freund, T.F., Katona, I., 2007. Perisomatic inhibition. Neuron. 56, 33-42. Fritschy, J.M., Harvey, R.J., Schwarz, G., 2008. Gephyrin: where do we stand, where do we go? Trends Neurosci. 31, 257-264. Fu, Y., Tucciarone, J.M., Espinosa, J.S., Sheng, N., Darcy, D.P., Nicoll, R.A., Huang, Z.J., Stryker, M.P., 2014. A cortical circuit for gain control by behavioral state. Cell. 156, 1139-1152. Fu, Y., Kaneko, M., Tang, Y., Alvarez-Buylla, A., Stryker, M.P., 2015. A cortical disinhibitory circuit for enhancing adult plasticity. Elife. 4, e05558. Fuzik, J., Zeisel, A., Mate, Z., Calvigioni, D., Yanagawa, Y., Szabo, G., Linnarsson, S., Harkany, T., 2015. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat Biotechnol. Gonchar, Y., Burkhalter, A., 1997. Three distinct families of GABAergic neurons in rat visual cortex. Cereb Cortex. 7, 347-358. Gonchar, Y., Wang, Q., Burkhalter, A., 2007. Multiple distinct subtypes of GABAergic neurons in mouse visual cortex identified by triple immunostaining. Front Neuroanat. 1, 3. 30

Gonzalez-Burgos, G., Cho, R.Y., Lewis, D.A., 2015. Alterations in cortical network oscillations and parvalbumin neurons in schizophrenia. Biol Psychiatry. 77, 1031-1040. Gupta, A., Wang, Y., Markram, H., 2000. Organizing principles for a diversity of GABAergic interneurons and synapses in the neocortex. Science. 287, 273-278. Hendry, S.H., Jones, E.G., Beinfeld, M.C., 1983. Cholecystokinin-immunoreactive neurons in rat and monkey cerebral cortex make symmetric synapses and have intimate associations with blood vessels. Proc Natl Acad Sci U S A. 80, 2400-2404. Hestrin, S., Galarreta, M., 2005. Electrical synapses define networks of neocortical GABAergic neurons. Trends Neurosci. 28, 304-309. Hioki, H., Fujiyama, F., Nakamura, K., Wu, S.X., Matsuda, W., Kaneko, T., 2004. Chemically specific circuit composed of vesicular glutamate transporter 3and preprotachykinin B-producing interneurons in the rat neocortex. Cereb Cortex. 14, 1266-1275. Hioki, H., Nakamura, H., Ma, Y.F., Konno, M., Hayakawa, T., Nakamura, K.C., Fujiyama, F., Kaneko, T., 2010. Vesicular glutamate transporter 3-expressing nonserotonergic projection neurons constitute a subregion in the rat midbrain raphe nuclei. J Comp Neurol. 518, 668-686. Hioki, H., Okamoto, S., Konno, M., Kameda, H., Sohn, J., Kuramoto, E., Fujiyama, F., Kaneko, T., 2013. Cell type-specific inhibitory inputs to dendritic and somatic compartments of parvalbumin-expressing neocortical interneuron. J Neurosci. 33, 544-555. Hioki, H., 2015. Compartmental organization of synaptic inputs to parvalbumin-expressing GABAergic neurons in mouse primary somatosensory cortex. Anat Sci Int. 90, 7-21. Hokfelt, T., Cortes, R., Schalling, M., Ceccatelli, S., Pelto-Huikko, M., Persson, H., Villar, M.J., 1991. Distribution patterns of CCK and CCK mRNA in some neuronal and non-neuronal tissues. Neuropeptides. 19 Suppl, 31-43. Hokfelt, T., Blacker, D., Broberger, C., Herrera-Marschitz, M., Snyder, G., Fisone, G., Cortes, R., Morino, P., You, Z.B., Ogren, S.O., 2002. Some aspects on the anatomy and function of central cholecystokinin systems. Pharmacol Toxicol. 91, 382-386. Hu, H., Gan, J., Jonas, P., 2014. Interneurons. Fast-spiking, parvalbumin(+) GABAergic interneurons: from cellular design to microcircuit function. Science. 345, 1255263. Ingram, S.M., Krause, R.G., 2nd, Baldino, F., Jr., Skeen, L.C., Lewis, M.E., 1989. 31

