Preimplantation genetic diagnosis for familial dysautonomia

RBMOnline - Vol 6. No 4. 488–493 Reproductive BioMedicine Online; www.rbmonline.com/Article/831 on web 20 February 2003

Article Preimplantation genetic diagnosis for familial dysautonomia Dr Svetlana Rechitsky is a graduate of Kharkov University’s Genetics Faculty, and received her PhD in Experimental Molecular Embryology from the Second Moscow Medical Institute in 1986. She moved to the Reproductive Genetics Institute in 1989 to head the DNA laboratory, which has performed the largest preimplantation genetic diagnosis (PGD) series for single gene disorders, with PGD design for the majority of these disorders developed for the first time. She has published more than 30 papers in the field of PGD, including a key contribution to the recently published Atlas of Preimplantation Genetic Diagnosis.

Dr Svetlana Rechitsky S Rechitsky, O Verlinsky, A Kuliev1, RS Ozen, C Masciangelo, A Lifchez, Y Verlinsky Reproductive Genetics Institute, Chicago, IL, USA 1Correspondence: 2825 North Halsted, Chicago IL 60657, USA. Tel: +1 773 4724900; Fax: +1 773 8715221; e-mail: [email protected]

Abstract Familial dysautonomia (FD) is the most common congenital sensory neuropathy in Ashkenazi Jews, caused by a single major mutation in the IKBKAP gene. Effective management for this severe debilitating disease is still not available, making preimplantation genetic diagnosis (PGD) a useful option for at-risk couples to establish an FD free pregnancy from the outset. PGD was performed for a couple with a previous affected child with FD, using first and second polar body testing to preselect mutation-free oocytes, based on mutation analysis with simultaneous testing of two closely linked markers, D9S58 and D9S1677. Of 15 tested oocytes, 11 carried information about both polar bodies’ genotype, of which seven were predicted to be free of the FD gene. Three embryos resulting from these oocytes were transferred back to the patient, resulting in a triplet pregnancy and the birth of three unaffected children confirmed to be free of FD. This is the first PGD for FD, providing an alternative for those at-risk couples who cannot accept prenatal diagnosis and termination of pregnancy as an option for avoiding FD. Keywords: familial dysautonomia, IKBKAP gene, multiplex PCR, polar body sampling, preimplantation genetic diagnosis

Introduction

488

Familial dysautonomia (FD) is an autosomal recessive disorder, associated with the mutation affecting the donor splice site of intron 20 of the IKBKAP gene, located on chromosome 9q31 (MIM 603722; Online Mendelian Inheritance in Man, 2001). It is the most common congenital sensory neuropathy, being present in 1/3600 live births in Ashkenazi Jews. FD is present at birth, with characteristic features including the absence of fungiform papillae on the tongue, absence of flare after injection of intradermal histamine, decreased or absent deep-tendon reflexes and absence of overflow of emotional tears. This is a devastating and debilitating disorder, characterized by the poor development and progressive degeneration of the sensory and autonomous nervous system, gastrointestinal and respiratory dysfunctions, vomiting crisis, excessive sweating and postural hypotension. Despite a remarkable variability in the disease phenotype within and between families, thought to derive from different mutations producing inactivation of the gene, a single major mutation has been described (Slaugenhaupt et al., 2001). It is also of interest that a single T→C change at base

pair 6 of the splice donor site, which is probably responsible for 99% of cases of FD, was shown to result in skipping of exon 20 (74 bp) from the IKBKAP mRNA only in the brain tissue, with varying level of gene expression in other tissues. This may explain the severe progressive degeneration of the sensory and autonomous nervous system, leading to continued neuronal depletion with age and early death. The product of the IKBKAP gene is part of a multiprotein complex, thought to play a role in general transcriptional regulation, so the complete inactivation of the gene might cause a lethal phenotype at any stage of embryonic development (Slaugenhaupt et al., 2001). The remarkable variability of the disease phenotype may be explained by the presence of a partially functional gene product in some tissues, including brain, because even a small amount of the encoded protein expressed at critical developmental stages might permit sufficient neuronal survival. In addition, a very rare minor FD missense mutation was described (G→C change at base pair 17 in exon 19 of the gene), which is associated with a mild phenotype in patients with heterozygous status for the major mutation (Slaugenhaupt et al., 2001).

