- Email: [email protected]
Prenatal stress induces vulnerability to stress together with the disruption of central serotonin neurons in mice
Accepted Manuscript Title: Prenatal stress induces vulnerability to stress together with the disruption of central serotonin neurons in mice Author: Kazuya Miyagawa Minoru Tsuji Daisuke Ishii Kotaro Takeda Hiroshi Takeda PII: DOI: Reference:
S0166-4328(14)00288-5 http://dx.doi.org/doi:10.1016/j.bbr.2014.04.052 BBR 8887
To appear in:
Behavioural Brain Research
Received date: Revised date: Accepted date:
29-1-2014 27-3-2014 11-4-2014
Please cite this article as: Miyagawa K, Tsuji M, Ishii D, Takeda K, Takeda H, Prenatal stress induces vulnerability to stress together with the disruption of central serotonin neurons in mice, Behavioural Brain Research (2014), http://dx.doi.org/10.1016/j.bbr.2014.04.052 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title: Prenatal stress induces vulnerability to stress together with the disruption of central serotonin neurons in
ip t
mice Running Title:
cr
Prenatal stress induce vulnerability to stress Authors:
us
Kazuya Miyagawa, Minoru Tsuji, Daisuke Ishii, Kotaro Takeda and Hiroshi Takeda Affiliation:
an
Department of Pharmacology, School of Pharmacy, International University of Health and Welfare Keywords:
M
Prenatal stress, Stress adaptation, Serotonin, Lmx1b, Hole-board test
Address and e-mail address to which correspondence and proofs should be sent
d
Dr. Kazuya Miyagawa
Department of Pharmacology, School of Pharmacy, International University of Health and Welfare Tel: +81-287-24-3216
Ac ce p
Fax: +81-287-24-3521
te
2600-1 Kitakanamaru, Ohtawara, Tochigi 324-8501, Japan
E-mail: [email protected]
Page 1 of 27
【Abstract】 A growing body of evidence suggests that prenatal stress increases the vulnerability to neuropsychiatric disorders. On the other hand, the ability to adapt to stress is an important defensive
ip t
function of a living body, and disturbance of this stress adaptability may be related, at least in part, to the pathophysiology of stress-related psychiatric disorders. The aim of the present study was to clarify the relationship between exposure to prenatal stress and the ability to adapt to stress in mice. Naive
cr
and prenatally stressed mice were exposed to repeated restraint stress for 60 min/day for 7 days. After the final exposure to restraint stress, the emotionality of mice was evaluated in terms of exploratory
us
activity, i.e., total distance moved as well as the number and duration of rearing and head-dipping behaviors, using an automatic hole-board apparatus. A single exposure to restraint stress for 60 min This acute emotional stress
an
induced a decrease in head-dipping behavior in the hole-board test.
response disappeared in naive mice that had been exposed to repeated restraint stress for 60 min/day for 7 days, which confirmed the development of stress adaptation. In contrast, prenatally stressed mice
M
did not develop this stress adaptation, and still showed a decrease in head-dipping behavior after the repeated exposure to restraint stress. Biochemical studies showed that the rate-limiting enzyme in 5-HT synthesis, tryptophan hydroxylase, was increased in raphe obtained from stress-adapted mice.
d
contrast, a decrease in tryptophan hydroxylase was observed in stress-maladaptive mice.
In
In addition,
the transcription factor Lmx1b, which is essential for differentiation and the maintenance of normal
te
functions in central 5-HT neurons, was decreased in the embryonic hindbrain and adult raphe of prenatally stressed mice. These findings suggest that exposure to excessive prenatal stress may induce
Ac ce p
a vulnerability to stress and disrupt the development of 5-HT neurons. Keywords; 5-HT, Prenatal stress, Stress adaptation, Serotonin, Lmx1b, hole-board test
Page 2 of 27
1. Introduction Depression and anxiety disorders are common public health problems with a lifetime prevalence of 10 to 20%, yet the mechanisms that underlie their pathophysiology are still poorly understood. Most such as hormonal systems may dramatically change during pregnancy.
ip t
pregnant women are at risk of showing some emotional abnormality, since some biological functions Indeed, it has been reported
that 16% of women experience the onset of an affective disorder during pregnancy, and 68% of them
cr
showed symptoms during the first trimester [1]. Thus, a suitable management plan that includes drug therapy may be necessary for pregnant women. However, doctors hesitate to use positive drug therapies
us
because of worries regarding adverse effects on the embryo. Inappropriate mental support for pregnant women may result in their exposure to very stressful situations. Particularly when pregnant women
an
suffer from serious mental disease, inappropriate drug therapies could expose them to very severe stressful situations. Previous clinical research on pregnant women suffering depressive disorders indicated that the activity of the fetus and newborn is elevated, prenatal growth is delayed, and
M
prematurity and low birthweight are more frequent [2]. Moreover, it has also been suggested that exposure to stress during gestation may impair the emotional development of the offspring and, as a result, the incidence of several neuropsychiatric disorders, including depression, anxiety, schizophrenia,
d
and autism, may increase [3-5]. Additionally, preclinical studies have suggested that offspring exposed to prenatal stress show abnormal psychiatric behaviors such as increased fear and anxiety [6,7],
te
persistent paradoxical sleep alterations [8], deficits of learning and memory [9-10], depressive-like behavior [11-13] and schizophrenia-like behavior [14]. Moreover, prenatal stress induces several
Ac ce p
functional and structural abnormalities of the components that regulate stress responses, such as the hypothalamic-pituitary-adrenal (HPA)-axis [15,16] and monoamine neurotransmission [17-19]. However, the mechanisms that underlie the impact of prenatal stress on adulthood are not yet fully understood.
Axons from the neurons of the raphe nuclei, the principal source of serotonin (5-hydroxytryptamine; 5-HT) released in the brain, form a neurotransmitter system that reaches almost every part of the central nervous system. Based on clinical and preclinical studies, it has been widely accepted that central 5-HT neurotransmission may be involved in the aetiology, expression and treatment of anxiety, impulsiveness and depression [20,21]. A few preclinical reports have suggested that prenatal stress could affect central 5-HT neurons. Peters et al. reported that maternal stress increased fetal brain 5-HT synthesis in rat. They also found that offspring that had been exposed to prenatal stress showed region-specific changes in brain 5-HT, 5-hydroxyindoleacetic acid (5-HIAA) and noradrenaline levels in infancy [17]. Hayashi et al. reported that maternal stress induced synaptic loss associated with the disruption of 5-HT
Page 3 of 27
neurotransmission and developmental disabilities in offspring [22]. In addition to these precedent articles, we recently reported that offspring that had been exposed to strong prenatal stress displayed an increase in anxiety-like behavior as determined by the elevated plus-maze test together with disruption
ip t
of the development of 5-HT neurons in mice [23].
On the other hand, the ability to adapt to stress is an important defensive function of a living body, and impairment of this ability may contribute to some stress-related disorders. Thus, the identification of strategies for stress-related psychiatric disorders.
cr
brain mechanisms that contribute to stress adaptation could help pave the way for new therapeutic A series of behavioral experiments have
us
demonstrated that repeated exposure to the same type of stress stimuli diminishes acute stress responses. For example, Kennett and co-workers reported that male rats that had been exposed to a single restraint stress for 120 min exhibited a reduction in locomotor activity in an open field, but this change in
an
behavior disappeared after repeated exposure to restraint stress for 120 min/day for 7 days [24-26]. Similar behavioral adaptive responses to stress stimuli in rats have been confirmed by other researchers
M
[27-29], which suggests that this animal model may be useful for investigating the mechanisms of stress adaptation. Furthermore, we examined behavioral responses in rats that were produced by either single or repeated exposure to restraint stress for 60 or 120 min.