Neuronal localization of cholecystokinin mRNA in the rat brain by using in situ hybridization histochemistry. J Comp Neurol. 287, 260-272. Jiang, X., Wang, G., Lee, A.J., Stornetta, R.L., Zhu, J.J., 2013. The organization of two new cortical interneuronal circuits. Nat Neurosci. 16, 210-218. Jiang, X., Shen, S., Cadwell, C.R., Berens, P., Sinz, F., Ecker, A.S., Patel, S., Tolias, A.S., 2015. Principles of connectivity among morphologically defined cell types in adult neocortex. Science. 350, aac9462. Kameda, H., Hioki, H., Tanaka, Y.H., Tanaka, T., Sohn, J., Sonomura, T., Furuta, T., Fujiyama, F., Kaneko, T., 2012. Parvalbumin-producing cortical interneurons receive inhibitory inputs on proximal portions and cortical excitatory inputs on distal dendrites. Eur J Neurosci. 35, 838-854. Kaneko, T., Mizuno, N., 1988. Immunohistochemical study of glutaminase-containing neurons in the cerebral cortex and thalamus of the rat. J Comp Neurol. 267, 590-602. Karson, M.A., Whittington, K.C., Alger, B.E., 2008. Cholecystokinin inhibits endocannabinoid-sensitive hippocampal IPSPs and stimulates others. Neuropharmacology. 54, 117-128. Karson, M.A., Tang, A.H., Milner, T.A., Alger, B.E., 2009. Synaptic cross talk between perisomatic-targeting interneuron classes expressing cholecystokinin and parvalbumin in hippocampus. J Neurosci. 29, 4140-4154. Kawaguchi, Y., Kubota, Y., 1993. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. J Neurophysiol. 70, 387-396. Kawaguchi, Y., 1995. Physiological subgroups of nonpyramidal cells with specific morphological characteristics in layer II/III of rat frontal cortex. J Neurosci. 15, 2638-2655. Kawaguchi, Y., Kubota, Y., 1996. Physiological and morphological identification of somatostatin- or vasoactive intestinal polypeptide-containing cells among GABAergic cell subtypes in rat frontal cortex. J Neurosci. 16, 2701-2715. Kawaguchi, Y., 1997. Selective cholinergic modulation of cortical GABAergic cell subtypes. J Neurophysiol. 78, 1743-1747. Kawaguchi, Y., Kubota, Y., 1997. GABAergic cell subtypes and their synaptic connections in rat frontal cortex. Cereb Cortex. 7, 476-486. Kawaguchi, Y., Kubota, Y., 1998. Neurochemical features and synaptic connections of large physiologically-identified GABAergic cells in the rat frontal cortex. Neuroscience. 85, 677-701. Kawaguchi, Y., 2001. Distinct firing patterns of neuronal subtypes in cortical 32

