Prenatal ethanol exposure increased the susceptibility of adult offspring rats to glomerulosclerosis

Journal Pre-proof Prenatal ethanol exposure increased the susceptibility of adult offspring rats to glomerulosclerosis Haiyun Chen, Yanan Zhu, Xiaoqi Zhao, Hangyuan He, Jinsong Luo, Ying Ao, Hui Wang

PII:

S0378-4274(19)30383-2

DOI:

https://doi.org/10.1016/j.toxlet.2019.11.026

Reference:

TOXLET 10637

To appear in:

Toxicology Letters

Received Date:

25 July 2019

Revised Date:

23 November 2019

Accepted Date:

25 November 2019

Please cite this article as: Chen H, Zhu Y, Zhao X, He H, Luo J, Ao Y, Wang H, Prenatal ethanol exposure increased the susceptibility of adult offspring rats to glomerulosclerosis, Toxicology Letters (2019), doi: https://doi.org/10.1016/j.toxlet.2019.11.026

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Title Prenatal ethanol exposure increased the susceptibility of adult offspring rats to glomerulosclerosis

Authors: Haiyun Chena, Yanan Zhua, Xiaoqi Zhaoa, Hangyuan He a, Jinsong Luo c, Ying Aoa,b*, Hui Wanga,b

Affiliation: Department of Pharmacology, Basic Medical School of Wuhan University, Wuhan, 430071, China

b

Hubei Provincial Key Laboratory of Developmentally Originated Disorder, Wuhan, 430071, China

c

Department of paediatrics, People's hospital of wuhan university, Wuhan, 430060, China

ro of

a

*Correspondence to:

re

Tel: +86-13995592855; E-mail: [email protected].

-p

Ying Ao, M.D., Ph.D., Department of Pharmacology, Basic Medical School of Wuhan University.

Highlights

lP

1. PEE increases the susceptibility of offspring to glomerulosclerosis under the high-fat diet feeding after weaning.

na

2. PEE caused podocytes EMT in offspring.

3. Low expression programming of AT2R mediated susceptibility of male offspring to glomerulosclerosis.

Jo

ur

4. GC-IGF1 axis programming mediated susceptibility of female offspring to glomerulosclerosis.

1

Abstract: This study was aimed to investigate the effect of prenatal ethanol exposure (PEE) on the susceptibility of offspring rats to glomerulosclerosis and to explore the mechanism. Pregnant Wistar rats were intragastrically administered ethanol (4g/kg·d) from gestational day (GD) 9 to GD 20, and the control group was given equal volume of normal saline. The offspring rats were all fed with high-fat diet after weaning, and were sacrificed at postnatal week 24 (PW24). The results revealed that the adult offspring kidneys in the male and female PEE groups exhibited higher glomerulosclerosis index and interstitial fibrosis index compared with the high-fat diet control groups, accompanied by elevated serum creatinine level. The protein expression of Nephrin and WT1, which were the marker genes of podocytes, was significantly decreased, whereas the protein

ro of

expression of desmin and α-SMA, the marker genes of mesenchymal cells, was remarked enhanced in the male and female PEE groups. Compared with the high-fat diet control groups, the mRNA and protein expressions of renal angiotensin II receptor type 2 (AT2R) were decreased in the male PEE group, but increased in the female PEE group. PEE increased the mRNA and protein expressions of glucocorticoid (GC) activation system and inhibited the expression of insulin-like growth factor 1

-p

(IGF1) signaling pathway in male offspring kidney; on the contrary, in female offspring kidney, PEE inhibited the mRNA and protein expression of glucocorticoid activation system and increased

re

the expression of IGF1 signaling pathway. Taken together, PEE increased the susceptibility of the adult offspring to glomerulosclerosis, and the programming of renal AT2R or GC-IGF1 is

lP

respectively involved in the toxicity of PEE to the male or female offspring. Key words: Prenatal ethanol exposure; Glomerulosclerosis; Podocyte epithelial-mesenchymal

1 Introduction

na

differentiation; Angiotensin II Type 2 Receptor; Glucocorticoid-insulin-like growth factor 1 axis.

ur

Alcohol consumption is a common phenomenon among pregnant women in many countries (Zimatkin, Pronko et al. 2006). In some European countries, the ratio of pregnant women drinking

Jo

alcohol-containing beverages was more than 50% (Sethi, Glassock et al. 2015). Our previous studies have shown that prenatal ethanol exposure (PEE) could not only increase the incidence of intrauterine growth retardation (IUGR), but also increase the susceptibility to osteoporosis and nonalcoholic fatty liver disease in adult offspring (Shen, Liu et al. 2014, Ni, Wang et al. 2015), and we proposed that the underlying mechanism is related to over-exposure of the fetus to high level of maternal glucocorticoid (Tan, Lu et al. 2012, Xu, Liang et al. 2012, Shangguan, Jiang et al. 2017, Xu, Huang et al. 2018). 2

Glomerulosclerosis is a common pathological stage in the progress and deterioration of various chronic glomerular diseases to end-stage renal disease (Sethi, Glassock et al. 2015). Brenner hypothesis states that adverse intrauterine environment results in poor kidney development and the reduced number of glomeruli in the offspring, which leads to glomerular ultrafiltration after birth, and increase the risk of chronic kidney disease under the second hit (Brenner, Garcia et al. 1988). High-fat diet is one of the main factors inducing the onset of metabolic syndrome, and it is also a reliable model to replicated animal kidney disease (Gluckman and Hanson 2004). Whether PEE could increase the susceptibility of offspring to glomerulosclerosis under the second hit of high-fat diet after weaning is still unclear.

ro of

Podocytes are glomerular visceral epithelial cells and are important for maintaining glomerular function. Epithelial-mesenchymal transition (EMT) refers to the loss of phenotypic characteristics of epithelial cells and the pathophysiological changes to interstitial cell phenotype under various physical and chemical factors. During EMT of podocytes, the expression of nephrin, podocin and other epithelial cell marker genes are decreased, whereas the expression of

-p

mesenchymal cell marker genes desmin, α-smooth muscle actin (α-SMA) is up-regulated (Greka and Mundel 2012). It is known that podocyte EMT is an early event of podocyte injury, and is the

re

onset of glomerular diseases (Shankland 2006, Greka and Mundel 2012, Nagata 2016). The activation of β-catenin can accelerate the occurrence of podocyte EMT (Guo, Xia et al. 2014).

lP

β-catenin activates lymphoenrichment factor 1 (LEF-1), which inhibits the expression of E-cadherin and directly induces EMT (Medici, Hay et al. 2006). However, whether PEE could cause podocyte EMT is still unclear.

na

The renin-angiotensin system (RAS) plays an important role in fetal kidney development. The angiotensin II receptors including type 1 and type 2 (AT1R and AT2R) promote kidney development during the embryonic period. Our previous studies indicated that low expression

ur

programming of renal AT2R may be involved in mediating fetal kidney dysplasia and promoting renal damage in adulthood (Ao, Sun et al. 2015, Shangguan, Wen et al. 2018, Zhu, Zuo et al. 2018).

