Prenatal determination of fetal RhD status by analysis of peripheral blood of rhesus negative mothers

1147

THE LANCET

LETTERS

to

the

EDITOR

Prenatal determination of fetal RhD status by analysis of peripheral blood of rhesus negative mothers SIR,—The prenatal determination of fetal rhesus D (RhD) status is useful in the management of pregnancies in sensitised RhDnegative mothers whose partners are heterozygous for RhD because no further diagnostic or therapeutic procedures are necessary if the fetus is RhD-negative. Currently, fetal RhD status can only be ascertained prenatally by invasive procedures, such as fetal blood sampling.! A non-invasive approach for prenatal fetal RhD status determination with use of fetal cells in maternal circulation2 would therefore be very useful. Recently the RhD gene was cloned and it was shown that RhD-negative individuals lack this gene.3 This observation suggested to us that the polymerase chain reaction (PCR) could be used to detect RhD DNA sequences from a RhD-positive fetus by amplification from the peripheral blood of RhD-negative mothers. This report describes the development of a sensitive PCR assay for RhD detection and represents the first demonstration of the elucidation of a fetal blood group type by analysis of maternal peripheral blood. 115 pregnant women who attended our antenatal clinic were recruited. 21 were RhD-negative by routine serological typing (table). DNA from each of the 21 RhD-negative women was DETECTION OF FETAL RhD SEQUENCES FROM MATERNAL PERIPHERAL BLOOD

extracted from 10 ml antecubital vein blood with standard proteinase K and phenol-chloroform methods. Fetal RhD was typed by serological analysis of cord blood at delivery, except for cases 8,14, and 15 where there was clinical indication for fetal blood sampling. Fetal blood sampling and fetal blood group analysis were done at 20 weeks in case 8, 29 weeks in case 14, and 28 weeks in case 15.

Amplification of RhD sequences from peripheral blood of RhD-negative mothers. M=pBR322 DNA digested with Haelll(marker) Lanes 1-6== cases 10-15, 7=1in 10’ dilution of 1 g homozygous RhD-positive DNA in 5 g RhD-negative male DNA (positive control); 8= 5 g RhD-negative male DNA; and 9=water (negative control). Results after two rounds of amplification. Arrow marks position of 262 bp second-round PCR product. Primer sequences: RD-A3 (sense): 5’GGATTTTAAGCAAAAGCATCCAAGAA3’ RD-2 (antisense): 5’ACTGGATGACCACCATCATAT3’ RD-5 (sense): 5’CAAGGCCTGTTCAAAAACAAG3’ PCR

primers

were

designed

to

amplify

the 3’ end of the RhD

gene which differs from the related Rh C/E gene.3 The specificity of the primers was tested by amplification of DNA from 25 RhD-positive and 25 RhD-negative individuals of various genotypes. Positive signals were only obtained from RhD-positive

individuals. The primer sequences are shown in the figure legend. For fetal RhD detection from maternal blood DNA, RD-A3 and RD-2 were used in a first round PCR (291 bp product) consisting of 50 cycles of 94*C for 1 min, 56°C for 1 min, and 72’C for 1 min. The hot-start used.’ 5

Anti-D prophylaxis given at *28 or t28 and 34 weeks. tAnti-D level of up to 01 IU/mL is consistent with passive immune prophylaxis pos=RhD-positive, neg=RhD-negative +presence of and absence of 262 bp second-round RhD product. N D = not detected. —

procedure with Ampliwax (Perkin-Elmer Cetus) was ug genomic DNA was used per 100 gL reaction. 2 L first-round product was reamplified by 10 cycles of hemi-nested PCR with RD-5 and RD-2 as primers (262 bp product) with the same cycling parameters. Stringent precautions against contamination were used.2 PCR products were analysed by agarose gel electrophoresis and scored by an observer with no previous knowledge of the fetal RhD status. The first-round PCR could detect the equivalent of a homozygous RhD-positive cell in a background of 750 000 RhD-negative cells. The second-round PCR was used as confirmation of the specificity of the first round and was not used further to enhance the sensitivity of the assay. Results of the assay are shown in the table and figure. Of the 10 women bearing RhD-positive fetuses, 8 gave a positive PCR signal, indicating that the fetal RhD sequence can be amplified from the peripheral blood of RhD-negative mothers. The ability to detect fetal RhD sequences in women with anti-D antibody (cases 8, 9, 14