Articles - PGD for familial dysautonomia - S Rechitsky et al.

Despite progress in understanding the nature and pathogenesis of the disease, FD is still fatal, with no effective management available at the present time, making preimplantation genetic diagnosis (PGD) a useful option for those at-risk couples who cannot accept prenatal diagnosis and termination of pregnancy as an option for avoiding FD in their offspring. This paper presents the first experience of PGD for FD, resulting in a triplet pregnancy and birth of three unaffected children.

Materials and methods The couple presented for PGD with one previous child diagnosed to be affected with FD. Both parents were of Ashkenazi Jewish ancestry and, as seen from the pedigree (Figure 1), were carriers of the gene for FD, based on marker analysis, which has been available for all members of the extended family (Blumenfeld et al., 1999). A PGD cycle was performed using a standard IVF protocol coupled with micromanipulation procedures for polar body (PB) sampling, as described elsewhere (Verlinsky and Kuliev, 2000). The first (PB1) and second PB (PB2) were removed following maturation and fertilization of the oocytes, and tested by multiplex nested PCR analysis, involving mutation testing simultaneously with different linked markers (Rechitsky et al., 1999). Mutation analysis involved the detection of T→C change in the donor splice site of intron 20, based on HhaI restriction digestion, which does not cut the normal allele, while creating two fragments of 60 and 94 bp in the mutant allele (Figure 2).

There are three genetic possibilities for the PB1 genotype from a heterozygous mother. If no crossover occurs, PB1 will be homozygous (either normal or mutant), but in the event of a crossover, PB1 will be heterozygous. If crossover does not occur and the PB1 is homozygous for the mutant gene, the oocyte must contain two copies of the normal gene and any embryo resulting from this oocyte can be transferred, but this was not the case in any of the oocytes shown in Figure 2. If the PBI is homozygous for the normal gene, the maternal contribution to the embryo must be the mutant gene, which was also not the case as seen from Figure 2. In both of these circumstances the extruded PB2 will have an identical genotype to the oocyte (opposite to genotype of PB1). In the event that crossover is observed in all cases shown in Figure 2, PBI is heterozygous and analysis of PB2 is required to predict which maternal allele has been extruded with PB2 and which left in the maternal pronucleus following fertilization. Accordingly, if the normal gene is extruded with PB2 (e.g. PB2 is hemizygous normal), the resulting maternal contribution to the embryos is the mutant gene, and if the mutant gene is extruded with PB2 (e.g. PB2 is hemizygous mutant), the resulting maternal contribution to the embryos is the normal gene (see Results, and Figure 2). Because PB1 and PB2 are extruded and have no biological significant in pre- and post-implantation development, they represent a valuable byproduct of the first and second meiotic divisions for testing and inferring the genetic content of the resulting maternal genetic contribution to the embryo. It is furthermore possible that even the oocytes predicted as mutant may further form unaffected heterozygous embryos, following fertilization by a

Figure 1. Family pedigree. Middle panel: the father (FD1) is a carrier of mutation (M) of the donor splice site of intron 20 of the IKBKAP gene, which is linked to 135 bp repeat of D9S1677, and 116 bp repeat of D9S58, while the normal allele (N) is linked to 135 bp and 151 bp repeat of the same polymorphic markers respectively. The mother (FD2) is also a carrier of the same mutation, linked to 140 bp and 116 bp repeat, the normal gene being linked to 126 bp and 99 bp repeat respectively. As seen from this panel, the paternal sister and maternal sister and brother are also carriers of the mutation inherited from the paternal father and maternal mother (upper panel). Lower panel: reproductive outcomes of this couple include one previous affected child with familial dysautonomia (FD) and unaffected triplets born following PGD.

489

Articles - PGD for familial dysautonomia - S Rechitsky et al.