synchronized activities. J Neurosci. 21, 7261-7272. Kawaguchi, Y., Kondo, S., 2002. Parvalbumin, somatostatin and cholecystokinin as chemical markers for specific GABAergic interneuron types in the rat frontal cortex. J Neurocytol. 31, 277-287. Kepecs, A., Fishell, G., 2014. Interneuron cell types are fit to function. Nature. 505, 318-326. Kosaka, T., Heizmann, C.W., Tateishi, K., Hamaoka, Y., Hama, K., 1987. An aspect of the organizational principle of the gamma-aminobutyric acidergic system in the cerebral cortex. Brain Res. 409, 403-408. Kubota, Y., Hattori, R., Yui, Y., 1994. Three distinct subpopulations of GABAergic neurons in rat frontal agranular cortex. Brain Res. 649, 159-173. Kubota, Y., Kawaguchi, Y., 1997. Two distinct subgroups of cholecystokinin-immunoreactive cortical interneurons. Brain Res. 752, 175-183. Kubota, Y., Shigematsu, N., Karube, F., Sekigawa, A., Kato, S., Yamaguchi, N., Hirai, Y., Morishima, M., Kawaguchi, Y., 2011. Selective coexpression of multiple chemical markers defines discrete populations of neocortical GABAergic neurons. Cereb Cortex. 21, 1803-1817. Kubota, Y., 2014. Untangling GABAergic wiring in the cortical microcircuit. Curr Opin Neurobiol. 26, 7-14. Lee, S., Kruglikov, I., Huang, Z.J., Fishell, G., Rudy, B., 2013. A disinhibitory circuit mediates motor integration in the somatosensory cortex. Nat Neurosci. 16, 1662-1670. Letzkus, J.J., Wolff, S.B., Meyer, E.M., Tovote, P., Courtin, J., Herry, C., Luthi, A., 2011. A disinhibitory microcircuit for associative fear learning in the auditory cortex. Nature. 480, 331-335. Letzkus, J.J., Wolff, S.B., Luthi, A., 2015. Disinhibition, a Circuit Mechanism for Associative Learning and Memory. Neuron. 88, 264-276. Lewis, D.A., Hashimoto, T., Volk, D.W., 2005. Cortical inhibitory neurons and schizophrenia. Nat Rev Neurosci. 6, 312-324. Lewis, D.A., Curley, A.A., Glausier, J.R., Volk, D.W., 2012. Cortical parvalbumin interneurons and cognitive dysfunction in schizophrenia. Trends Neurosci. 35, 57-67. Li, Z., Ge, S., Zhang, F., Zhang, T., Mizuno, N., Hioki, H., Kaneko, T., Gao, G., Li, J., 2012. Distribution of gephyrin-immunoreactivity in the trigeminal motor nucleus: an immunohistochemical study in rats. Anat Rec (Hoboken). 295, 641-651. Lopez-Bendito, G., Sturgess, K., Erdelyi, F., Szabo, G., Molnar, Z., Paulsen, O., 33

2004. Preferential origin and layer destination of GAD65-GFP cortical interneurons. Cereb Cortex. 14, 1122-1133. Loren, I., Emson, P.C., Fahrenkrug, J., Bjorklund, A., Alumets, J., Hakanson, R., Sundler, F., 1979. Distribution of vasoactive intestinal polypeptide in the rat and mouse brain. Neuroscience. 4, 1953-1976. Ma, Y., Hu, H., Berrebi, A.S., Mathers, P.H., Agmon, A., 2006. Distinct subtypes of somatostatin-containing neocortical interneurons revealed in transgenic mice. J Neurosci. 26, 5069-5082. Ma, Y., Hioki, H., Konno, M., Pan, S., Nakamura, H., Nakamura, K.C., Furuta, T., Li, J.L., Kaneko, T., 2011. Expression of gap junction protein connexin36 in multiple subtypes of GABAergic neurons in adult rat somatosensory cortex. Cereb Cortex. 21, 2639-2649. Markram, H., Toledo-Rodriguez, M., Wang, Y., Gupta, A., Silberberg, G., Wu, C., 2004. Interneurons of the neocortical inhibitory system. Nat Rev Neurosci. 5, 793-807. McGarry, L.M., Packer, A.M., Fino, E., Nikolenko, V., Sippy, T., Yuste, R., 2010. Quantitative classification of somatostatin-positive neocortical interneurons identifies three interneuron subtypes. Front Neural Circuits. 4, 12. Mesik, L., Ma, W.P., Li, L.Y., Ibrahim, L.A., Huang, Z.J., Zhang, L.I., Tao, H.W., 2015. Functional response properties of VIP-expressing inhibitory neurons in mouse visual and auditory cortex. Front Neural Circuits. 9, 22. Metherate, R., Cox, C.L., Ashe, J.H., 1992. Cellular bases of neocortical activation: modulation of neural oscillations by the nucleus basalis and endogenous acetylcholine. J Neurosci. 12, 4701-4711. Miles, R., Toth, K., Gulyas, A.I., Hajos, N., Freund, T.F., 1996. Differences between somatic and dendritic inhibition in the hippocampus. Neuron. 16, 815-823. Nakamura, K.C., Kameda, H., Koshimizu, Y., Yanagawa, Y., Kaneko, T., 2008. Production and histological application of affinity-purified antibodies to heat-denatured green fluorescent protein. J Histochem Cytochem. 56, 647-657. Orekhova, E.V., Stroganova, T.A., Nygren, G., Tsetlin, M.M., Posikera, I.N., Gillberg, C., Elam, M., 2007. Excess of high frequency electroencephalogram oscillations in boys with autism. Biol Psychiatry. 62, 1022-1029. Peters, A., Miller, M., Kimerer, L.M., 1983. Cholecystokinin-like immunoreactive neurons in rat cerebral cortex. Neuroscience. 8, 431-448. Peters, A., Jones, E.G., 1984. Classification of cortical neurons. In Cerebral cortex, 34