1148

THE LANCET

and 15) is important because the test is potentially useful in the management of sensitised pregnancies. The cellular origin of the RhD DNA sequences detected by our PCR requires further investigation as they may originate from both RhD-expressing (eg, nucleated fetal red cells) or non-RhDexpressing (eg, trophoblasts) cells. Our system, however, has not reached the precision required for routine clinical use. Diagnostic accuracy could be further improved by combining our technique with fetal cell enrichment. Enrichment strategies aiming at different fetal cell populations (eg, fetal nucleated red cells5 and trophoblasts6) may have different efficiencies in the present application because fetal nucleated red cells may be cleared to a greater extent than trophoblast cells in sensitised pregnancies, since the latter do not express Rh antigens. Our hope is that an improved method will help in the assessment of cases at risk of RhD

haemolytic disease,. We thank Mr Paul Elliott, Mr Geoff Pratt, Mrs Anne Naylor, and Mrs Annona Galliard for obtaining clinical details of some of the cases. This study was supported by the Wellcome Trust.

Department of Pathology and Bacteriology, Regional Transfusion Laboratory, Nuffield Department of Obstetrics and Gynaecology, and Department of Haematology, John Radcliffe Hospital, Nuffield

Oxford OX3 9DU, UK

Y.-M. D. LO P. J. BOWELL M. SELINGER I. Z. MACKENZIE P. CHAMBERLAIN M. D. G. GILLMER T. J. LITTLEWOOD K. A. FLEMING J. S. WAINSCOAT

1. MacKenzie IZ, Selinger M, Bowell PJ. Management of red cell isoimmunization in the 1990s. In: Studd J, ed. Progress in obstetrics and gynaecology. London: Churchill Livingstone, 1991; 9: 31-53. 2. Lo Y-MD, Patel P, Wainscoat JS, Sampietro M, Gillmer MDG, Fleming KA. Prenatal sex determination by DNA amplification from maternal peripheral blood. Lancet 1989; ii: 1363-65. 3. Le Van Kim C, Mouro I, Chérif-Zahar B, et al. Molecular cloning and primary structure of the human blood group RhD polypeptide. Proc Natl Acad Sci USA 1992; 89: 10925-29. 4. Chou Q, Russell M, Birch DE, Raymond J, Bloch W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications Nucleic Acids Res 1992; 20: 1717-23. 5. Bianchi DW, Flint AF, Pizzimenti MF, Knoll JHM, Latt SA. Isolation of fetal DNA from nucleated erythrocytes in maternal blood. Proc Natl Acad Sci USA 1990; 87: 3279-83. 6. Mueller UW, Hawes CS, Wright AE, et al. Isolation of fetal trophoblast cells from peripheral blood of pregnant women. Lancet 1990; 336: 197-200.

Monoclonal-antibody-purified factor IX SIR,-Monoclonal-antibody-purified factor IX (Mononine, Armour) was released in the US in August, 1992, for factor IX deficiency. Trials in trauma-related bleeding and elective surgery have used intermittent bolus injections of 25 U/kg every 12-24 h. Such doses generally produce in-vitro recovery of 65% and have not been associated with the thrombotic problems that have bedevilled the use of prothrombin complex concentrated Experience with continuous infusion of monoclonal-purified factor VIII products shows decreased bleeding and total cost.2 Logan et al3 treated two patients with continuous infusion Alphanine for three surgical procedures. This factor IX concentrate is purified by affinity chromatography and suspended in n-heptane. We have used continuous infusion Mononine. A 22-year-old man with severe haemophilia B presented with 2 days of progressive headache and vomiting with no known trauma. Computed tomography (CT) showed a 1 ’5 cm left parietal subdural haematoma with a small midline shift and possibly an epidural component. He was given a bolus of 52 U/kg Mononine before CT. 2 h later, he received another 52 U/kg followed by a continuous infusion over the next 4 days of 4-7 U/kg per h (table). He had a small increase in scalp oozing when the incision was closed, which stopped within 15 min. The infusion was continued for 32days, when he switched to bolus Mononine for the next 4 days. Each 12 h supply of Mononine was mixed sterile with normal saline to run at 20 ml/h from a vinyl infusion bag. At hour 39, the bag contained 5-11 U/ml factor IX activity. The bag had been mixed to give 112 U/ml. Thus, the amount in the bag was only 45% of