A single exposure to restraint stress
d
reduced locomotor activity, and this stress response disappeared in rats that were exposed to repeated restraint stress for 60 min/day for 7 days, which confirmed the development of stress adaptation.
te
However, this adaptive response to stress stimuli was not observed in rats that had been exposed to restraint stress for 240 min/day for 7 days. Thus, we can create stress-adaptive and -maladaptive
Ac ce p
models by repeatedly exposing rats to different degrees of restraint stress [30]. In addition, more recently, to further characterize models of stress adaptation, we created stress-adaptive and -maladaptive models in mice, as described below [31]. A single exposure to restraint stress for 60 min produced a decrease in the number and duration of head-dipping behaviors of mice in the hole-board test, and these acute emotional responses were recovered by exposure to repeated restraint stress for 60 min/day for 7 or 14 days, but not 3 days. However, mice that had been exposed to repeated restraint stress for 240 min/day for 7 or 14 days continued to show a decrease in head-dipping behavior in the hole-board test. Furthermore, the results obtained in our previous studies suggest that the brain 5-HT nervous system may be involved, at least in part, in the development of adaptation to stress [32-34]. The aim of the present study was to clarify the influence of exposure to prenatal stress on the development of stress adaptation and central 5-HT neurons.
Page 4 of 27
2. Materials and Methods The present studies were conducted in accordance with the Guide for the Care and Use of Laboratory Animals as adopted by the Committee on the Care and Use of Laboratory Animals of the International
ip t
University Health and Welfare.
2.1. Animals
cr
All experiments were performed using 8-week-old male offspring of ICR mice (Japan SLC, Inc., Shizuoka, Japan) that had been prenatally exposed to stress as described below, or naive mice. The mice
us
were housed at a room temperature of 23 ± 1 °C and humidity of 50 ± 5 % with a 12 h light-dark cycle
an
(light on 7:00 a.m. to 7:00 p.m.). Food and water were available ad libitum.
2.2. Experimental procedure 2.2.1. Exposure to prenatal stress
M
Virgin female mice were mated at 10-11 weeks of age. The presence of a copulation plug denoted gestation day (GD) 0.5. Pregnant females were housed individually. In the model mice exposed to prenatal restraint stress (PRS), the pregnant mice were placed in a 50 (for mice with a body weight of 40
d
g or less)- or 70 (for mice with a body weight of 40 g or more)-ml polystyrene tube at 6 h (10:00 a.m. to 4:00 p.m.) a day from GD 5.5 to GD 17.5. The conditions of exposure to restraint stress to pregnant
Ac ce p
te
mice were determined in accordance with our previous study [23].
2.2.2. Effects of exposure to acute restraint stress on the emotionality of mice as estimated by the hole-board test
8 week-old naive or prenatally stressed mice were exposed to single restraint stress for 60 min by being inserted into a syringe (50 mL) or left in their home cage in adulthood. Just after the exposure to restraint stress, the emotionality of mice was estimated by the hole-board test [35,36]. Namely, each mouse was placed in the center of the hole-board and allowed to freely explore the apparatus for 5 min. The exploratory behaviors of mice on the hole-board, i.e., distance moved, the number and duration of rearing, and the number and duration of head-dips, were automatically recorded.
2.2.3. Effects of exposure to repeated restraint stress on the emotionality of mice as estimated by the hole-board test
Page 5 of 27
8 week-old naive or prenatally stressed mice were exposed to restraint stress for 60 min/day for 7 days. Just after the exposure to final restraint stress, the emotionality of mice was estimated by the hole-board test. At the end of the experiments, the brain samples for western blotting or immunohistochemistry
ip t
were collected.
2.3. Apparatus for the hole-board test
cr
To investigate the changes in general emotional behaviors, mice were tested using an automatic hole-board apparatus (model ST-1; Muromachi Kikai Co., Ltd, Tokyo, Japan). The apparatus (model
us
ST-1; Muromachi Kikai Co., Ltd, Tokyo, Japan) consisted of a gray wooden box (50 x 50 x 50 cm) with four equidistant holes 3 cm in diameter in the floor [35,36]. An infrared beam sensor was installed on the wall to detect the number and duration of rearing and head-dipping behaviors and the latency to the
an
first head-dipping. Other behavioral parameters such as locus, distance and speed of movement of mice in the hole-board were recorded by an overhead digital video camera; the heads of the mice were
M
painted yellow and the digital video camera followed their center of gravity. Data from the digital video camera were collected through a custom-designed interface (DV-Track; Muromachi Kikai) as a reflection signal. Head-dipping behaviors were double-checked via both an infrared beam sensor and
d
the overhead digital video camera. Thus, head-dipping behavior was counted only when both the head intercepted the infrared beam and the head was detected at the hole by the digital video camera. All of
Ac ce p
Muromachi Kikai).
te
the data were analyzed and stored in a personal computer using analytical software (Comp ACT HBS;
2.4. Western blotting
The midbrain, containing raphe, was quickly removed and homogenized in 6 volumes of ice-cold buffer. The midbrain was removed within 10 min from decapitation and stored at -70 °C for future analysis. The midbrain was homogenized in 6 volumes of ice-cold buffer containing 20 mM Tris-HCl (pH 7.4; Wako Pure Chemical Industries, Ltd, Osaka, Japan), 2 mM ethylenediaminetetraacetic acid (EDTA; Wako Pure Chemical), 10 mM ethylene glycol-bis (2-aminoethylether)-N,N,N’,N’,-tetraacetic acid (EGTA; Wako Pure Chemical), 250 mM sucrose (Wako Pure Chemical), 1 % Triton (Calbiochem-Novabiochem, La Jolla, CA, USA) and a protease inhibitor cocktail (Complete®; Roche Molecular Biochemicals, Mannheim, Germany), using an ultrasound homogenizer (UR-20P, TOMY SEIKO, Co., Ltd., Tokyo, Japan). The homogenates were homogenized again immediately after being centrifuged at 10,000 x g for 1 min at 4 °C. The homogenates were centrifuged at 1,000 x g for 1 min at 4 °C, and the supernatants were collected and stored as test samples at -70 °C for future analysis.
Page 6 of 27
An aliquot of test sample was diluted with an equal volume of electrophoresis sample buffer (Bio-Rad Laboratories, Co., Ltd., CA, USA). Proteins were separated by size on 4-20 % SDS-polyacrylamide gradient gel and transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories) in semi-dry electrophoretic transfer cell (Bio-Rad Laboratories).
ip t
5 % methanol (Wako Pure Chemical) added Tris-glycine buffer (Bio-Rad Laboratories) using a In addition, the molecular markers
(Precision plus protein dual color standards; Bio-Rad Laboratories) were loaded in lanes adjacent to
cr
sample lanes before the commencement of the run. For the immunoblot detection of tryptophan hydroxylase (TPH), membranes were blocked in 0.05 % Tween 20-Tris-Buffered Saline (TTBS)
us
containing 3 % bovine serum albumin (BSA; Sigma Aldrich, Co., Ltd., MO) for 1 hr at room temperature with agitation. The membrane was incubated with primary antibody for TPH (Sigma Chemical) diluted 1:1,000 in TTBS containing 3 % BSA overnight at 4 °C. The membranes were
an
washed in TTBS and then incubated for 30 min at room temperature with horseradish peroxidase-conjugated goat anti rabbit IgG (Jackson Immunoresearch Laboratories, Co., Ltd., PA, USA),
M
which was diluted 1:10,000 in TTBS containing 3 % BSA. After this incubation, the membranes were washed in TTBS. The antigen-antibody-peroxidase complex was then finally detected by enhanced chemiluminescence (Santa Cruz Biotechnology, Co., Ltd., CA, USA), and scanned, optimized and
te
2.5. Immunohistochemistry
d
analyzed by Chemi Doc XRS (Bio-Rad Laboratories).