Figure 2. Preimplantation genetic diagnosis for major mutation. a. Position of major splice donor mutation T→C in IKBKAP gene. b. Restriction map. Major mutation creates restriction site for HhaI enzyme. c. PB analysis of normal and mutant sequences of IKBKAP gene. Of 11 oocytes tested, seven were mutation free based on heterozygous PB1 and affected PB2, of which oocytes 1, 3 and 6 were transferred back to the patient resulting in unaffected triplets. L, 100 bp ladder; N, normal; M, mutant; ET, embryo transfer; U, undigested PCR product; Ma, maternal genotype; P, paternal genotype.

mutation-free spermatozoon. Therefore, with insufficient number of mutation-free oocytes, preselected by PB1 and PB2 sequential analysis, further testing of the resulting embryos may allow the identification of heterozygous unaffected carrier embryos for transfer. Preselection of mutation-free oocytes was performed based on the simultaneous mutation detection and linked marker analysis, involving two strongly linked markers, D9S58 and D9S1677, which were shown not to be involved in recombination in the analysis of 435 FD chromosomes (Blumenfeld et al., 1999). Therefore, prior to PGD a single sperm testing was performed to identify the paternal haplotypes, which were as follows: the mutant allele was linked to 116 bp, and the normal to a 151 bp repeat of the D9S58 marker, while the D9S1677 marker was not informative. The maternal haplotypes were established based on PB analysis and were as follows: the mutant allele was linked to a 116 bp repeat of D9S58, and a 140 bp repeat of the D9S1677 marker, while the normal allele was linked to a 140 bp repeat of D9S58 and a 126 bp repeat of the D9S1677 marker (Figure 3). Primer sequences and reaction conditions are presented in Table 1.

490

Following informed consent, approved by the Institutional Review Board, the embryos derived from oocytes free of FD, based on information regarding both polymorphic markers, were pre-selected for transfer back to the patient, while those predicted to be mutant or with insufficient marker information

were exposed to confirmatory analysis using blastomere DNA from these embryos to identify heterozygous embryos, which could be used for transfer in the future cycles, and to evaluate the accuracy of single-cell based PGD.

Results and discussion A single PGD cycle was performed, with 15 oocytes available for testing, for 11 of which information was available for both PB1 and PB2 (in oocyte 5, PB2 did not amplify and in oocytes 2, 4 and 14 no PB2 was extruded due to failure of fertilization; Table 2). Of these 11 oocytes, four were predicted to be mutant based on the heterozygous PB1 and hemizygous normal (mutation-free) PB2 (oocytes 8, 10, 13 and 15), while the remaining seven oocytes were free of the mutant gene, as evidenced by the heterozygous PB1 and hemizygous mutant PB2 (Figure 2, Table 2). These results were in agreement with both markers, except for oocytes 7 and 11, in which allele drop-out (ADO) of the D9S1677 allele linked to the mutant gene was observed (Figure 3). Three embryos resulting from the above seven oocytes (embryos 1, 3, 6; Figure 2), with mutation-free status confirmed by both markers, reached the blastocyst stage and were transferred back to the patient, yielding a triplet pregnancy and birth of three unaffected children, including two homozygous normal and one heterozygous carrier. Two of the other embryos resulting from normal oocytes did not form blastocysts and the other two were further tested because of ADO of one of the markers (oocytes 7 and 11).

Articles - PGD for familial dysautonomia - S Rechitsky et al.

Table 1. List of primers for PGD of FD. Gene/polymorphism

Upper primer

Intron 20, major mutation (T→C) HhaI restriction, hemi-nested PCR

Outside: 5′ GTTGTTCATCATCGAGCCC 3′ Inside: 5′ GTTGTTCATCATCGAGCCC 3′ Outside: 5′ TGGCTGTTTTGAGAAGT 3′ Inside: 5′ Hex ATGTAACCTGTCTCCACTG 3′ Outside: 5′ AAGCAATCCTCGCACCTCAG 3′ Inside: 5′ FamCCTGAGTAGCCGGGACTATA 3′

D9S1677

D9S58

Lower primer

Annealing temperature

5′ CTGATTGATGATATAGGTAATGAGG 3′ 62–55°C 5′ GCTTTTCATAATTTTAAGTTCTCG 3′

55°C

5′ TGGGAGGATGAGTTGAG 3′

62–55°C

5′ CTGGGCAACATAGCAAG 3′

57°C

5′ CCAGGAGTTTGAGACCAGCC 3′

62–55°C

5′ TAGGCAACACATCAAGATCCT 3′

57°C

Figure 3. Capillary electrophoregrams of fluorescently labelled PCR products of tightly linked markers D9S1677 (left panel) and D9S58 (right panel) scored by GenotyperTM. Upper panel: confirmation of mutation-free status of oocyte 1, based on the presence of both polymorphic markers linked to normal and mutant genes in PB1 and only marker linked to mutant gene in PB2. Middle panel: confirmation of mutation-free status of oocyte 11, based on the presence of one of the polymorphic markers linked to normal and mutant genes in PB1 and the marker linked to mutant gene in PB2 (right). Allele drop-out (ADO) of the marker linked to mutant gene is seen in PB1 (left). Lower panel: confirmation of mutant status of oocyte 13 based on the presence of both polymorphic markers linked to normal and mutant genes in PB1 and the marker linked to normal gene in PB2.