volume 1, cellular components of the cerebral cortex., Vol., A. Peters, E.G. Jones, ed.^eds. Plenum Press., New York, pp. 107-121. Pfeffer, C.K., Xue, M., He, M., Huang, Z.J., Scanziani, M., 2013. Inhibition of inhibition in visual cortex: the logic of connections between molecularly distinct interneurons. Nat Neurosci. 16, 1068-1076. Pi, H.J., Hangya, B., Kvitsiani, D., Sanders, J.I., Huang, Z.J., Kepecs, A., 2013. Cortical interneurons that specialize in disinhibitory control. Nature. 503, 521-524. Porter, J.T., Cauli, B., Tsuzuki, K., Lambolez, B., Rossier, J., Audinat, E., 1999. Selective excitation of subtypes of neocortical interneurons by nicotinic receptors. J Neurosci. 19, 5228-5235. Pronneke, A., Scheuer, B., Wagener, R.J., Mock, M., Witte, M., Staiger, J.F., 2015. Characterizing VIP Neurons in the Barrel Cortex of VIPcre/tdTomato Mice Reveals Layer-Specific Differences. Cereb Cortex. 25, 4854-4868. Roberts, G.W., Woodhams, P.L., Bryant, M.G., Crow, T.J., Bloom, S.R., Polak, J.M., 1980. VIP in the rat brain: evidence for a major pathway linking the amygdala and hypothalamus via the stria terminalis. Histochemistry. 65, 103-119. Rudy, B., Fishell, G., Lee, S., Hjerling-Leffler, J., 2011. Three groups of interneurons account for nearly 100% of neocortical GABAergic neurons. Dev Neurobiol. 71, 45-61. Schiffmann, S.N., Vanderhaeghen, J.J., 1991. Distribution of cells containing mRNA encoding cholecystokinin in the rat central nervous system. J Comp Neurol. 304, 219-233. Sims, K.B., Hoffman, D.L., Said, S.I., Zimmerman, E.A., 1980. Vasoactive intestinal polypeptide (VIP) in mouse and rat brain: an immunocytochemical study. Brain Res. 186, 165-183. Sohal, V.S., Zhang, F., Yizhar, O., Deisseroth, K., 2009. Parvalbumin neurons and gamma rhythms enhance cortical circuit performance. Nature. 459, 698-702. Sohal, V.S., 2012. Insights into cortical oscillations arising from optogenetic studies. Biol Psychiatry. 71, 1039-1045. Sohn, J., Hioki, H., Okamoto, S., Kaneko, T., 2014. Preprodynorphin-expressing neurons constitute a large subgroup of somatostatin-expressing GABAergic interneurons in the mouse neocortex. J Comp Neurol. 522, 1506-1526. Sohn, J., Okamoto, S., Kataoka, N., Kaneko, T., Nakamura, K., Hioki, H., 2016. Differential Inputs to the Perisomatic and Distal-Dendritic Compartments of VIP-Positive Neurons in Layer 2/3 of the Mouse Barrel Cortex. Front 35