In the immunohistochemical analysis, mice were deeply anesthetized with sodium pentobarbital (70
Ac ce p
mg/kg, i.p.) and perfusion-fixed with 4% paraformaldehyde (Wako Pure Chemical Industries Ltd., Osaka, Japan) in PBS. The brains were then quickly removed after perfusion, and thick coronal sections of the midbrain, including the dorsal raphe nuclei (DRN), were initially dissected using Brain Blocker. The brain coronal sections were postfixed in 4 % paraformaldehyde for 2 hr. After the brains were permeated with 20 % sucrose for 1 day and 30 % sucrose for 2 days, they were frozen in embedding compound (Sakura Finetechnical, Tokyo, Japan) on dry ice and stored at -30 °C until use. Frozen 10-μ-m-thick coronal sections were cut with a cryostat (Sakura Finetechnical) and thaw-mounted on amino silane coated glass slides (Matsunami Glass Ind., Ltd., Osaka, Japan). The brain sections were incubated with 10 % normal goat serum in ice-cold PBS for 60 min to block nonspecific antibody binding and then with the tryptophan hydroxylase (TPH) mouse monoclonal antibody (1:600; Sigma Chemical) for 2 days at 4 °C. The samples were then rinsed with PBS and incubated with the appropriate secondary antibody conjugated with Alexa 488 (1:1000) for 2 h at room temperature. The slides were then coverslipped with PermaFluor Aqueous mounting medium (Immunon, Pittsburgh, PA,
Page 7 of 27
USA). Fluorescence immunolabeling was detected using a confocal laser-scanning microscope (FV1000; Olympus Optical, Tokyo, Japan). The intensity of TPH-like immunoreactivity in dorsal raphe nuclei (DRN) was analyzed and quantified by computer-assisted densitometry using Image J software
ip t
(National Institutes of Health, MD).
2.6. RT-PCR
cr
Adult offspring that had been exposed to prenatal restraint stress was sacrificed by decapitation at 8 week-old. Their midbrain, containing raphe, were removed quickly. In addition, the embryonic
us
hindbrain was removed at GD12.5 from dams that had been exposed to restraint stress GD5.5-11.5. In the RNA preparation and semiquantitative analysis by reverse transcription-PCR, total RNA was extracted using the SV Total RNA Isolation System (Promega, Madison, WI, USA) following the
an
instructions of the manufacturer. Similarly, total RNA in the embryonic hindbrain was extracted. To prepare first strand cDNA, 1 μg of RNA was incubated in 100 μL of buffer containing 10 mM DTT, 2.5
M
mM MgCl2, dNTP mix, 200 U of reverse transcriptase III (Invitrogen, Carlsbad, CA, USA) and 0.1 mM oligo (dT) 12-18 (Invitrogen). The targeted genes were amplified in 50 μL of a PCR solution containing MgCl2, dNTP mix and DNA polymerase (Invitrogen) with synthesized primers. The sequences of
d
mouse gene-specific primers are provided in Table 1. Samples were heated to 94 °C for 5 min, 55 °C for 1 min, and 72 °C for 1 min, and cycled 35 times through 94 °C for 30 sec, 55 °C for 1 min, and 72 °C electrophoresis
with
the
te
for 1 min. The final incubation was at 72 °C for 7 min. The mixture was subjected to 2 % agarose gel indicated
markers
and
primers
for
the
internal
standard
Ac ce p
glyceraldehyde-3-phosphate dehydrogenase. Each sample was applied to more than two lanes in the same gel. The agarose gel was stained with ethidium bromide and photographed with ultraviolet transillumination. The intensity of the bands was analyzed and quantified by computer-assisted densitometry using NIH Image software.
2.7. Statistical analysis
The data are presented as the mean with S.E.M. The statistical analyses were performed using one-way ANOVA with the Bonferroni/Dunnett multiple comparison test or Student’s t-test.
Page 8 of 27
3. Results 3.1. Effects of exposure to prenatal restraint stress on the emotional response to acute or chronic restraint stress in mice as estimated by the hole-board test
ip t
The effects of exposure to acute or repeated restraint stress on the emotionality of mice that had been exposed to prenatal restraint stress as estimated by the hole-board test are shown in Figs. 1 and 2. A single exposure to restraint stress for 60 min induced significant decreases in the moving distance,
cr
rearing behaviors and head-dipping behaviors in the hole-board test in naive mice that had not been exposed to prenatal restraint stress (Fig. 1A-E). These emotional stress responses disappeared in naive
us
mice that were exposed to the same duration of restraint stress repeatedly once a day for 7 days (Fig. 2A-E), which suggests the development of stress adaptation. In contrast, mice that had been exposed
an
to prenatal restraint stress did not develop stress adaptation, and still showed a significant decrease in the number and duration of head-dipping behaviors after chronic exposure to restraint stress for 60 min/day for 7 days (Fig. 2D, E). CC (control-control) means the group of mice that had not been
M
exposed to prenatal stress and postnatal acute/chronic stress. CS (control-stress) means the group of mice that had not been exposed to prenatal stress and exposed to postnatal acute/chronic stress. SC (stress-control) means the group of mice that had been exposed to prenatal stress and not exposed to
d
postnatal acute/chronic stress. SS (stress-stress) means the group of mice that had been exposed to prenatal stress and postnatal acute/chronic stress. Each mean value was follows. (Fig.1) Number of
te
animals: CC: 10, CS: 12, SC: 7, SS: 7. Moving distance: CC: 3016 ± 215, CS: 1774 ± 291, SC: 2337 ± 188, SS: 1717 ± 299 (F(3,32)=5.486, p<0.01), Rearing count: CC: 35.7 ± 2.4, CS: 12.0 ± 3.1, SC: 26.1 ±
Ac ce p
4.8, SS: 12.0 ± 2.9 (F(3,32)=13.393, p<0.001). Rearing duration: CC: 36.4 ± 3.4, CS: 9.2 ± 2.7, SC: 24.1 ± 7.5, SS: 8.9 ± 2.6 (F(3,32)=11.537, p<0.001). Head dip count: CC: 33.1 ± 4.7, CS: 6.9 ± 2.2, SC: 27.1 ± 4.1, SS: 12.4 ± 2.8 (F(3,32)=13.093, p<0.001). Head dip duration: CC: 12.9 ± 2.6, CS: 2.8 ± 1.2, SC: 10.9 ± 2.5, SS: 3.6 ± 0.9 (F(3,32)=7.338, p<0.001). 18.
(Fig.2) Number of animals: CC: 15, CS: 17, SC: 15, SS:
Moving distance: CC: 2464 ± 123, CS: 2760 ± 194, SC: 2490 ± 131, SS: 1973 ± 209 (F(3,61)=3.792,
p<0.05). Rearing count: CC: 27.0 ± 2.8, CS: 20.5 ± 2.1, SC: 25.9 ± 2.6, SS: 19.2 ± 2.7 (F(3,61)=2.297, p=0.087). Rearing duration: CC: 26.3 ± 4.6, CS: 15.9 ± 2.1, SC: 22.6 ± 3.6, SS: 14.5 ± 2.5 (F(3,61)=3.000, p<0.05). Head dip count: CC: 32.5 ± 2.2, CS: 25.7 ± 2.4, SC: 29.9 ± 2.1, SS: 16.5 ± 2.0 (F(3,61)=10.613, p<0.001). Head dip duration: CC: 13.6 ± 1.5, CS: 9.3 ± 1.3, SC: 13.4 ± 1.6, SS: 5.8 ± 0.9 (F(3,61)=8.019, p<0.001).
3.2. Effects of exposure to prenatal restraint stress on the expression of tryptophan hydroxylase (TPH) in the raphe of mice exposed to chronic restraint stress.
Page 9 of 27
The change in the protein level of TPH in the mouse midbrain after exposure to chronic restraint stress is shown in Fig. 3. Western blotting showed that protein levels of whole-cell TPH in the midbrain were significantly increased in naive mice that had been exposed to chronic restraint stress for 60 In contrast, in prenatally stressed mice
ip t
min/day for 7 days, i.e. stress-adapted mice (Fig. 3B; p<0.05).
that had been exposed to chronic restraint stress for 60 min/day for 7 days, i.e. stress-maladaptive mice, protein levels of TPH were significantly decreased after chronic exposure to restraint stress (Fig. 3B; Immunohistochemical analysis showed a similar tendency (Fig. 3C, D). CC
cr
p<0.001).