Jo

Whether the above programming mechanism is also involved in mediating the susceptibility to glomerulosclerosis caused by PEE has not been reported yet. It is known that intrauterine glucocorticoid level is a key factor to regulate the development of

fetal tissues, and excessive glucocorticoid exposure causes abnormality of fetal development (Fowden, Li et al. 1998). IGF1 is an important growth factor in the enrichment and functional differentiation of stem cells during fetal development, plays an important role in various organogenesis, structural and functional differentiation (Piecewicz, Pandey et al. 2012, Puri, Kumar 3

et al. 2012, Magner, Jung et al. 2013). Our previous studies have found that PEE can cause over-exposure of the fetal rats to maternal corticosterone, and the glucocorticoid-insulin-like growth factor 1 (GC-IGF1) axis programming may be involved in the abnormal development of the organs and related diseases of the offspring caused by PEE (Shen, Liu et al. 2014, Huang, He et al. 2015). However, it is not clear whether GC-IGF1 axis programming is also involved in mediating the susceptibility to glomerulosclerosis. Therefore, in this study, we used PEE as the ‘first strike’, high-fat diet feeding after weaning as the ‘second hit’, to investigate the effect of PEE on the susceptibility of offspring rats to glomerulosclerosis and to explore the mechanism. The main questions that we wanted to answer in

ro of

this study were whether PEE could increase the susceptibility of offspring rats to glomerulosclerosis and what was the mechanism. This study will be beneficial to clarify the developmental toxicity of PEE on offspring kidney and to explore potential therapeutic targets for fetal-originated renal

-p

diseases.

2 Materials and methods

re

2.1 Chemicals and reagents

Ethanol was obtained from Zhen Xin Co. Ltd. (Shanghai, China). Isoflurane was purchased

lP

from Baxter Healthcare Co. (Deerfield, IL, USA). Creatinine (Cr) assay kits (C011-2-1) were from Jiancheng Bioengineering Institute (Nanjing, China). Trizol reagent kits were obtained from Omega Bio-Tek (Doraville, USA). Monoclonal antibodies of rat glucocorticoid receptor (GR) (sc-12763),

na

nephrin (No. sc-376522), Wilms’tumor (WT1)(No. sc-7385), desmin (sc-65983) and α-smooth muscle actin (α-SMA) (sc-53142) were purchased from Santa Cruz (China); monoclonal antibody of rat IGF1 (NBP2-34361) was purchased from Novus Biotechnology Inc. (Novus, CA, USA);

ur

polyclonal antibody of rat insulin-like growth factor 1 receptor (IGF1R) (A12736) was purchased from ABclonal Biotechnology Inc. (Wuhan, China); polyclonal antibody of rat Angiotensin II Type

Jo

1 Receptor (AT1R) (AB124505) and AT2R (NBP1-77368) were from Abcam Inc. (Cambridge, MA, USA) and Novus Biotechnology Inc. (Novus, CA, USA); polyclonal antibody of rat glyceraldehyde phosphate dehydrogenase (GAPDH) (PB0141) was produced by Boster Biotechnology Inc. (Wuhan, China), polyclonal antibody of rat β-catenin (A11932), Histone H3 (A2348) were purchased from abclone (China). The RNA-Solv reagent and HiBindTM PCR DNA extraction kit were provided by Omega Bio-Tek Inc. (Norcross, GA, USA). Reverse transcript and quantitative PCR (Q-PCR) kits were purchased from Takara Biotechnology Co., Ltd. (Dalian, China). All oligonucleotide primers 4

of rat were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). All chemicals and reagents were of analytical grade. 2.2 Animals and treatment Animal experiments were performed in the Center for Animal Experiments of Wuhan University (Wuhan, China), which has been accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC International). All animal experimental procedures were approved by and performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of the Chinese Animal Welfare Committee and the International Council on Research Animal Care. [No. 2012-2014; license number: SCXK (Hubei);

ro of

Specific pathogen-free (SPF) Wistar rats

certification number: 42000600002258] with weights of 200–240 g for females and 260–300 g for males were obtained from the Experimental Center of Hubei Medical Scientific Academy (Wuhan, China). Animals were housed under temperature-controlled conditions on a 12 h light: dark cycle and had ad libitum access to standard chow and tap water at all time. After one week of

-p

accommodation, 2 females were mated with 1 male every night. Upon confirmation of mating by the appearance of sperm in a vaginal smear, the day was taken as gestational day (GD) 0. Then,

re

pregnant females were transferred to individual cages and randomly divided into two groups: the control group and the PEE group (n = 8-10 for each group). The PEE group was given ethanol

lP

4g/kg·d by gavage administration from GD9 until GD20, while the control group was given the same volume of distilled water. The pregnant rats were kept until normal delivery (GD21), and on postnatal day 1 (PD1) the numbers of pups were normalized to 8 pups per litter to assure adequate

na

and standardized nutrition until weaning (postnatal week 4, PW4). After weaning, all pup of each group were fed with high-fat diet (HFD) till PW24. The HFD was previously reported by our laboratory and provided 18.9% of its energy content as protein, 61.7% as carbohydrate, and 19.4%

ur

as fat (Shen, Liu et al. 2014). At PW24, the offspring rats were anaesthetized with isoflurane, the blood was collected from carotid artery before being sacrificed. Serum was prepared and stored at