Neuroanat. 10, 124. Sohn, J., Takahashi, M., Okamoto, S., Ishida, Y., Furuta, T., Hioki, H., 2017. A Single Vector Platform for High-Level Gene Transduction of Central Neurons: Adeno-Associated Virus Vector Equipped with the Tet-Off System. PLoS One. 12, e0169611. Somogyi, P., Tamas, G., Lujan, R., Buhl, E.H., 1998. Salient features of synaptic organisation in the cerebral cortex. Brain Res Brain Res Rev. 26, 113-135. Somogyi, P., Klausberger, T., 2005. Defined types of cortical interneurone structure space and spike timing in the hippocampus. J Physiol. 562, 9-26. Spruston, N., 2008. Pyramidal neurons: dendritic structure and synaptic integration. Nat Rev Neurosci. 9, 206-221. Taki, K., Kaneko, T., Mizuno, N., 2000. A group of cortical interneurons expressing mu-opioid receptor-like immunoreactivity: a double immunofluorescence study in the rat cerebral cortex. Neuroscience. 98, 221-231. Tamamaki, N., Yanagawa, Y., Tomioka, R., Miyazaki, J., Obata, K., Kaneko, T., 2003. Green fluorescent protein expression and colocalization with calretinin, parvalbumin, and somatostatin in the GAD67-GFP knock-in mouse. J Comp Neurol. 467, 60-79. Tamas, G., Buhl, E.H., Somogyi, P., 1997. Fast IPSPs elicited via multiple synaptic release sites by different types of GABAergic neurone in the cat visual cortex. J Physiol. 500 ( Pt 3), 715-738. Tanaka, Y.H., Tanaka, Y.R., Fujiyama, F., Furuta, T., Yanagawa, Y., Kaneko, T., 2011. Local connections of layer 5 GABAergic interneurons to corticospinal neurons. Front Neural Circuits. 5, 12. Taniguchi, H., 2014. Genetic dissection of GABAergic neural circuits in mouse neocortex. Front Cell Neurosci. 8, 8. Thomson, A.M., West, D.C., Hahn, J., Deuchars, J., 1996. Single axon IPSPs elicited in pyramidal cells by three classes of interneurones in slices of rat neocortex. J Physiol. 496 ( Pt 1), 81-102. Thomson, A.M., Lamy, C., 2007. Functional maps of neocortical local circuitry. Front Neurosci. 1, 19-42. Uematsu, M., Hirai, Y., Karube, F., Ebihara, S., Kato, M., Abe, K., Obata, K., Yoshida, S., Hirabayashi, M., Yanagawa, Y., Kawaguchi, Y., 2008. Quantitative chemical composition of cortical GABAergic neurons revealed in transgenic venus-expressing rats. Cereb Cortex. 18, 315-330. van den Pol, A.N., 2012. Neuropeptide transmission in brain circuits. Neuron. 76, 98-115. Voigt, M.M., Uhl, G.R., 1988. Preprocholecystokinin mRNA in rat brain: regional 36