(control-control) means the group of mice that had not been exposed to prenatal stress and postnatal
us
chronic stress. CS (control-stress) means the group of mice that had not been exposed to prenatal stress and exposed to postnatal chronic stress. SC (stress-control) means the group of mice that had been exposed to prenatal stress and not exposed to postnatal chronic stress. SS (stress-stress) means the group
an
of mice that had been exposed to prenatal stress and postnatal chronic stress. Each mean value was follows: (Fig.3B) Number of samples: CC: 8, CS: 7, SC: 7, SS: 8. CC: 100.0 ± 2.1, CS: 116.9 ± 7.0, SC:
M
111.4 ± 2.0, SS: 90.1 ± 6.5 (F(3,26)=5.714, p=0.004). (Fig.3D) Number of samples: CC: 8, CS: 7, SC: 7, SS: 8. CC: 100.0 ± 15.9, CS: 124.5 ± 12.5, SC: 129.0 ± 20.5, SS: 97.3 ± 18.2 (F(3,12)=0.918, p=0.462).
prenatally exposed to restraint stress.
d
3.3. Down-regulation of the expression of Lmx1b mRNAs in the embryonic hindbrain of mice that were
te
In the RT-PCR assay, exposure to prenatal restraint stress produced a significant decrease in Lmx1b mRNA (p<0.05, Fig. 4A, B) and a tendency for a decrease in Pet1 (p=0.06, Fig. 4C, D) mRNA
Ac ce p
production in the hindbrain of embryonic mice (GD 12.5). On the other hand, under these conditions, no changes in the levels of Mash1 (Fig. 4E, F) or Shh (Fig. 4G, H) mRNA were noted. Each mean value was follows: Lmx1b: CONT: 100.0 ± 5.8, PRS: 80.5 ± 4.0, Pet1: CONT: 100.0 ± 5.3, PRS: 88.8 ± 2.9, Mash1: CONT: 100.0 ± 6.8, PRS: 96.6 ± 3.3, Shh: CONT: 100.0 ± 4.1, PRS: 105.5 ± 5.1.
3.4. Down-regulation of the expression of Lmx1b mRNA in raphe of mice that were prenatally exposed to restraint stress.
In the RT-PCR assay, exposure to prenatal restraint stress produced a significant decrease in Lmx1b mRNA production in the midbrain, which contains raphe, of offspring (p<0.05, Fig. 5A, B). On the other hand, under these conditions, no changes in the levels of Pet1 mRNA were noted (Fig. 5C, D). Each mean value was follows: Lmx1b: CONT: 100.0 ± 5.5, PRS: 84.2 ± 1.6, Pet1: CONT: 100.0 ± 1.7, PRS: 103.3 ± 2.9.
Page 10 of 27
4. Discussion A growing body of evidence obtained from experimental studies using animal models and epidemiological studies in human populations suggests that prenatal stress is associated with adverse
ip t
health outcomes in offspring [37]. In a previous study, we also investigated the emotional abnormality in two types of prenatal stress in a model that is created by exposing pregnant mice to weak or strong restraint stress. We found that exposure to excessive prenatal stress could increase anxiety levels in
cr
offspring [23]. These results suggest that mice exposed to strong prenatal stress could reflect the clinical situation in which severe stressful situations during pregnancy impair the emotional
us
development of offspring.
On the other hand, Selye, who pioneered research on the biological effects of exposure to stress stimuli,
an
noticed that the body adapts to external stressors in terms of a biological pattern that is actually predictable, so that the internal balance, or homeostasis, is restored and maintained [38,39]. The ability to adapt to stress is an important defensive function of a living body, and impairment of this
M
ability may contribute to some stress-related disorders. In the present study, we investigated the association between exposure to prenatal stress and the ability to adapt to stress in adulthood. The present study demonstrated that a single exposure to restraint stress for 60 min produced a decrease in
d
the moving distance, head-dipping behaviors and rearing behaviors in naive mice, which had not been exposed to prenatal restraint stress, in the hole-board test, and these acute emotional responses were
te
recovered by exposure to repeated restraint stress for 60 min/day for 7 days. These findings are in good agreement with previous reports in rats [24-30], and confirm the development of stress adaptation.
Ac ce p
However, mice that had been exposed to prenatal restraint stress continued to show a decrease in head-dipping behavior in the hole-board test after chronic exposure to restraint stress for 60 min/day for 7 days. Because only exposure to prenatal stress failed to change the behaviors in hole-board, these behavioral abnormalities have not been caused by natural locomotive activity by hypoplasia in offspring. These results indicate that severe stressful situations during pregnancy impair the ability to adapt to stress in adulthood.
Previous studies in stress-adaptive and -maladaptive animals have provided evidence that an increase in brain 5-HT signaling may be a key factor in the adaptation to repeated exposure to stress [24-27]. We also found that 5-HT1A receptor agonists can produce emotional resistance to stress stimuli in mice [32-34].
Another key finding of the present study is that the rate-limiting enzyme in 5-HT synthesis,
tryptophan hydroxylase, was increased in raphe obtained from stress-adapted mice.
In contrast, a
decrease in tryptophan hydroxylase was observed in stress-maladapted mice that had been exposed to prenatal stress. These results indicate that the constitutive activation of brain 5-HT neurons could be
Page 11 of 27
necessary for the development of stress adaptation, and this mechanism may be affected by exposure to prenatal restraint stress. As mentioned above, a few preclinical reports have suggested that prenatal stress could affect central 5-HT neurons. Peters et al. reported that maternal stress increased fetal brain
ip t
5-HT synthesis in rats [18]. They also found that offspring that had been exposed to prenatal stress showed region-specific changes in brain 5-HT, 5-HIAA and noradrenaline levels in infancy [17]. Hayashi et al. reported that maternal stress induced synaptic loss associated with disruption of 5-HT
cr
neurotransmission and developmental disabilities in offspring [22]. In addition to these precedent articles, we previously reported that 5-HT-positive neurons were significantly increased in the dorsal
us
raphe nuclei (DRN) in the same model of prenatal stress as used in the present study [23]. Moreover, Konnno et al. reported that early postnatal stress induce abnormalities of emotional behavior of rats in elevated plus maze [40]. They also found that same behavior was observed in rats with raphe nuclei
an
lesions. These previous reports and our present findings suggest that prenatal stress could disrupt the development of central 5-HT neurons. Thus, future studies should focus on the changes in functional
M
molecules involved in the development of 5-HT neurons.
With the accumulation of recent preclinical reports, the mechanisms that underlie the development of 5-HT neurons are becoming clear. The synthesis of 5-HT neurons is restricted to a very limited
d
number of cells in the brainstem raphe nuclei with a vast axonal network. These cells express markers of the serotonin lineage, such as the rate-limiting enzyme in serotonin synthesis, tryptophan hydroxylase
te
2, a serotonin transporter, and transcription factors. Pet1, LIM homeobox transcription factor 1b (Lmx1b), NK transcription factor-related, locus 2 (Nkx2.2), Mouse achaete-scute homolog 1 (Mash1),
Ac ce p
GATA-motif binding (Gata) 2, Gata3, and Paired-like homeodomain protein 2b (Phox2b) form a transcriptional network, which specifies the differentiation of serotonergic neurons around embryonic day 11 in the mouse [41-46]. These cells are generated in rhombomeres r1-r3 and r5-r7 caudal to the midbrain-hindbrain organizer under the control of fibroblast growth factors 4 and 8 and sonic hedgehog (Shh) from precursors, which have produced motoneurons before. In the present study, the RT-PCR assay show a significant decrease in Lmx1b mRNA and a tendency for a decrease in Pet1 mRNA production in the hindbrain of embryonic mice (GD12.5) that had been exposed to prenatal stress. On the other hand, under these conditions, no changes in the levels of Mash1 and Shh mRNA were noted. Lmx1b and Pet1 participate in the specification and differentiation of serotonergic neurons, whereas Shh and Mash1 play an important role in the development of various neurons. Therefore, the present findings indicate that prenatal restraint stress disrupts the specification and differentiation of serotonergic neurons through a decrease in the expression of Pet1 and Lmx1b.
Page 12 of 27
The RT-PCR assay also showed that the expression of Lmx1b, but not Pet1, was downregulated in raphe of adult mice that had been exposed to prenatal restraint stress. Pet1 and Lmx1b are also expressed in adult raphe nuclei and are required across the lifespan of the mouse.