Jo

−80 °C for Cr analyses. Kidneys were dissected and weighed. The right kidney was split longitudinally and fixed in 4% paraformaldehyde solution for histological examination, and the left kidneys were immediately frozen and stored at −80°C for further study. 2.3 Blood sample analysis Serum Cr level was detected by assay kits following the manufacturer's protocol. 2.4 Histological and immunohistochemistry analysis The right kidney tissue was fixed for 24 h in 4% paraformaldehyde solution and embedded in 5

paraffin, sectioned into 4 μm thick slices, and stained with hematoxylin and eosin (HE), periodic acid-Schiff (PAS) reagent and Masson's trichrome (Masson). Glomerulosclerotic index (GSI) and tubulointerstitial fibrosis index (TIFI) were evaluated as described previously (Ao, Sun et al. 2015). 2.5 Total RNA extraction and RT-qPCR Total RNA was isolated by using TRIzol reagent following the manufacturer’s protocol. The total RNA was reverse transcribed using a first strand cDNA synthesis kit. cDNA was amplified using the PrimeScript® RT reagent kit to cDNA. Relative mRNA expression levels of AT1R, AT2R, GR, 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1), 11β-hydroxysteroid dehydrogenase (11β-HSD2), IGF1, IGF1R were normalized to the level of GAPDH. The rat primer sequences and

ro of

annealing temperature are shown in Table 1. 2.6 Western blotting analysis

Protein abundance of renal Nephrin, WT1, desmin, α-SMA, AT1R, AT2R, GR, IGF1 and IGF1R was determined with Western blotting analysis. Briefly, kidneys were homogenized in RIPA buffer. Homogenates were centrifuged at 4°C for 10 min at 12,000 g, and supernatants aliquots were

-p

collected and stored at -80°C. Nuclear protein was prepared by Nuclear-Cytosol Extraction kit (P1200). Protein concentrations were determined using a protein assay kit from Bio-Rad. Samples

re

with equal protein (30 μg) were resolved on 10% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) and then transferred to nitrocellulose membranes. Nonspecific binding was blocked

lP

by TBST containing 5% dry milk for 60 min at room temperature, followed with overnight incubation at 4°C with the diluted primary antibodies of anti-rat Nephrin (1:500), anti-rat WT1 (1:500), anti-rat desmin (1:500), anti-rat α-SMA (1:500), anti-rabbit AT1R (1:1000), anti-rabbit

na

AT2R (1:1000), anti-rat GR (1:2000), anti-rat IGF1 (1:2500), anti-rat GAPDH (1:5000), anti-rabbit β-catenin (1:1000)，anti-rabbit H3 (1:1000). After 1 hour of incubation with HRP-conjugated secondary antibodies (1:5000), the signal was detected using ECL reagents. For comparison of the

ur

levels of the protein relative density between the groups, samples were normalized to GAPDH values and then presented as fold values relative to control animals.

Jo

2.7 Statistical analysis

Prism 6.0 (GraphPadSoftware, La Jolla, CA, USA) were used to perform data analysis.

Quantitative data were expressed as the Mean ± S.E.M. and was evaluated with independent samples t-test. Statistical significance was designated at P<0.05.

3 Results 6

3.1 Effects of PEE on the susceptibility of offspring to glomerulosclerosis In order to observe the effect of PEE on the susceptibility to glomerulosclerosis of the offspring, the control and PEE groups were fed with high-fat diet after weaning till PW24. In the results of HE staining (Fig. 1A and 1H), the high-fat diet control groups showed slight hyperplasia and fibrosis, while the kidneys in the PEE groups displayed severe glomerular hyperplasia and narrowing of Bowman's space in the glomerulus, accompanied by protein casts in the kidney tubules, and the pathological changes were similar in the male and female groups. The results of PAS staining (Fig. 1B and 1I) showed that the glomerular basement membrane was slightly thickened in the high-fat diet control groups, but the PEE groups exhibited obvious glomerular

ro of

basement membrane thickening, narrowing of Bowman's space and segmental glomerulosclerosis. The semi-quantitative analysis demonstrated that the GSI in male and female PEE groups were both significantly higher than that of the high-fat diet control groups (Fig. 1F and 1M, P<0.01). The result of Masson staining (Fig. 1C and 1J) presented that PEE groups showed more collagen deposition and severe renal interstitial fibrosis than the high-fat diet control groups. Accordingly,

-p

the semi-quantitative analysis indicated the increase of TIFI in both male and female PEE groups compared with their high-fat diet controls (Fig. 1G and 1N, P<0.01). As shown in Fig.1D and 1K,

re

the female and male PEE groups had a higher kidney/body weight ratio than the control groups (Fig. 1D and 1K, P<0.01). For the kidney function analysis, the serum Cr levels were significantly higher

lP

in the male and female PEE groups than the high-fat diet controls (Fig. 1E and 1L, P<0.01). The results suggested that PEE can increase the susceptibility of both male and female adult offspring to

Jo

ur

na

glomerulosclerosis under the second hit of high-fat diet feeding after weaning.

7

8

ro of

-p

re

lP

na

ur

Jo

Fig.1. Effects of prenatal ethanol exposure on renal histology and function in adult offspring. A/H: Kidney sections were stained with hematoxylin and eosin reagents (magnification: ×400). The arrow in b indicates the glomerular hyperplasia; the arrows in d show the protein casts in the kidney tubules. B/I: Kidney sections were stained with Periodic acid-Schiff’s reagents (magnification: ×400). The arrow in b indicates the narrowing of Bowman's space and segmental glomerulosclerosis. C/J: Kidney sections were stained with Masson’s trichrome-stained reagents (magnification: ×200). The arrow indicates the collagen deposition and renal interstitial fibrosis. D/K: Kidney weight/body weight ratio. n = 10. E/L: Serum creatinine (Scr) level. n = 8. F/M: Glomerulosclerotic index. n = 3. G/N: Tubulointerstitial fibrosis index. n = 3. Mean ± S.E.M. P

ro of

value was calculated by Student’s t-test. *P<0.05, **P<0.01 vs high-fat diet control.

3.2 Effects of PEE on the expression of podocyte and mesenchymal marker genes in offspring kidney

Nephrin and WT1 are the marker genes of podocytes, whereas desmin and α-SMA are the

-p

marker genes of mesenchymal cells (May, Saleem et al. 2014, Loeffler and Wolf 2015). In this study, the protein expression of Nephrin and WT1 in male and female PEE groups were both lower than

re

that in the high-fat diet controls (Fig. 2A and 2C, 2H and 2J, P<0.01), while the protein expression of desmin and α-SMA were up-regulated compared with the high-fat diet controls (Fig. 2B and 2D,

lP

2I and 2K, P<0.05or P<0.01), which suggested the phenomenon of podocyte EMT in both male and female adult offspring by PEE. β-catenin is a well-known promoting factor for podocyte EMT (Lv, Hu et al. 2013, Zhang, Wang et al. 2017). In this study, the mRNA expression of renal β-catenin

na

were up-regulated in both male and female PEE groups (Fig. 2E and 2L, P<0.01 or P<0.05), and the protein expressions of total and nucleus β-catenin were increased in both male and female PEE groups (Fig. 2F and 2G, 2M and 2N, P<0.01 or P<0.05). These results suggest that PEE might

Jo

ur

promote EMT of the podocyte in both male and female offspring rats by activating β-catenin.