expression includes thalamus. Brain Res. 464, 247-253. Wang, Y., Gupta, A., Toledo-Rodriguez, M., Wu, C.Z., Markram, H., 2002. Anatomical, physiological, molecular and circuit properties of nest basket cells in the developing somatosensory cortex. Cereb Cortex. 12, 395-410. Wang, Y., Toledo-Rodriguez, M., Gupta, A., Wu, C., Silberberg, G., Luo, J., Markram, H., 2004. Anatomical, physiological and molecular properties of Martinotti cells in the somatosensory cortex of the juvenile rat. J Physiol. 561, 65-90. Watakabe, A., Hirokawa, J., Ichinohe, N., Ohsawa, S., Kaneko, T., Rockland, K.S., Yamamori, T., 2012. Area-specific substratification of deep layer neurons in the rat cortex. J Comp Neurol. 520, 3553-3573. Whissell, P.D., Cajanding, J.D., Fogel, N., Kim, J.C., 2015. Comparative density of CCK- and PV-GABA cells within the cortex and hippocampus. Front Neuroanat. 9, 124. Whittington, M.A., Traub, R.D., Jefferys, J.G., 1995. Synchronized oscillations in interneuron networks driven by metabotropic glutamate receptor activation. Nature. 373, 612-615. Williams, S.R., Stuart, G.J., 2003. Voltage- and site-dependent control of the somatic impact of dendritic IPSPs. J Neurosci. 23, 7358-7367. Woodruff, A., Xu, Q., Anderson, S.A., Yuste, R., 2009. Depolarizing effect of neocortical chandelier neurons. Front Neural Circuits. 3, 15. Xu, X., Roby, K.D., Callaway, E.M., 2006. Mouse cortical inhibitory neuron type that coexpresses somatostatin and calretinin. J Comp Neurol. 499, 144-160. Xu, X., Roby, K.D., Callaway, E.M., 2010. Immunochemical characterization of inhibitory mouse cortical neurons: three chemically distinct classes of inhibitory cells. J Comp Neurol. 518, 389-404. Zaitsev, A.V., Gonzalez-Burgos, G., Povysheva, N.V., Kroner, S., Lewis, D.A., Krimer, L.S., 2005. Localization of calcium-binding proteins in physiologically and morphologically characterized interneurons of monkey dorsolateral prefrontal cortex. Cereb Cortex. 15, 1178-1186. Zaitsev, A.V., Povysheva, N.V., Gonzalez-Burgos, G., Rotaru, D., Fish, K.N., Krimer, L.S., Lewis, D.A., 2009. Interneuron diversity in layers 2-3 of monkey prefrontal cortex. Cereb Cortex. 19, 1597-1615. Zhang, S., Xu, M., Kamigaki, T., Hoang Do, J.P., Chang, W.C., Jenvay, S., Miyamichi, K., Luo, L., Dan, Y., 2014. Selective attention. Long-range and local circuits for top-down modulation of visual cortex processing. Science. 345, 660-665.

37

Table 1. Laminar distributions of CCK+ neurons in the S1. GAD67 mRNA

a

VIP

CCK/GAD67

GAD67/CCK

CCK/VIP

VIP/CCK

L1

1.4 ± 1.4a (3/204)b

100 ± 0 (3/3)

16.7 ± 23.6 (2/11)

33.3 ± 47.1 (2/7)

L2/3

5.6 ± 2.9† (77/1375)

97.9 ± 3.6 (77/79)

13.6 ± 3.0 (119/921)

42.7 ± 4.0§ (119/278)

L4

2.9 ± 0.8 (26/923)

100 ± 0 (26/26)

7.4 ± 4.7 (10/161)

11.7 ± 3.9 (10/86)

L5

1.7 ± 0.4 (24/1445)

95.2 ± 8.2 (24/25)

7.2 ± 4.6 (7/111)

9.2 ± 5.0 (7/73)

L6

3.1 ± 0.8 (39/1272)

100 ± 0 (39/39)

6.1 ± 3.3 (8/145)

9.5 ± 4.1 (8/87)

Total

3.2 ± 0.5 (169/5219)

98.3 ± 1.6 (169/172)

11.3 ± 2.5 (148/1350)

27.7 ± 2.6 (148/530)

Data are given as mean ± S.D. of the percentages in three mice.

b

The denominator and numerator in parentheses are the total number of neurons positive for

each marker in three mice. †

p = 0.0031 versus L1 and 0.0051 versus L5 (Tukey’s multiple-comparison test after one-way

ANOVA). §

p = 0.0396 versus L4, 0.0227 versus L5 and 0.0243 versus L6 (Tukey’s multiple-comparison

test after one-way ANOVA).