Behavioral
ip t
pathogenesis can result from both developmental and adult-onset alterations in serotonergic transcription [47-49]. In addition, while Lmx1b and Pet1 likely act in parallel to regulate central 5-HTergic systems, some of the expression of Lmx1b in adult brain is independent of Pet1 [49].
cr
Interestingly, Dai et al. reported that the contextual fear learning and memory induced by foot-shock conditioning was markedly enhanced in the 5-HT deficient mice achieved by inactivating Lmx1b
us
selectively in raphe nuclei [50]. This report strongly suggests that Lmx1b also play a critical role in functional regulation of raphe 5-HT neurons. Taken together, these findings suggest that the functional disruption of Lmx1b-positive 5-HT neurons may be induced by excessive prenatal stress.
an
In summary, we found that excessive prenatal stress induced long-term emotional vulnerability to stress associated with functional abnormalities in central 5-HT neurons in mice. Furthermore, the
M
disruption of 5-HT neuron development seems to also be induced by exposure to stress during gestation. The present findings provide evidence that prenatal stress is an important risk factor that may underlie
Ac ce p
te
d
the presence of neuropsychiatric disorders in adulthood.
Page 13 of 27
【Figure legends】 Fig. 1 Effect of prenatal restraint stress on the behavioral responses of mice to acute restraint stress in
ip t
the hole-board test. A single exposure to restraint stress for 60 min induced significant decreases in the moving distance (A), rearing counts (B) and duration (C), and head-dip counts (D) and duration (E) in the hole-board in control naive mice (CC vs CS). Similar phenomena were observed in mice that
cr
had been exposed to prenatal restraint stress (SC vs SS). Each column represents the mean with SEM of 7-12 mice. *p<0.05, **p<0.01, ***p<0.001 vs CC, #p<0.05, ##p<0.01###p<0.001 vs CS, $p<0.05 vs
us
SC. CC; control - control, CS; control - exposure to acute restraint stress, SC; exposure to prenatal
an
restraint stress - control, SS; exposure to prenatal restraint stress - exposure to acute restraint stress. Fig. 2
Effect of prenatal restraint stress on the behavioral responses of mice to chronic restraint stress in
M
the hole-board test. Chronic exposure to restraint stress (60 min / day, 7 days) in adulthood did not affect the moving distance (A), rearing counts (B) or duration (C), or head-dip counts (D) or duration (E) in the hole-board in control mice. On the other hand, significant changes in head-dip counts (D)
d
and duration (E) were observed in mice that had been exposed to prenatal restraint stress. Each column represents the mean with SEM of 15-18 mice. *p<0.05, ***p<0.001 vs CC, ##p<0.01 vs CS,
te
$$p<0.01 vs SC. CC; control - control, CS; control - exposure to acute restraint stress, SC; exposure to prenatal restraint stress - control, SS; exposure to prenatal restraint stress - exposure to acute restraint
Fig. 3
Ac ce p
stress.
Effect of strong prenatal restraint stress on the expression of tryptophan hydroxylase (TPH) in the raphe of mice exposed to chronic restraint stress. (A) Representative Western blotting for TPH proteins. (B) Chronic exposure to restraint stress (60 min / day, 7 days) in adulthood increased TPH levels in the raphe of control naive mice. On the other hand, a significant decrease in the TPH level was observed in prenatally stressed mice after chronic exposure to restraint stress. Each column represents the mean with SEM of 7-8 mice. *p<0.05 vs CC, ###p<0.001 vs CS, $$p<0.01 vs SC. Scale bars: 200 µm. (C) Typical photographs of TPH-like immunoreactivity (IR) in the DRN mice. (D) The results of a quantitative analysis of TPH-IR in the DRN are shown in panel D. Chronic exposure to restraint stress in adulthood also tend to increased TPH-like immunoreactivities (IRs) in the dorsal raphe nuclei of control naive mice.
On the other hand, a tending to decrease in TPH-IRs was observed in
Page 14 of 27
prenatally stressed mice after chronic exposure to restraint stress. The column represents the mean with SEM of 4 independent samples. CC; control - control, CS; control - exposure to acute restraint stress, acute restraint stress. GAPDH; glyceraldehyde-3-phosphate dehydrogenase. Fig. 4
ip t
SC; exposure to prenatal restraint stress - control, SS; exposure to prenatal restraint stress - exposure to
in the hindbrain of embryonic mice.
cr
Effect of strong prenatal restraint stress on the expression of Lmx1b, Pet1, Mash1 and Shh mRNA Representative RT-PCR for Lmx1b (A), Pet1 (C), Mash1 (E)
us
and Shh (G) mRNA in the hindbrain of prenatal restraint stress-exposed and control naive embryonic mice. A significant decrease in the expression of Lmx1b (B) and a tendency for a decrease in the expression of Pet1 (D) mRNA were observed in the hindbrain of embryonic mice that had been
an
prenatally exposed to restraint stress. On the other hand, no changes were observed in the expression of Mash1 (F) and Shh (H) mRNAs. Each column represents the mean with SEM of 3 independent dams.
M
*p<0.05 vs. control mice. CONT; control, PRS; prenatal restraint stress, Pet1; pheochromocytoma 12 ETS, Lmx1b; LIM homeobox transcription factor 1 beta, Mash1; mouse achaete-scute homolog 1, Shh;
d
sonic hedgehog. GAPDH; glyceraldehyde-3-phosphate dehydrogenase. Fig. 5
of mice.
te
Effect of strong prenatal restraint stress on the expression of Lmx1b and Pet1 mRNA in the raphe Representative RT-PCR for Lmx1b (A) and Pet1 (C) mRNA in the raphe of prenatal restraint
Ac ce p
stress-exposed and control naive mice. A significant decrease in the expression of Lmx1b (B), but not Pet1 (D), mRNA was observed in the raphe of mice that were exposed to restraint stress prenatally. Each column represents the mean with SEM of 9 mice. *p<0.05 vs. control mice. CONT: control, PRS: prenatal restraint stress. Lmx1b; LIM homeobox transcription factor 1 beta, Pet1; pheochromocytoma 12 ETS. GAPDH; glyceraldehyde-3-phosphate dehydrogenase.
Page 15 of 27
【Referece】 1.
Kitamura T, Shima S, Sugawara M, Toda MA. Psychological and social correlates of the onset of
2.
ip t
affective disorders among pregnant women. Psychol Med 1993; 23: 967-75. [PMID: 8134520]
Field T, Diego M, Hernandez-Reif M. Prenatal depression effects on the fetus and newborn: a review. Infant Behav Dev 2006; 29: 445-55. [PMID: 17138297]
Koenig JI, Kirkpatrick B, Lee P. Glucocorticoid hormones and early brain development in
cr
3.
schizophrenia. Neuropsychopharmacology 2002; 27: 309-18. [PMID: 12093605]
Walker E, Mittal V, Tessner K. Stress and the hypothalamic pituitary adrenal axis in the
us
4.
developmental course of schizophrenia. Annu Rev Clin Psychol 2008; 4: 189-216. [PMID: 5.
an
18370616]
Ronald A, Pennell CE, Whitehouse AJ. Prenatal Maternal Stress Associated with ADHD and Autistic Traits in early Childhood. Front Psychol 2010; 1: 223. [PMID: 21833278] Vallée M, Mayo W, Dellu F, Le Moal M, Simon H, Maccari S. Prenatal stress induces high anxiety
M
6.
and postnatal handling induces low anxiety in adult offspring: correlation with stress-induced corticosterone secretion. J Neurosci 1997; 17: 2626-36. [PMID: 9065522] Nishio H, Kasuga S, Ushijima M, Harada Y. Prenatal stress and postnatal development of neonatal
d
7.
te
rats--sex-dependent effects on emotional behavior and learning ability of neonatal rats. Int J Dev Neurosci 2001; 19: 37-45. [PMID: 11226753] 8.
Dugovic C, Maccari S, Weibel L, Turek FW, Van Reeth O. High corticosterone levels in
Ac ce p
prenatally stressed rats predict persistent paradoxical sleep alterations. J Neurosci 1999; 19: 8656-64. [PMID: 10493766] 9.