9

10

ro of

-p

re

lP

na

ur

Jo

Fig. 2. Effects of prenatal ethanol exposure on the expression of podocyte and mesenchymal cell marker genes in offspring kideny. A/C, H/J: The protein expression of Nephrin and WT1. B/D, I/K: The protein expression of desmin and α-SMA. F/G, M/N: The protein expression of total β-catenin and nucleus β-catenin. The protein abundance was determined by western blotting analysis. n = 3. E/L: The mRNA expression of β-catenin was determined by RT-qPCR. n = 5-6. Each sample was pooled by 2 kidneys from 2 pregnant rats. Mean±S.E.M., P value was calculated by Independent Samples t-test. *P<0.05, **P<0.01 vs high-fat diet control.

3.3 Effect of PEE on the expression of ATRs in offspring kidney

ro of

To investigate the effect of PEE on the expression of ATRs in offspring kidneys, we examined the mRNA and protein expression of renal ATRs in different groups. In the male and female fetal PEE kidney, the mRNA expression of AT2R was both inhibited by PEE (Supplementary Fig.1A and 1B), this result was similar with the data we published before (Zhu, Zuo et al. 2018). In the male adult offspring kidney, the mRNA and protein expression of AT1R was up-regulated, while the

-p

expression of AT2R was down-regulated in the PEE group when compared with the high-fat diet control group (Fig. 3A-D, P < 0.01 or P<0.05). In contrast, in the female adult offspring kidney, the

re

mRNA expression of AT1R was decreased, and the protein expression of AT1R was comparable with the control group, but the mRNA and protein expression of AT2R was both increased in the

lP

PEE group when compared with the control (Fig. 3E-H, P<0.01 or P<0.05). These results indicated

Jo

ur

na

that the expression of ATRs showed gender difference in adult male and female PEE groups.

11

ro of -p re lP na ur Jo

Fig. 3. Effects of prenatal ethanol exposure on renal ATRs expression in adult offspring. A/E: The mRNA expression of AT1R. B/F: The mRNA expression of AT2R. mRNA expression was determined by RT-qPCR. n = 5-6. Each sample was pooled by 2 kidneys from 2 pregnant rats. C/D, G/H: The protein expression of AT1R, AT2R was determined by western blotting analysis. n = 3. Mean±S.E.M. P value was calculated by Independent Samples t-test. *P<0.05, **P<0.01 vs high-fat diet control. 12

3.4 Effect of PEE on the expression of GC-IGF1 axis in offspring kidney To determine whether GC-IGF1 axis programming is related to the susceptibility to glomerulosclerosis, we examined the expression of the GC-IGF1 axis in offspring kidneys. Our previous study indicated that the glucocorticoid activation system was activated and the IGF1 signaling pathway was inhibited in the female fetal kidneys by PEE (He, Xiong et al. 2019). Similar to this published data, we found that in the female fetal PEE group, the mRNA expression of glucocorticoid activation system was increased and IGF1 pathway was reduced (Supplementary Fig.1D). However, in the male fetal PEE group, the mRNA expression of glucocorticoid activation system or IGF1 pathway did not show regular change (Supplementary Fig.1C). For the adult

ro of

offspring kidney, as shown in Fig. 4, in the male offspring, the mRNA expression of 11βHSD2 and GR were up-regulated in the PEE group when compared with the high-fat diet control (Fig. 4B-C, P<0.01 or P<0.05), whereas the mRNA expression of 11βHSD1, IGF1 and IGF1R were down-regulated in the PEE group (Fig. 4A, D, E, P<0.01). Western blotting analysis also showed

-p

that the protein expression of renal GR was increased, but the expression of IGF1 and IGF1R were reduced in the male PEE group (Fig. 4F and 4G, P<0.01). However, in the female PEE group, the

re

mRNA expression of renal 11βHSD1 and GR were inhibited whereas the expression of 11βHSD2, IGF1 and IGF1R were up-regulated compared with the control (Fig. 4H-L, P<0.01 or P<0.05).

lP

Consistent with the change of mRNA, the protein expression of renal GR was also decreased (Fig. 4N, P<0.01) in the female PEE group, whereas the protein expression of IGF1 and IGF1R were increased (Fig. 4N, P<0.01). These results suggested that there is also a gender difference in the

na

changes of the GC-IGF1 axis in the adult offspring kidney in the PEE group, shown as the activation of glucocorticoid activation system and the inhibition of the IGF1 signaling pathway in the male PEE group; but the inhibition of glucocorticoid activation system and activation of the

Jo

ur

IGF1 signaling pathway in the female PEE group.

13

ro of -p re lP na

Fig. 4. Effects of prenatal ethanol exposure on GC-IGF1 axis expression in offspring kidney . A/H: The mRNA expression of 11β-HSD1. B/I: The mRNA expression of 11β-HSD2. C/J: The

ur

mRNA expression of GR. D/K: The mRNA expression of IGF1. E/L: The mRNA expression of IGF1R. mRNA expression was determined by RT-qPCR. n=5-6. Each sample was pooled by 2

Jo

kidneys from 2 pregnant rats. F/G, M/N: The protein expression of GR, IGF1 and IGF1R was determined by western blotting analysis. n = 3. Mean±S.E.M. P value was calculated by Independent Samples t-test. *P<0.05, **P<0.01 vs high-fat diet control.

4 Discussion 4.1 PEE increases the susceptibility of offspring to glomerulosclerosis under the high-fat diet feeding Glomerulosclerosis is a lesion of glomerular injury, clinically presented with massive 14

proteinuria and progressive deterioration of kidney function, and histopathologically characterised by segmental sclerosis involving glomeruli in a focal distribution, which is commonly accompanied with hyperplasia of the unaffected glomeruli, tubular atrophy and interstitial fibrosis (Abbate, Zoja et al. 2002). In this study, we examined the renal histology using HE, PAS and Masson staining. The results showed that the GSI and TIFI in the male and female PEE groups were both significantly higher than their high-fat diet controls. Blood Cr is a sensitive indicator of glomerular filtration. In the present study, male and female offspring rats in the PEE group both had higher blood Cr than the high-fat diet control. These results suggested that PEE increased the susceptibility of both male and female offspring to glomerular sclerosis under the high-fat diet feeding after weaning.

ro of

4.2 PEE caused podocytes EMT in offspring Podocyte is a terminally differentiated cell located at the outer layer of the glomerular basement membrane, and it plays an important role in maintaining the normal filtration function of the glomerulus (Greka and Mundel 2012). The podocyte EMT is an early event of its injury, mainly characterised by decreased expression of podocyte markers and increased expression of