COAGULATION RESULTS BEFORE AND DURING INFUSION I

I

f

I

I

*Normal.

predicted, perhaps due to adsorption of Mononine by vinyl. We would have predicted an increasing factor IX level in our patient, since the half-life of Mononine is 31 h (SD 10), but this did not occur (table). The patient received Mononine 40 g/kg daily to produce steady-state factor IX over 90%. Fibrin split products were slightly high after one dose of Mononine and remained so for 6 days, which may have been a result of the subdural bleed or the surgical procedure itself. While our patient had normal liver function, he is both HBsAg and hepatitis C positive, which may have affected fibrin split products. Our patient had had arthroscopic synovectomy of his right knee in March, 1991, with Mononine obtained for compassionate use. In a pre-operative recovery study, 40 U/kg gave a peak factor IX of 54% at 30 min, 20% at 24 h, and 8% at 48 h. He was given 40 U/kg every 24 h for 12 days, which kept his factor IX trough above 27% with no postoperative bleeding. Scottish Rite Children’s Medical Center,

Atlanta, Georgia 30342, USA

ELIZABETH M. KURCZYNSKI MARK D. MONCINO

HC, McMillan CW, White GC, Bergman GG, Horton MW, Saidi P. Purified factor IX using monoclonal immunoaffinity technique: clinical trials in hemophilia B and comparison to prothrombin complex concentrates. Blood 1992; 79: 568. 2. Weinstein RE, Bona RD, Rickles FR. Continuous infusion of monoclonal antibodypurified factor VIII. Am J Hematol 1991; 36: 211. 3. Logan LJ, Gilbert PK, Sanders NL, VanderLaan TL. Delivery of alphanine by continuous infusion for surgical operations. 44th annual meeting, National Hemophilia Foundation, Atlanta, Georgia, 1992: 10. 1. Kim

Mammography and breast cancer frequency SIR,-A Lancet editorial’ stated that the

cost

in

terms

of

false-positive mammograms that lead to unnecessary investigations and surgery is

not

insubstantial. It is evident that in the UK

mammography risks are open to discussion. Unfortunately, this is not so in the USA. For example, an article in the Jan/Feb, 1993, federal Public Health Reports states that, according to the National Cancer Institute (NCI), American women older than age 40 nearly doubled mammography use between 1987 and 1990, which suggests government and public health organisations are succeeding in their goal of encouraging women to have mammograms. The NCI recommends that women 50 years and older have yearly mammograms, and women between 40 and 50 years have them every 1-2 years. No mention is made of many mammography deficiencies that may endanger women’s lives. The Food and Drug Administration’s (FDA) article "Mammography saves lives" in FDA Consumer, July/August, 1991, stated that mammography screening for women of 50 and over can reduce breast cancer death by 30%, and for women 40-49 by 24%. However, the same article also revealed that "State surveys supported by the FDA found that the average score of images produced by mammography machines climbed from 7-8 in 1985 to 9-9 in 1990". The range of scores is 0-16. Since mammograms are among the most difficult radiographic images to read and must have optimum clarity for the image to be interpreted correctly, the average image quality score of 9 obtained in 1990 was much too low to represent optimum image clarity. It is not surprising that in 1990, after about 25 years of mammography use, very few facilities (if any) delivered the optimum image clarity needed for proper

diagnosis.