Hayashi A, Nagaoka M, Yamada K, Ichitani Y, Miake Y, Okado N. Maternal stress induces synaptic loss and developmental disabilities of offspring. Int J Dev Neurosci 1998; 16: 209-16. [PMID: 9785117]
10.
Vallée M, MacCari S, Dellu F, Simon H, Le Moal M, Mayo W. Long-term effects of prenatal stress and postnatal handling on age-related glucocorticoid secretion and cognitive performance: a longitudinal study in the rat. Eur J Neurosci 1999; 11: 2906-16. [PMID: 10457187]
11.
Secoli SR, Teixeira NA. Chronic prenatal stress affects development and behavioral depression in rats. Stress 1998; 2: 273-80. [PMID: 9876258]
12.
Zimmerberg B, Blaskey LG. Prenatal stress effects are partially ameliorated by prenatal administration of the neurosteroid allopregnanolone. Pharmacol Biochem Behav 1998; 59: 819-27. [PMID: 9586837]
Page 16 of 27
13.
Alonso SJ, Castellano MA, Quintero M, Navarro E. Action of antidepressant drugs on maternal stress-induced hypoactivity in female rats. Methods Find Exp Clin Pharmacol 1999; 21: 291-5. [PMID: 10399138] Lehmann J, Stöhr T, Feldon J. Long-term effects of prenatal stress experiences and postnatal
ip t
14.
maternal separation on emotionality and attentional processes. Behav Brain Res 2000; 107: 133-44. [PMID: 10628737]
Lephart ED, Watson MA, Jacobson NA, Rhees RW, Ladle DR. Calbindin-D28k is regulated by
cr
15.
adrenal steroids in hypothalamic tissue during prenatal development. Brain Res Dev Brain Res 16.
us
1997; 100: 117-20. [PMID: 9174253]
Szuran TF, Pliska V, Pokorny J, Welzl H. Prenatal stress in rats: effects on plasma corticosterone, hippocampal glucocorticoid receptors, and maze performance. Physiol Behav 2000; 71: 353-62.
17.
an
[PMID: 11150568]
Peters DA. Prenatal stress: effects on brain biogenic amine and plasma corticosterone levels.
18.
M
Pharmacol Biochem Behav 1982; 17: 721-5. [PMID: 6184733]
Peters DA. Maternal stress increases fetal brain and neonatal cerebral cortex 5-hydroxytryptamine synthesis in rats: a possible mechanism by which stress influences brain development. Pharmacol
19.
d
Biochem Behav 1990; 35: 943-7. [PMID: 1693214]
Weinstock M. Does prenatal stress impair coping and regulation of hypothalamic-pituitary-adrenal
20.
te
axis? Neurosci Biobehav Rev 1997; 21: 1-10. [PMID: 8994205] Murphy DL, Pigott TA. A comparative examination of a role for serotonin in obsessive
Ac ce p
compulsive disorder, panic disorder, and anxiety. J Clin Psychiatry 1990; 51 Suppl: 53-8; discussion 59-60. [PMID: 2139026] 21.
Nordquist N, Oreland L. Serotonin, genetic variability, behaviour, and psychiatric disorders--a review. Ups J Med Sci 2010; 115: 2-10. [PMID: 20187845]
22.
Hayashi A, Nagaoka M, Yamada K, Ichitani Y, Miake Y, Okado N. Maternal stress induces synaptic loss and developmental disabilities of offspring. Int J Dev Neurosci 1998; 16: 209-16. [PMID: 9785117]
23.
Miyagawa K, Tsuji M, Takeda H. Possible involvement of histone acetylation in the development of emotional resistance to stress stimuli in mice. Behav Brain Res 2012; 235: 318-25. [PMID: 22963996]
24.
Kennett GA, Dickinson SL, Curzon G. Central serotonergic responses and behavioural adaptation to repeated immobilisation: the effect of the corticosterone synthesis inhibitor metyrapone. Eur J Pharmacol 1985; 119: 143-52. [PMID: 4092729]
Page 17 of 27
25.
Kennett GA, Dickinson SL, Curzon G. Enhancement of some 5-HT-dependent behavioural responses following repeated immobilization in rats. Brain Res 1985; 330: 253-63. [PMID: 4039215] Kennett GA, Chaouloff F, Marcou M, Curzon G. Female rats are more vulnerable than males in an
ip t
26.
animal model of depression: the possible role of serotonin. Brain Res 1986; 382: 416-21. [PMID: 3756525]
Ohi K, Mikuni M, Takahashi K. Stress adaptation and hypersensitivity in 5-HT neuronal systems
cr
27.
after repeated foot shock. Pharmacol Biochem Behav 1989; 34: 603-8. [PMID: 2623017] Haleem DJ, Parveen T. Brain regional serotonin synthesis following adaptation to repeated restraint. Neuroreport 1994; 5: 1785-8. [PMID: 7827332] 29.
us
28.
Haleem DJ. Adaptation to repeated restraint stress in rats: failure of ethanol-treated rats to adapt in
30.
an
the stress schedule. Alcohol Alcohol 1996; 31: 471-7. [PMID: 8949963]
Tsuji M, Takeda H, Matsumiya T. Brain 5-HT1A receptors as important mediators in the
31.
M
development of stress adaptation. Curr Neuropharmacol 2003; 1: 315-24. Tsuji M, Takeuchi T, Miyagawa K, Ishii D, Imai T, Takeda K, Kitajima M, Takeda H. Yokukansan, a traditional Japanese herbal medicine, alleviates the emotional abnormality induced 32.
d
by maladaptation to stress in mice. Phytomedicine 2013. [PMID: 24129119] Tsuji M, Takeda H, Matsumiya T. Different effects of 5-HT1A receptor agonists and
te
benzodiazepine anxiolytics on the emotional state of naive and stressed mice: a study using the hole-board test. Psychopharmacology (Berl) 2000; 152: 157-66. [PMID: 11057519] Tsuji M, Takeda H, Matsumiya T. Protective effects of 5-HT1A receptor agonists against
Ac ce p
33.
emotional changes produced by stress stimuli are related to their neuroendocrine effects. Br J Pharmacol 2001; 134: 585-95. [PMID: 11588113] 34.
Tsuji M, Takeda H, Matsumiya T. Modulation of passive avoidance in mice by the 5-HT1A receptor agonist flesinoxan: comparison with the benzodiazepine receptor agonist diazepam. Neuropsychopharmacology 2003; 28: 664-74. [PMID: 12655311]
35.
Takeda H, Tsuji M, Matsumiya T. Changes in head-dipping behavior in the hole-board test reflect the anxiogenic and/or anxiolytic state in mice. Eur J Pharmacol 1998; 350: 21-9. [PMID: 9683010]
36.
Tsuji M, Takeda H, Matsumiya T. Different effects of 5-HT1A receptor agonists and benzodiazepine anxiolytics on the emotional state of naive and stressed mice: a study using the hole-board test. Psychopharmacology (Berl) 2000; 152: 157-66. [PMID: 11057519]
37.
Beydoun H, Saftlas AF. Physical and mental health outcomes of prenatal maternal stress in human and animal studies: a review of recent evidence. Paediatr Perinat Epidemiol 2008; 22: 438-66.
Page 18 of 27
[PMID:18782252] 38.
Selye H. Syndrome produced by diverse nocuous agents. Nature 1936; 138: 32. [PMID: 9722327]
39.
SELYE H. The general adaptation syndrome and the diseases of adaptation. J Clin Endocrinol
40.
ip t
Metab 1946; 6: 117-230. [PMID: 21025115]
Konnno K, Matsumoto M, Togashi H, Yamaguchi T, Izumi T, Watanabe M, Iwanaga T, Yoshioka M. Early postnatal stress affects the serotonergic function in the median raphe nuclei of adult rats.