-p

mesenchymal cell markers. The EMT of the podocytes promotes podocyte apoptosis and shedding, which is known as the onset of the development of glomerulosclerosis (Sakamoto, Ueno et al. 2014).

re

Nephrin and WT1 are important functional proteins of podocytes in the formation of slit membranes, while desmin and α-SMA are mesenchymal cell marker genes involved in mesangial cell

lP

proliferation. In our study, the protein expression of nephrin and WT1 in the male and female offspring PEE groups were both lower than that in the high-fat diet control groups, while the protein expression of desmin and α-SMA were up-regulated. These results suggested that PEE can cause

na

podocyte EMT in the male and female offspring rats. It is known that β-catenin is the main activator of podocyte EMT (Ghiggeri, Gigante et al. 2013). Our experimental results showed that the expression of β-catenin in male and female PEE offspring rats was both up-regulated. Based on β-catenin.

ur

these results, we suggested that PEE may induce podocyte EMT in adult offspring by activating

Jo

4.3 Low expressional programming of AT2R is involved in mediating susceptibility to glomerulosclerosis in male offspring The renin-angiotensin system (RAS) plays an important role in fetal kidney development and

renal function regulation in adulthood (Ao, Sun et al. 2015, Sun, Hu et al. 2015). AT2R is one of the Ang II receptors, which is highly expressed in the kidney during the embryonic period and promotes fetal kidney development by activating the developmental signaling pathways such as GDNF (Yosypiv 2009). After birth, although the expression is reduced, its activation still functions 15

as diastolic blood vessels, anti-inflammatory, balances with AT1R, and participates in maintaining renal function and local endocrine balance (Carey, Wang et al. 2000). Therefore, the abnormal expression of ATRs in adulthood can mediate the occurrence and development of glomerulosclerosis (Fanos, Puddu et al. 2010, Ma, Ni et al. 2013). Consistent with our previous study (Zhu, Zuo et al. 2018), we found that PEE could reduce the expression of renal AT2R in the male fetus, which might be involved in the renal development toxicity caused by PEE. In this study, we also showed that the gene and protein expression of AT2R was inhibited in the male adult offspring in the PEE group under the second hit of high-fat diet feeding after weaning. These results suggested that the low expression of renal AT2R was sustained

ro of

from fetus to adulthood in the male PEE group. Since renal AT2R plays an important role in the kidney development in fetus and protection of renal function in adulthood, we suspected that the low expressional programming was involved in the susceptibility of male offspring rats to glomerulosclerosis caused by PEE and the high-fat feeding after weaning.

However, in the female group, although PEE inhibited the expression of AT2R in the fetal

-p

kidney, the expression of renal AT2R in female adult offspring was increased in the PEE group under high-fat diet feeding. This result indicated that there was no low expressional programming

re

of AT2R in the female offspring. And we suggested that the increase of renal AT2R in the female adult offspring might be a compensatory response to the second hit of high-fat diet feeding.

lP

4.4 GC-IGF1 axis programming is involved in mediating susceptibility of female offspring to glomerulosclerosis

The activity of glucocorticoids is mainly regulated by 11β-hydroxysteroid dehydrogenases

na

(11β-HSDs), among which 11β-HSD1 and 11β-HSD2 play opposite roles. Glucocorticoids regulate the expression of downstream genes by binding to GR and CCAAT/enhancer-binding protein (C/EBP) in target tissues (Nerlov 2008). We refer to 11β-HSD/GR/C/EBP as the glucocorticoid

ur

activation system (Fewtrell, Morley et al. 2001, Gluckman and Hanson 2004). It has been confirmed that all the components of the glucocorticoid activation system were expressed in rat

Jo

kidney and involved in the regulation of renal development (Todd-Turla, Schnermann et al. 1993, McNeil, Nwagwu et al. 2007). It is known that the IGF1 signaling pathway is the core of the endocrine regulation system, and participates in the processes of proliferation, differentiation and metabolism in the pre- and post-natal period of multi-organ organs (Rogers, Ryan et al. 1991, Hammerman, Ryan et al. 1992, Inder, Jang et al. 2010). IGF1 is a downstream target gene of glucocorticoids, which negatively regulate the expression of IGF1 in tissues (Hyatt, Budge et al. 2007, Inder, Jang et al. 2010). Our group had previously found that (Shen, Liu et al. 2014, Xia, 16

Shen et al. 2014, Huang, He et al. 2015), PEE causes overexposure of the fetus to high level of maternal glucocorticoids, which might activate local glucocorticoid activation system and in turn inhibit the expression of IGF1 signaling pathway, and causes development retardation of the organs. After birth, the glucocorticoid level in the offspring was low due to the low basal activity of hypothalamic–pituitary–adrenal (HPA) axis, and thus the local glucocorticoid activation system is inhibited whereas the IGF1 pathway is activated, resulting in catch-up growth of the organ. We refer to this inverse change of GC-IGF1 axis before and after birth as GC-IGF1 axis programming. And we speculate that it may be involved in organ dysplasia and susceptibility to metabolic disease in adulthood due to adverse environmental conditions during pregnancy.

ro of

Our previous research had indicated that in the female fetal kidney, the expression of glucocorticoid activation system was activated, and the IGF1 signaling pathway was inhibited, which might be involved in mediating renal dysplasia caused by PEE (He, Xiong et al. 2019). In this study, we found that, in the female adult offspring kidney, the expression of the renal glucocorticoid activation system was inhibited, whereas the IGF1 pathway was up-regulated in the

-p

PEE group under the high-fat diet feeding. These results indicated that there was a reverse programming phenomenon in the expression of the GC-IGF1 pathway in the female offspring

re

kidney. Recent research demonstrated that (Lee, Ju et al. 2012, Sastre-Perona and Santisteban 2014) IGF1 increases β-catenin levels by activating the phosphatidylinositol 3-kinase (PI3K)/Akt pathway.

lP

Our study also found that the expression of IGF1 and β-catenin was up-regulated in female PEE rats. Based on this, we hypothesise that GC-IGF1 axis programming was involved in the susceptibility of female offspring to glomerulosclerosis. The activation of the glucocorticoid activation system and

na

inhibition of the IGF1 pathway during embryogenesis were involved in mediating fetal kidney dysplasia, whereas the inhibition of the renal glucocorticoid activation system and the activation of the IGF1 pathway after birth might promote podocyte EMT by activating β-catenin, and was

ur

involved in mediating the susceptibility to glomerulosclerosis under the high-fat diet feeding. However, in the male PEE group, the expression of glucocorticoid activation system and IGF1

Jo

pathway did not show regular change before or after birth. Therefore, we hypothesize that the toxicological mechanism of PEE to male offspring may not be related to GC-IGF1 axis programming.