491

Articles - PGD for familial dysautonomia - S Rechitsky et al.

Table 2. Results of PB1 and PB2 multiplex PCR analysis, with simultaneous testing for major FD mutation and linked marker analysis (D9S58 and D9S1677) and the follow-up blastomere analysis for confirmation of PB diagnosis. N, normal allele; M, mutant allele; FA, failed amplification. Oocyte no.

1 2 3 4 5

6 7

8

9 10

11

12 13

14 15

Mother Father

492

PB1 PB2 PB1 PB2 PB1 PB2 PB1 PB2 PB1 PB2 Blastomere PB1 PB2 PB1 PB2 Blastomere PB1 PB2 Blastomere PB1 PB2 PB1 PB2 Blastomere PB1 PB2 Blastomere PB1 PB2 PB1 PB2 Blastomere PB1 PB2 PB1 PB2 Blastomere DNA DNA

Major mutation

D9S58

D9S1677

Predicted Embryo oocyte genotype follow-up or transfer

N/M M N/M Not available N/M M N/M Not available N/M FA N/M N/M M N/M M N/M N/M N M/M N/M M N/M N N/M N/M M N/N N/M M N/M N N/M N/M Not available N/M N N/M N/M N/M

99/116 116 99/116

126/140 140 126/140

Normal

Transferred

Inconclusive

–

99/116 116 99/116

126/140 140 126/140

Normal

Transferred)

Inconclusive

–

99/116 FA 151/116 99/116 116 99/116 116 151/116 99/116 99 116/116 99/116 116 99/116 99 151/116 99/116 116 151/99 99/116 116 99/116 99 151/116 99/116

126/140 FA 135/140 126/140 140 126/ADO 140 135/140 126/140 126 135/140 126/140 140 126/140 126 135/140 126/ADO 140 136/126 126/140 140 126/140 126 135/140 126/140

Inconclusive

Carrier

Normal

Transferred

Normal

Carrier

Mutant

Mutant

Normal

–

Mutant

Carrier

Normal

Normal

Normal

–

Mutant

Carrier

Inconclusive

–

99/116 99 151/116 99/116 116/116

126/140 126 135/140 126/140 135/135

Mutant

Carrier

The results of blastomere analysis of these embryos and of those resulting from four mutant oocytes are presented in Table 2. Three of four embryos deriving from the mutant oocytes were shown to be heterozygous carries of the mutant gene (embryos 10, 13 and 15), and one was homozygous mutant (embryo 8). One of the embryos deriving from normal oocytes was confirmed to be homozygous for the normal gene (embryo 11) and the other was a heterozygous carrier (embryo 7). These embryos, as well as a further three embryos, which appeared to be heterozygous carriers, were frozen to be available for transfer in future cycles, should the couple wish to have another unaffected child. Of course, the normal noncarrier embryo could be given preference in transfer, but because a detrimental effect of removing blastomeres from cleaving embryos cannot be completely excluded, priority was

given to the three non-biopsied embryos resulting from the mutation-free oocytes. There is also at least a two times higher ADO rate in PCR of blastomeres than in PB1, which may affect the accuracy of blastomere analysis (Rechitsky et al., 1998). However, when more data are collected on the possible effect of different biopsy procedures on the outcome of pregnancy, and the accuracy of blastomere analysis is further improved, the possibility for parents to chose implanting normal or carrier embryos should be explored. The results demonstrate the diagnostic accuracy of PGD for FD by sequential PB1 and PB2 analysis, as the follow-up analysis of the embryos, resulting from either mutant or normal (mutation-free) oocytes was in agreement with sequential PB1 and PB2 analysis in all the embryos tested,