41.
cr
Brain Res 2007; 1172: 60-6. [PMID: 17825274]
Hendricks T, Francis N, Fyodorov D, Deneris ES. The ETS domain factor Pet-1 is an early and genes. J Neurosci 1999; 19: 10348-56. [PMID: 10575032]
42.
us
precise marker of central serotonin neurons and interacts with a conserved element in serotonergic Hendricks TJ, Fyodorov DV, Wegman LJ, Lelutiu NB, Pehek EA, Yamamoto B, Silver J, Weeber
an
EJ, Sweatt JD, Deneris ES. Pet-1 ETS gene plays a critical role in 5-HT neuron development and is required for normal anxiety-like and aggressive behavior. Neuron 2003; 37: 233-47. 43.
M
[PMID:12546819]
Brunet JF, Pattyn A. Phox2 genes - from patterning to connectivity. Curr Opin Genet Dev 2002; 12: 435-40. [PMID: 12100889]
Pattyn A, Vallstedt A, Dias JM, Samad OA, Krumlauf R, Rijli FM, Brunet JF, Ericson J.
d
44.
Coordinated temporal and spatial control of motor neuron and serotonergic neuron generation from 45.
te
a common pool of CNS progenitors. Genes Dev 2003; 17: 729-37.
[PMID: 12651891]
Pattyn A, Simplicio N, van Doorninck JH, Goridis C, Guillemot F, Brunet JF. Ascl1/Mash1 is
Ac ce p
required for the development of central serotonergic neurons. Nat Neurosci 2004; 7: 589-95. [PMID: 15133515] 46.
Alenina N, Bashammakh S, Bader M. Specification and differentiation of serotonergic neurons. Stem Cell Rev 2006; 2: 5-10. [PMID: 17142880]
47.
Dai JX, Hu ZL, Shi M, Guo C, Ding YQ. Postnatal ontogeny of the transcription factor Lmx1b in the mouse central nervous system. J Comp Neurol 2008; 509: 341-55. [PMID: 18512225]
48.
Liu C, Maejima T, Wyler SC, Casadesus G, Herlitze S, Deneris ES. Pet-1 is required across different stages of life to regulate serotonergic function. Nat Neurosci 2010; 13: 1190-8. [PMID: 20818386]
49.
Song NN, Xiu JB, Huang Y, Chen JY, Zhang L, Gutknecht L, Lesch KP, Li H, Ding YQ. Adult raphe-specific deletion of Lmx1b leads to central serotonin deficiency. PLoS One 2011; 6: e15998. [PMID: 21246047]
50.
Dai JX, Han HL, Tian M, Cao J, Xiu JB, Song NN, Huang Y, Xu TL, Ding YQ, Xu L. Enhanced
Page 19 of 27
contextual fear memory in central serotonin-deficient mice. Proc Natl Acad Sci USA 105(33);
Ac ce p
te
d
M
an
us
cr
ip t
11981-6. [PMID: 18695238]
Page 20 of 27
Research Highlights 1. Acute emotional stress response disappeared in naive mice that had been exposed to repeated 2. Prenatally stressed mice did not develop this stress adaptation.
ip t
restraint stress.
3. A decrease in tryptophan hydroxylase was observed in stress-maladaptive mice.
cr
4. The transcription factor Lmx1b was decreased in the embryonic hindbrain and adult raphe of
Ac ce p
te
d
M
an
us
prenatally stressed mice.
Page 21 of 27
Figure(s)
cs
sc
ss
(C)
ss
ip t sc
an
ss
###
M
ed
sc
cs
*** $ ***
cc
cs
sc
ss
pt
cs
$
Head dip count (counts/5 min)
Rearing duration (sec/5 min)
***
***
cc
ce
(E)
##
Ac
Head dip duration (sec/5min)
cc
(D)
*#
*** $
***
cr
cc
**
##
us
Moving distance (cm)
**
Rearing count (counts/5 min)
(B)
(A)
** $
***
cc
cs
sc
Prenatal stress
Postnatal acute stress
Abbreviat ions
−
−
CC
−
+
CS
+
−
SC
+
+
SS
ss
Page 22 of 27
(A)
sc
(D)
ip t cc
cs
an
sc
sc
Ac
ce
pt
ss
cc
cs
sc
*** $$
cc
ss
*** ## $$
M cs
ed
cc (E) Head dip duration (sec/5min)
ss
cr
cs
Head dip count (counts/5 min)
cc
Rearing duration (sec/5 min)
(C)
us
Moving distance (cm)
Rearing count (counts/5 min)
(B)
cs
sc
ss
Prenatal stress
Postnatal chronic stress
Abbrevi ations
−
−
CC
−
+
CS
+
−
SC
+
+
SS
ss
Page 23 of 27
(Figure 2)
(C)
(kDa) 75 50
TPH
37 25
GAPDH
cc CC
CS
SC
cs
ip t
(A)
SS
sc
ss
CC
CS
SC
M
an
% of CC
### $$
us
*
cr
(B)
SS
ed
(D)
160
Abbrevi ations
−
−
CC
−
+
+
−
+
+
ce
Ac
CS
SC SS
140 120 100
% of CC
Postnatal chronic stress
pt
Prenatal stress
80 60 40 20 0 CC
CS
SC
SS
Page 24 of 27
(Figure 3)
Lmx1b
Pet1
GAPDH
GAPDH
(D)
PRS
M
CONT (E)
GAPDH PRS
ce
pt
CONT
Ac
% of control
(F)
ed
Mash1
CONT
PRS
PRS
cr
an
*
CONT
us
PRS
% of control
% of control
CONT
(G)
CONT
PRS
Shh GAPDH
(H)
CONT
PRS
% of control
(B)
ip t
(C)
(A)
CONT
PRS
Page 25 of 27
(Figure 4)
ip t Pet1
CONT
PRS
CONT
(D)
PRS
PRS
CONT
PRS
Ac
ce
pt
CONT
ed
M
% of control
*
% of control
us
GAPDH
GAPDH
(B)
cr
(C)
Lmx1b
an
(A)
Page 26 of 27
(Figure 5)
us
cr
ip t
Table(s)
Table 1. Primer sequences
antisense primer (5'-3')
Length
Pet1
CGCACTTGGGGGGTCATTATCAC
GCCTGATGTTCAAGGAAGACCTCGG
210bp
Lmx1b
GCAGCGGCTGCATGGAGAAGATCGC
GGTTCTGAAACCAGACCTGGACCAC
465bp
Mash1
GGCTCAACTTCAGCGGCTTC
GTTGGTAAAGTCCAGCAGCTC
398bp
Shh
CTGGCCAGATGTTTTCTGGT
GAPDH
CCCACGGCAAGTTCAACGG
M
an
sense primer (5'-3’)
CATGTCGGGGTTGTAATTGG
427bp bp = base pairs
Ac
ce
pt
ed
CTTTCCAGAGGGGCCATCCA
243bp
Page 27 of 27
S0166-4328(14)00288-5 http://dx.doi.org/doi:10.1016/j.bbr.2014.04.052 BBR 8887
To appear in:
Behavioural Brain Research
Received date: Revised date: Accepted date:
29-1-2014 27-3-2014 11-4-2014
Please cite this article as: Miyagawa K, Tsuji M, Ishii D, Takeda K, Takeda H, Prenatal stress induces vulnerability to stress together with the disruption of central serotonin neurons in mice, Behavioural Brain Research (2014), http://dx.doi.org/10.1016/j.bbr.2014.04.052 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title: Prenatal stress induces vulnerability to stress together with the disruption of central serotonin neurons in
ip t
mice Running Title:
cr
Prenatal stress induce vulnerability to stress Authors:
us
Kazuya Miyagawa, Minoru Tsuji, Daisuke Ishii, Kotaro Takeda and Hiroshi Takeda Affiliation:
an
Department of Pharmacology, School of Pharmacy, International University of Health and Welfare Keywords:
M
Prenatal stress, Stress adaptation, Serotonin, Lmx1b, Hole-board test
Address and e-mail address to which correspondence and proofs should be sent
d
Dr. Kazuya Miyagawa
Department of Pharmacology, School of Pharmacy, International University of Health and Welfare Tel: +81-287-24-3216
Ac ce p
Fax: +81-287-24-3521
te
2600-1 Kitakanamaru, Ohtawara, Tochigi 324-8501, Japan
E-mail: [email protected]
Page 1 of 27
【Abstract】 A growing body of evidence suggests that prenatal stress increases the vulnerability to neuropsychiatric disorders. On the other hand, the ability to adapt to stress is an important defensive
ip t
function of a living body, and disturbance of this stress adaptability may be related, at least in part, to the pathophysiology of stress-related psychiatric disorders. The aim of the present study was to clarify the relationship between exposure to prenatal stress and the ability to adapt to stress in mice. Naive
cr
and prenatally stressed mice were exposed to repeated restraint stress for 60 min/day for 7 days. After the final exposure to restraint stress, the emotionality of mice was evaluated in terms of exploratory
us
activity, i.e., total distance moved as well as the number and duration of rearing and head-dipping behaviors, using an automatic hole-board apparatus. A single exposure to restraint stress for 60 min This acute emotional stress
an
induced a decrease in head-dipping behavior in the hole-board test.