38

Table 2. The density of CCK inputs to PV+ neurons [10–2/µm2]. dendrite CB

20 µm from CB

80 µm from CB

140 µm from CB

L2/3

13.62 ± 3.16

2.15 ± 0.85

1.56 ± 1.20

0.88 ± 1.25

L4

13.40 ± 3.75

2.18 ± 1.38

1.51 ± 1.27

0.83 ± 1.31

L5

13.38 ± 3.26

2.02 ± 1.51

1.54 ± 1.21

0.93 ± 1.45

L6

13.18 ± 3.20

1.97 ± 1.06

1.41 ± 1.14

0.92 ± 1.44

Total

13.39 ± 3.43

2.08 ± 1.16

1.50 ± 1.15

0.89 ± 1.30

We selected two PV+ neurons in each layer in three transgenic mice (total 6 neurons in every layer), and calculated the number of inputs, surface area [µm2] and input density [10–2/µm2]. We performed Tukey’s multiple-comparison test after one-way ANOVA and found no significant difference in the input density among layers. Data are given as mean ± S.D.

39

Table 3. The estimated number of inputs per single PV+ neuron. dendrite CB

0 – 50 µm from CB

50 – 110 µm from CB

> 110 µm from CB

L2/3

87.12

58.09

56.01

19.78

L4

98.40

40.91

23.87

6.57

L5

93.91

43.44

26.81

6.99

L6

110.42

35.06

24.82

14.79

Total

97.95

43.33

30.71

11.01

We estimated the number of total inputs per single PV+ neuron by multiplying the average value of the surface area [µm2] and that of the input density [/µm2].

40

Figure Legends Figure 1. Characterization of guinea pig anti-VIP antibody. (A) After transfection of human embryonic kidney (HEK) 293 cells with a plasmid expressing GFP-VIP or GFP, the whole-cell protein solution was extracted, electrophoresed in a 10–20% gradient polyacrylamide gel, and blotted onto a polyvinylidene difluoride membrane. The membranes were immunostained with guinea pig or rabbit anti-VIP antibody, which was produced in the present study or purchased from ImmunoStar, respectively. Arrowheads indicate the positive bands of about 30 kDa. CBB, a protein stain with Comassie brilliant blue R250. (B1–G3) Adjacent coronal sections were immunostained with guinea pig or rabbit anti-VIP antibody (AF488; green), and counterstained with propidium iodide (PI). The immunoreactivity for VIP was observed in the S1, suprachiasmatic nucleus (SCN), and central nucleus of the amygdala (CeA). Arrowheads in B2 and C2 indicate the cell bodies immunoreactive for VIP. Scale bar in C3 applies to B3; that in G1 applies to B1 –F1; that in G2 applies to B2 –F2; that in G3 applies to D3 –F3.

Figure 2. CCK immunoreactivity in GABAergic neurons in the mouse S1. (A1–A3) FastRed (green) and AF488 (magenta) show the signals for GAD67 mRNA and CCK immunoreactivity, respectively. CCK+ neurons show expression of GAD67 mRNA (arrowhead). (B1–C3) The immunoreactivities for GABA or VGAT and CCK were visualized with AF488 (green) and AF568 (magenta). CCK+ cell bodies and axon terminals were immunopositive for GABA and VGAT, respectively. (D1–F3) The immunoreactivities for CCK and PV, SOM, or VIP are labeled with AF594 (magenta) and AF488 (green), respectively. Almost all CCK+ neurons are negative for PV or SOM immunoreactivity, whereas some are positive for VIP immunoreactivity (arrowhead). (G) Pie chart summarizing relative population sizes of PV+, SOM+, VIP+, and CCK+ GABAergic neurons in L1–6 of 41

the S1 cortex. The relative population size of PV+, SOM+ or VIP+ neurons was calculated from the data reported previously in the mouse neocortex (Hioki et al., 2013; Sohn et al., 2014). Scale bar in B3 applies to A1–A3; that in C3 applies to C1 and C2; F3 applies to D1–F2.