4.5 Gender differences on the mechanism of the increased susceptibility to glomerulosclerosis In this study, our results interestingly showed that although PEE increased the susceptibility to glomerulosclerosis of both the male and female offspring, the mechanism was different among different genders. The low expressional programming of AT2R was involved in toxic effect of PEE 17

on the male offspring, whereas GC-IGF1 axis programming was related to the toxicity to female offspring kidney. The reason for these gender differences is still unclear, we speculate that the sex hormones might be contributed to the gender differences, but this speculation still needs further study. 4.6 The ethanol exposure dose is reasonable Exposure to ethanol during pregnancy increases the risk of IUGR. According to the survey, the average blood alcohol concentration measured after drinking 3-5 bottles of alcoholic beverages was 33 mM (Gohlke, Griffith et al. 2005). The concentration then fluctuates from 20 mM to 170 mM depending on the actual amount of alcohol consumed (Pantazis, Dohrman et al. 1992). In the

ro of

present study, we administered 4g/kg·d ethanol to pregnant rats, and the alcohol concentrations was 87 mM in the maternal blood (Shen, Liu et al. 2014). According to the body weight and the human-to-rat (human: rats=1:6.17) dose conversion relationship (Reagan-Shaw, Nihal et al. 2008), the dose of ethanol exposure (4 g/kg·d) in pregnant rats in our study is equivalent to ethanol exposure of 0.65 g/ kg·d in a pregnant woman (Zhu, Zuo et al. 2018). What’s more, Willhite had

-p

reported that (Willhite, Hendrickx et al. 1988), the mean ethanol dose of a pregnant human that was associated with fetal alcohol syndrome (FAS) is 2.2g/kg·d, that is much greater than our dose (0.65

re

g/kg·d). Therefore, the ethanol dose used in this study has practical significance for humans. 5 Conclusion

lP

In summary, as shown in Fig. 5, this study demonstrates that PEE stimulated podocyte EMT and increased the susceptibility of offspring to glomerulosclerosis under high-fat diet feeding after weaning. However, there is a gender difference in the mechanism. To the male offspring, PEE

na

caused low-function programming of kidney AT2R, which led to EMT in podocytes and promoted the progression of glomerulosclerosis. To the female offspring, PEE caused GC-IGF1 axis programming of the kidney, which activated the β-catenin-mediated EMT of the podocytes and led

ur

to the development of glomerulosclerosis. Therefore, we speculated that AT2R and IGF1 could be used as potential therapeutic targets in male and female offspring, respectively, for the treatment of

Jo

glomerulosclerosis caused by PEE. This study provides a certain experimental and theoretical basis for elucidating the mechanism of the renal developmental toxicity of PEE.

18

ro of

Fig. 5. The proposed mechanism of susceptibility to glomerulosclerosis induced by prenatal ethanol exposure under high-fat diet feeding after weaning. AT2R: angiotensin II type 2

-p

receptor; IGF1: insulin-like growth factor 1.

Conflict of interest

re

The authors declare that there are no conflicts of interest.

lP

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (Nos. 81430089, 81872943), Hubei Province Health and Family Planning Scientific Research

References

ur

(No. 2017CFB649).

na

Project (Nos. WJ2017M002, WJ2017C0003) and Natural Science Foundation of Hubei Province

Jo

Abbate, M., C. Zoja, M. Morigi, D. Rottoli, S. Angioletti, S. Tomasoni, C. Zanchi, L. Longaretti, R. Donadelli and G. Remuzzi (2002). "Transforming growth factor-beta1 is up-regulated by podocytes in response to excess intraglomerular passage of proteins: a central pathway in progressive glomerulosclerosis." Am J Pathol 161(6): 2179-2193. Ao, Y., Z. Sun, S. Hu, N. Zuo, B. Li, S. Yang, L. Xia, Y. Wu, L. Wang, Z. He and H. Wang (2015). "Low functional programming of renal AT2R mediates the developmental origin of glomerulosclerosis in adult offspring induced by prenatal caffeine exposure." Toxicol Appl Pharmacol 287(2): 128-138. Brenner, B. M., D. L. Garcia and S. Anderson (1988). "Glomeruli and blood pressure. Less of one, more the other?" Am J Hypertens 1(4 Pt 1): 335-347. Carey, R. M., Z. Q. Wang and H. M. Siragy (2000). "Role of the angiotensin type 2 receptor in the regulation of blood pressure and renal function." Hypertension 35(1 Pt 2): 155-163. 19