Articles - PGD for familial dysautonomia - S Rechitsky et al.

which is in accordance with the previously reported extensive data on sequential PB1 and PB2 analysis (Rechitsky et al., 1999). Although ideally at least three linked markers are considered necessary to completely exclude the risk for misdiagnosis due to ADO (Rechitsky et al., 2001), the use of the two linked markers, in the present study, was reliable because it was possible to follow both normal and mutant alleles through the first and second meiotic divisions in all but four oocytes, in which either no PB2 was available due to failure of fertilization or PB2 failed to amplify. In other words the presence of both mutant and normal alleles in PB1 following meiosis I, and the detection of the mutant allele extruded with PB2 following meiosis II, leaves no doubt of mutation-free status of the maternal pronucleus, even if no linked markers are available for testing. However, the testing of sufficient number of linked markers would be absolutely essential if the PB1 appears to be homozygous mutant, to exclude the possible ADO of the normal allele, because failure to detect ADO could lead to the opposite interpretation of the results of PB2. With undetected ADO in PB1, the presence of a normal allele in PB2 could suggest a normal (mutation-free) status of the resulting oocyte, which is in fact mutant. The presented case is the first PGD for FD, demonstrating the clinical relevance of PGD in those couples who cannot accept prenatal diagnosis and termination of pregnancy. Because of the high prevalence of FD in Ashkenazi Jews, with carrier frequency of 1 in 32, this approach may have practical implications, so at-risk couples require information about the availability of PGD. The described PGD design for FD can generally be applied without extensive preparatory work in different couples, due to the fact that a single major mutation is involved, although a sufficient number of informative linked markers should be selected, a variety of which are readily available.

References Blumenfeld A, Slaugenhaupt SA, Liebert CB et al. 1999 Precise genetic mapping and haplotype analysis of the familial dysautonomia gene on human chromosome 9q31. American Journal of Human Genetics 64, 1110–1118. International Working Group on Preimplantation Genetics 2001 Tenth Anniversary of Preimplantation Genetic Diagnosis. Report of the 10th Annual Meeting International Working Group on Preimplantation Genetics, in association with the 3rd International Symposium on Preimplantation Genetics, Bologna, Italy, June 23, 2000. Journal of Assisted Reproduction and Genetics 18, 66–72. Kuliev A, Verlinsky Y 2002 Current feature of preimplantation genetic diagnosis. Reproductive BioMedicine Online 5, 296–301. Online Mendelian Inheritance in Man (OMIM) 2001 Johns Hopkins University. http://www.ncbi.nlm.nih.gov/Omim [MIM 223900]. Rechitsky S, Strom C, Verlinsky O et al. 1998 Allele drop out in polar bodies and blastomeres. Journal of Assisted Reproduction and Genetics 15, 253–257. Rechitsky S, Strom C, Verlinsky O et al. 1999 Accuracy of preimplantation diagnosis of single-gene disorders by polar body analysis of oocytes. Journal of Assisted Reproduction and Genetics 16, 192–198. Rechitsky S, Verlinsky O, Amet T et al. 2001 Reliability of preimplantation diagnosis for single gene disorders. Molecular and Cellular Endocrinology 183, S65–S68. Slaugenhaupt SA, Blumenfekl A, Gill SP et al. 2001 Tissue-specific expression of a splicing mutation in the IKBKAP gene causes familial dysautonomia. American Journal of Human Genetics 68, 598–605. Verlinsky Y, Kuliev A 2000 Atlas of Preimplantation Genetic Diagnosis. Parthenon, New York, London. Received: 18 December 2002; refereed: 8 January 2003; accepted: 20 January 2003.

PGD for Mendelian disorders has now been applied in more than 1000 clinical cycles, resulting in 300 unaffected pregnancies and births of healthy children (International Working Group on Preimplantation Genetics, 2001; Kuliev and Verlinsky, 2002). The list of conditions for which PGD can be applied is expanding gradually with progress in the identification of an increasing number of novel mutations causing Mendelian diseases. As shown by the example of FD, it is predicted that PGD may in future be applied for gene expression abnormalities, which might be limited to a particular tissue or stage of embryonic development. This may also allow preselection of embryos with the best potential to establish a viable pregnancy, based on progress on the understanding of stage-specific gene expression.

493