Figure 3. CCK inputs to PV+ neurons. (A1–B4) GFP, gephyrin and CCK are labeled with AF488 (green), AF568 (red) and AF647 (blue), respectively. The somatodendritic plasma membrane of PV+ neurons was clearly visualized by somatodendritic membrane-targeted GFP (myrGFP-LDLRCT). In three-dimensional image stacks of high magnification with a confocal laser scanning microscope, close contacts between CCK+ axon terminals and gephyrin immunoreactivity are observable on the GFP+ dendrite (A1–A4) or cell body (B1–B4) in all the XY, XZ and YZ planes. Arrowheads indicate the contact sites. Scale bar in A4 applies to A1 –A3; that in B4 applies to B1 –B3.

Figure 4. Density and total number of CCK inputs to the somatic and dendritic compartment of PV+ neurons. (A) The density of CCK inputs was calculated by dividing the number of inputs by the surface area (total 6 neurons in each layer). The data obtained from all 24 dendrites and cell bodies were pooled. CCK inputs preferred the somatic compartment to the dendritic one of PV+ neurons. The density of GABAergic inputs was re-calculated from the previous report (Hioki et al., 2013). Each symbol represents mean ± S.D. Statistical significance was judged by the Tukey’s multiple comparison test after one-way ANOVA: ***, p < 0.001. (B) The number of CCK inputs per single PV+ neuron for each compartment. The cell bodies of PV+ neurons received 31.8% of GABAergic inputs from CCK+ neurons, whereas the dendrites 3.4–5.2%. The number of CCK or GABAeric inputs per single PV+ neuron were re-calculated from the previous and present data (Hioki et al., 2013).

42

Figure 5. CCK and/or VIP inputs to the cell bodies of PV+ neurons. (A–C4) Three-dimensional image stacks showing quadruple immunofluorescence staining for GFP, gephyrin, CCK and VIP. The images for GFP, gephyrin and CCK (C1–C3) are merged in A, and those for gephyrin, CCK and VIP (C2–C4) in B. The axon terminal double-positive for VIP and CCK is in close contact with the gephyrin immunoreactive area on the GFP-positive somatic membrane of PV+ neuron (arrowhead). CCK+/VIP– or CCK–/VIP+ inputs are visible in the same XY plane (double arrowhead or arrow, respectively). Scale bar in C4 applies to all images.

Figure 6. Density of CCK and/or VIP inputs to the cell bodies of PV neurons across cortical layers. (A–C) We randomly selected 84 PV+ neurons in the S1, estimated the input densities to the cell bodies of PV+ neurons, and prepared the scatter diagrams with the cortical depths on the horizontal axis; ‘0’ and ‘1’ correspond to the pia mater and the white matter (WM), respectively. Bar graphs (mean ± S.D.) were also prepared for each layer, showing no significant difference among cortical layers. (D) Pie chart summarizing GABAergic inputs to the cell bodies of PV+ neurons. Average numbers of GABAergic, PV, and SOM inputs were re-calculated from the previous data (Hioki et al., 2013).

43

Highlights  

Cholecystokinin-positive (CCK+) neurons constituted only 3.2% of GABAergic neurons.

  

More than 30% of inhibitory inputs to PV+ somata were derived from CCK+ neurons. CCK+ axosomatic inputs showed no significant difference among the cortical layers. About 60% of those inputs were positive for vasoactive intestinal polypeptide.

CCK+ neurons preferred the somatic compartment of parvalbumin (PV)+ neurons.

44

45

46

47

48

49

50

51