Jo

ur

na

lP

re

-p

ro of

Fanos, V., M. Puddu, A. Reali, A. Atzei and M. Zaffanello (2010). "Perinatal nutrient restriction reduces nephron endowment increasing renal morbidity in adulthood: a review." Early Hum Dev 86 Suppl 1: 37-42. Fewtrell, M. S., R. Morley, R. A. Abbott, A. Singhal, T. Stephenson, U. M. MacFadyen, H. Clements and A. Lucas (2001). "Catch-up growth in small-for-gestational-age term infants: a randomized trial." Am J Clin Nutr 74(4): 516-523. Fowden, A. L., J. Li and A. J. Forhead (1998). "Glucocorticoids and the preparation for life after birth: are there long-term consequences of the life insurance?" Proc Nutr Soc 57(1): 113-122. Ghiggeri, G. M., M. Gigante and A. Di Donato (2013). "Constitutional Nephrin Deficiency in Conditionally Immortalized Human Podocytes Induced Epithelial-Mesenchymal Transition, Supported by beta-Catenin/NF-kappa B Activation: A Consequence of Cell Junction Impairment?" Int J Nephrol 2013: 457490. Gluckman, P. D. and M. A. Hanson (2004). "Living with the past: evolution, development, and patterns of disease." Science 305(5691): 1733-1736. Gohlke, J. M., W. C. Griffith and E. M. Faustman (2005). "A systems-based computational model for dose-response comparisons of two mode of action hypotheses for ethanol-induced neurodevelopmental toxicity." Toxicol Sci 86(2): 470-484. Greka, A. and P. Mundel (2012). "Cell biology and pathology of podocytes." Annu Rev Physiol 74: 299-323. Guo, J., N. Xia, L. Yang, S. Zhou, Q. Zhang, Y. Qiao and Z. Liu (2014). "GSK-3beta and vitamin D receptor are involved in beta-catenin and snail signaling in high glucose-induced epithelial-mesenchymal transition of mouse podocytes." Cell Physiol Biochem 33(4): 1087-1096. Hammerman, M. R., G. Ryan and S. B. Miller (1992). "Expression of insulin-like growth factor in adult and embryonic kidney." Miner Electrolyte Metab 18(2-5): 253-255. He, H., Y. Xiong, B. Li, Y. Zhu, H. Chen, Y. Ao and H. Wang (2019). "Intrauterine programming of the glucocorticoid-insulin-like growth factor 1 (GC-IGF1) axis mediates glomerulosclerosis in female adult offspring rats induced by prenatal ethanol exposure." Toxicol Lett 311: 17-26. Huang, H., Z. He, C. Zhu, L. Liu, H. Kou, L. Shen and H. Wang (2015). "Prenatal ethanol exposure-induced adrenal developmental abnormality of male offspring rats and its possible intrauterine programming mechanisms." Toxicol Appl Pharmacol 288(1): 84-94. Hyatt, M. A., H. Budge, D. Walker, T. Stephenson and M. E. Symonds (2007). "Ontogeny and nutritional programming of the hepatic growth hormone-insulin-like growth factor-prolactin axis in the sheep." Endocrinology 148(10): 4754-4760. Inder, W. J., C. Jang, V. R. Obeyesekere and F. P. Alford (2010). "Dexamethasone administration inhibits skeletal muscle expression of the androgen receptor and IGF-1--implications for steroid-induced myopathy." Clin Endocrinol (Oxf) 73(1): 126-132. Lee, J., J. Ju, S. Park, S. J. Hong and S. Yoon (2012). "Inhibition of IGF-1 signaling by genistein: modulation of E-cadherin expression and downregulation of beta-catenin signaling in hormone refractory PC-3 prostate cancer cells." Nutr Cancer 64(1): 153-162. Loeffler, I. and G. Wolf (2015). "Epithelial-to-Mesenchymal Transition in Diabetic Nephropathy: Fact or Fiction?" Cells 4(4): 631-652. Lv, Z., M. Hu, J. Zhen, J. Lin, Q. Wang and R. Wang (2013). "Rac1/PAK1 signaling promotes epithelial-mesenchymal transition of podocytes in vitro via triggering beta-catenin transcriptional activity under high glucose conditions." Int J Biochem Cell Biol 45(2): 255-264. Ma, K. L., J. Ni, C. X. Wang, J. Liu, Y. Zhang, Y. Wu, L. L. Lv, X. Z. Ruan and B. C. Liu (2013). "Interaction of RAS activation and lipid disorders accelerates the progression of glomerulosclerosis." Int J Med Sci 10(12): 1615-1624. 20

Jo

ur

na

lP

re

-p

ro of

Magner, N. L., Y. Jung, J. Wu, J. A. Nolta, M. A. Zern and P. Zhou (2013). "Insulin and IGFs enhance hepatocyte differentiation from human embryonic stem cells via the PI3K/AKT pathway." Stem Cells 31(10): 2095-2103. May, C. J., M. Saleem and G. I. Welsh (2014). "Podocyte dedifferentiation: a specialized process for a specialized cell." Front Endocrinol (Lausanne) 5: 148. McNeil, C. J., M. O. Nwagwu, A. M. Finch, K. R. Page, A. Thain, H. J. McArdle and C. J. Ashworth (2007). "Glucocorticoid exposure and tissue gene expression of 11beta HSD-1, 11beta HSD-2, and glucocorticoid receptor in a porcine model of differential fetal growth." Reproduction 133(3): 653-661. Medici, D., E. D. Hay and D. A. Goodenough (2006). "Cooperation between snail and LEF-1 transcription factors is essential for TGF-beta1-induced epithelial-mesenchymal transition." Mol Biol Cell 17(4): 1871-1879. Nagata, M. (2016). "Podocyte injury and its consequences." Kidney Int 89(6): 1221-1230. Nerlov, C. (2008). "C/EBPs: recipients of extracellular signals through proteome modulation." Curr Opin Cell Biol 20(2): 180-185. Ni, Q., L. Wang, Y. Wu, L. Shen, J. Qin, Y. Liu, J. Magdalou, L. Chen and H. Wang (2015). "Prenatal ethanol exposure induces the osteoarthritis-like phenotype in female adult offspring rats with a post-weaning high-fat diet and its intrauterine programming mechanisms of cholesterol metabolism." Toxicol Lett 238(2): 117-125. Pantazis, N. J., D. P. Dohrman, J. Luo, C. R. Goodlett and J. R. West (1992). "Alcohol reduces the number of pheochromocytoma (PC12) cells in culture." Alcohol 9(3): 171-180. Piecewicz, S. M., A. Pandey, B. Roy, S. H. Xiang, B. R. Zetter and S. Sengupta (2012). "Insulin-like growth factors promote vasculogenesis in embryonic stem cells." PLoS One 7(2): e32191. Puri, G., K. Kumar, R. Singh, R. K. Singh, T. Yasotha, R. Ranjan, M. Kumar, B. C. Das, G. Singh, M. Sarkar and S. Bag (2012). "Effects of Growth Factors on Establishment and Propagation of Embryonic Stem Cells from Very Early Stage IVF Embryos and Their Characterization in Buffalo." Int J Stem Cells 5(2): 96-103. Reagan-Shaw, S., M. Nihal and N. Ahmad (2008). "Dose translation from animal to human studies revisited." FASEB J 22(3): 659-661. Rogers, S. A., G. Ryan and M. R. Hammerman (1991). "Insulin-like growth factors I and II are produced in the metanephros and are required for growth and development in vitro." J Cell Biol 113(6): 1447-1453. Sakamoto, K., T. Ueno, N. Kobayashi, S. Hara, Y. Takashima, I. Pastan, T. Matsusaka and M. Nagata (2014). "The direction and role of phenotypic transition between podocytes and parietal epithelial cells in focal segmental glomerulosclerosis." Am J Physiol Renal Physiol 306(1): F98-F104. Sastre-Perona, A. and P. Santisteban (2014). "Wnt-independent role of beta-catenin in thyroid cell proliferation and differentiation." Mol Endocrinol 28(5): 681-695. Sethi, S., R. J. Glassock and F. C. Fervenza (2015). "Focal segmental glomerulosclerosis: towards a better understanding for the practicing nephrologist." Nephrol Dial Transplant 30(3): 375-384. Shangguan, Y., H. Jiang, Z. Pan, H. Xiao, Y. Tan, K. Tie, J. Qin, Y. Deng, L. Chen and H. Wang (2017). "Glucocorticoid mediates prenatal caffeine exposure-induced endochondral ossification retardation and its molecular mechanism in female fetal rats." Cell Death Dis 8(10): e3157. Shangguan, Y., Y. Wen, Y. Tan, J. Qin, H. Jiang, J. Magdalou, L. Chen and H. Wang (2018). "Intrauterine Programming of Glucocorticoid-Insulin-Like Growth Factor-1 Axis-Mediated Developmental Origin of Osteoporosis Susceptibility in Female Offspring Rats of Prenatal Caffeine Exposure." Am J Pathol. 21

Jo

ur

na

lP

re

-p

ro of

Shankland, S. J. (2006). "The podocyte's response to injury: role in proteinuria and glomerulosclerosis." Kidney Int 69(12): 2131-2147. Shen, L., Z. Liu, J. Gong, L. Zhang, L. Wang, J. Magdalou, L. Chen and H. Wang (2014). "Prenatal ethanol exposure programs an increased susceptibility of non-alcoholic fatty liver disease in female adult offspring rats." Toxicol Appl Pharmacol 274(2): 263-273. Sun, Z., S. Hu, N. Zuo, S. Yang, Z. He, Y. Ao and H. Wang (2015). "Prenatal nicotine exposure induced GDNF/c-Ret pathway repression-related fetal renal dysplasia and adult glomerulosclerosis in male offspring." Toxicology Research 4(4): 1045-1058. Tan, Y., K. Lu, Y. Deng, H. Cao, B. Chen, H. Wang, J. Magdalou and L. Chen (2012). "The effects of levofloxacin on rabbit fibroblast-like synoviocytes in vitro." Toxicol Appl Pharmacol 265(2): 175-180. Todd-Turla, K. M., J. Schnermann, G. Fejes-Toth, A. Naray-Fejes-Toth, A. Smart, P. D. Killen and J. P. Briggs (1993). "Distribution of mineralocorticoid and glucocorticoid receptor mRNA along the nephron." Am J Physiol 264(5 Pt 2): F781-791. Willhite, C. C., A. G. Hendrickx, D. T. Burk and S. A. Book (1988). "Warnings and the hazards of drinking alcoholic beverages during pregnancy." Teratology 37(6): 609-611. Xia, L. P., L. Shen, H. Kou, B. J. Zhang, L. Zhang, Y. Wu, X. J. Li, J. Xiong, Y. Yu and H. Wang (2014). "Prenatal ethanol exposure enhances the susceptibility to metabolic syndrome in offspring rats by HPA axis-associated neuroendocrine metabolic programming." Toxicol Lett 226(1): 98-105. Xu, D., S. Huang, H. Wang and W. Xie (2018). "Regulation of brain drug metabolizing enzymes and transporters by nuclear receptors." Drug Metab Rev 50(4): 407-414. Xu, D., G. Liang, Y. E. Yan, W. W. He, Y. S. Liu, L. B. Chen, J. Magdalou and H. Wang (2012). "Nicotine-induced over-exposure to maternal glucocorticoid and activated glucocorticoid metabolism causes hypothalamic-pituitary-adrenal axis-associated neuroendocrine metabolic alterations in fetal rats." Toxicol Lett 209(3): 282-290. Yosypiv, I. V. (2009). "Renin-angiotensin system-growth factor cross-talk: a novel mechanism for ureteric bud morphogenesis." Pediatr Nephrol 24(6): 1113-1120. Zhang, J. T., Y. Wang, J. J. Chen, X. H. Zhang, J. D. Dong, L. L. Tsang, X. R. Huang, Z. Cai, H. Y. Lan, X. H. Jiang and H. C. Chan (2017). "Defective CFTR leads to aberrant beta-catenin activation and kidney fibrosis." Sci Rep 7(1): 5233. Zhu, Y., N. Zuo, B. Li, Y. Xiong, H. Chen, H. He, Z. Sun, S. Hu, H. Cheng, Y. Ao and H. Wang (2018). "The expressional disorder of the renal RAS mediates nephrotic syndrome of male rat offspring induced by prenatal ethanol exposure." Toxicology 400-401: 9-19. Zimatkin, S. M., S. P. Pronko, V. Vasiliou, F. J. Gonzalez and R. A. Deitrich (2006). "Enzymatic mechanisms of ethanol oxidation in the brain." Alcohol Clin Exp Res 30(9): 1500-1505.

22

Genes

ID

Forward primer(5′-3′）

Reverse primer（5′-3′）

GR AT1R

24413 CACCCATGACCCTGTCAGTG 24180 TCTCAGCTCTGCCACATTCCCTG

AAAGCCTCCCTCTGCTAACC TGGTGATCACTTTCTGGGAGGGTT

AT2R

24182 CTTCCATGTTCTGACCTTCTT

CGGTTTCCAACGAAACAATAC

64563 GAGAGGAGTCTAGGAAGATAGG TTACTGGCAGCTTGGATTG CACCTGTGTGTCTCCTTTG 24883 GTACCCAGGCTGCAATAAG

Desmin

64362 GAGATGATGGAATACCGACAC

CGCGATGTTGTCCTGATAG

IGF-1

24482 GACCAAGGGGCTTTTACTTCAC

TTTGTAGGCTTCAGCGGAGCAC

IGF1R

25718 GTCCTTCGGGATGGTCTA

TGGCCTTGGGATACTACAC

11βHSD1

25116 GAAGAAGCATGGAGGTCAAC

GCAATCAGAGGTTGGGTCAT

11βHSD2 GAPDH

25117 AGGGGACGTATTGTGACCG 24383 CTCCCATTCTTCCACCTTTG

GCTGGATGATGCTGACCTTG TGGTCCAGGGTTTCTTACT

-p

ro of

Nephrin WT1

Pr Ann oduct ealing (bp) (℃) 15 60 6 60 1 57 60 159 14 60 9 60 16 1 14 60 7 14 60 8 19 60 5 13 60 3 76 60 15 60 6

Table 1. Oligonucleotide primers and PCR conditions of rat in real-time quantitative PCR

re

WT1, Wilms’tumor 1; AT1R, Angiotensin Ⅱ Type 1 Receptor; AT2R, Angiotensin Ⅱ Type 2 Receptor; 11β-HSD1: 11β-hydroxysteroid dehydrogenase 1; 11β-HSD2: 11β-hydroxysteroid

lP

dehydrogenase 2; GR: Glucocorticoid receptor; IGF1: insulin-like growth factor 1; IGF1R: IGF1

Jo

ur

na

receptor; GAPDH, glyceraldehyde phosphate dehydrogenase.

23