response disappeared in naive mice that had been exposed to repeated restraint stress for 60 min/day for 7 days, which confirmed the development of stress adaptation. In contrast, prenatally stressed mice
M
did not develop this stress adaptation, and still showed a decrease in head-dipping behavior after the repeated exposure to restraint stress. Biochemical studies showed that the rate-limiting enzyme in 5-HT synthesis, tryptophan hydroxylase, was increased in raphe obtained from stress-adapted mice.
d
contrast, a decrease in tryptophan hydroxylase was observed in stress-maladaptive mice.
In
In addition,
the transcription factor Lmx1b, which is essential for differentiation and the maintenance of normal
te
functions in central 5-HT neurons, was decreased in the embryonic hindbrain and adult raphe of prenatally stressed mice. These findings suggest that exposure to excessive prenatal stress may induce
Ac ce p
a vulnerability to stress and disrupt the development of 5-HT neurons. Keywords; 5-HT, Prenatal stress, Stress adaptation, Serotonin, Lmx1b, hole-board test
Page 2 of 27
1. Introduction Depression and anxiety disorders are common public health problems with a lifetime prevalence of 10 to 20%, yet the mechanisms that underlie their pathophysiology are still poorly understood. Most such as hormonal systems may dramatically change during pregnancy.
ip t
pregnant women are at risk of showing some emotional abnormality, since some biological functions Indeed, it has been reported
that 16% of women experience the onset of an affective disorder during pregnancy, and 68% of them
cr
showed symptoms during the first trimester [1]. Thus, a suitable management plan that includes drug therapy may be necessary for pregnant women. However, doctors hesitate to use positive drug therapies
us
because of worries regarding adverse effects on the embryo. Inappropriate mental support for pregnant women may result in their exposure to very stressful situations. Particularly when pregnant women
an
suffer from serious mental disease, inappropriate drug therapies could expose them to very severe stressful situations. Previous clinical research on pregnant women suffering depressive disorders indicated that the activity of the fetus and newborn is elevated, prenatal growth is delayed, and
M
prematurity and low birthweight are more frequent [2]. Moreover, it has also been suggested that exposure to stress during gestation may impair the emotional development of the offspring and, as a result, the incidence of several neuropsychiatric disorders, including depression, anxiety, schizophrenia,
d
and autism, may increase [3-5]. Additionally, preclinical studies have suggested that offspring exposed to prenatal stress show abnormal psychiatric behaviors such as increased fear and anxiety [6,7],
te
persistent paradoxical sleep alterations [8], deficits of learning and memory [9-10], depressive-like behavior [11-13] and schizophrenia-like behavior [14]. Moreover, prenatal stress induces several
Ac ce p
functional and structural abnormalities of the components that regulate stress responses, such as the hypothalamic-pituitary-adrenal (HPA)-axis [15,16] and monoamine neurotransmission [17-19]. However, the mechanisms that underlie the impact of prenatal stress on adulthood are not yet fully understood.
Axons from the neurons of the raphe nuclei, the principal source of serotonin (5-hydroxytryptamine; 5-HT) released in the brain, form a neurotransmitter system that reaches almost every part of the central nervous system. Based on clinical and preclinical studies, it has been widely accepted that central 5-HT neurotransmission may be involved in the aetiology, expression and treatment of anxiety, impulsiveness and depression [20,21]. A few preclinical reports have suggested that prenatal stress could affect central 5-HT neurons. Peters et al. reported that maternal stress increased fetal brain 5-HT synthesis in rat. They also found that offspring that had been exposed to prenatal stress showed region-specific changes in brain 5-HT, 5-hydroxyindoleacetic acid (5-HIAA) and noradrenaline levels in infancy [17]. Hayashi et al. reported that maternal stress induced synaptic loss associated with the disruption of 5-HT
Page 3 of 27
neurotransmission and developmental disabilities in offspring [22]. In addition to these precedent articles, we recently reported that offspring that had been exposed to strong prenatal stress displayed an increase in anxiety-like behavior as determined by the elevated plus-maze test together with disruption
ip t
of the development of 5-HT neurons in mice [23].
On the other hand, the ability to adapt to stress is an important defensive function of a living body, and impairment of this ability may contribute to some stress-related disorders. Thus, the identification of strategies for stress-related psychiatric disorders.
cr
brain mechanisms that contribute to stress adaptation could help pave the way for new therapeutic A series of behavioral experiments have
us
demonstrated that repeated exposure to the same type of stress stimuli diminishes acute stress responses. For example, Kennett and co-workers reported that male rats that had been exposed to a single restraint stress for 120 min exhibited a reduction in locomotor activity in an open field, but this change in
an
behavior disappeared after repeated exposure to restraint stress for 120 min/day for 7 days [24-26]. Similar behavioral adaptive responses to stress stimuli in rats have been confirmed by other researchers
M
[27-29], which suggests that this animal model may be useful for investigating the mechanisms of stress adaptation. Furthermore, we examined behavioral responses in rats that were produced by either single or repeated exposure to restraint stress for 60 or 120 min.
A single exposure to restraint stress
d
reduced locomotor activity, and this stress response disappeared in rats that were exposed to repeated restraint stress for 60 min/day for 7 days, which confirmed the development of stress adaptation.
te
However, this adaptive response to stress stimuli was not observed in rats that had been exposed to restraint stress for 240 min/day for 7 days. Thus, we can create stress-adaptive and -maladaptive
Ac ce p
models by repeatedly exposing rats to different degrees of restraint stress [30]. In addition, more recently, to further characterize models of stress adaptation, we created stress-adaptive and -maladaptive models in mice, as described below [31]. A single exposure to restraint stress for 60 min produced a decrease in the number and duration of head-dipping behaviors of mice in the hole-board test, and these acute emotional responses were recovered by exposure to repeated restraint stress for 60 min/day for 7 or 14 days, but not 3 days. However, mice that had been exposed to repeated restraint stress for 240 min/day for 7 or 14 days continued to show a decrease in head-dipping behavior in the hole-board test. Furthermore, the results obtained in our previous studies suggest that the brain 5-HT nervous system may be involved, at least in part, in the development of adaptation to stress [32-34]. The aim of the present study was to clarify the influence of exposure to prenatal stress on the development of stress adaptation and central 5-HT neurons.
Page 4 of 27
2. Materials and Methods The present studies were conducted in accordance with the Guide for the Care and Use of Laboratory Animals as adopted by the Committee on the Care and Use of Laboratory Animals of the International
ip t
University Health and Welfare.
2.1. Animals
cr
All experiments were performed using 8-week-old male offspring of ICR mice (Japan SLC, Inc., Shizuoka, Japan) that had been prenatally exposed to stress as described below, or naive mice. The mice
us
were housed at a room temperature of 23 ± 1 °C and humidity of 50 ± 5 % with a 12 h light-dark cycle
an
(light on 7:00 a.m. to 7:00 p.m.). Food and water were available ad libitum.
2.2. Experimental procedure 2.2.1. Exposure to prenatal stress
M
Virgin female mice were mated at 10-11 weeks of age. The presence of a copulation plug denoted gestation day (GD) 0.5. Pregnant females were housed individually. In the model mice exposed to prenatal restraint stress (PRS), the pregnant mice were placed in a 50 (for mice with a body weight of 40
d
g or less)- or 70 (for mice with a body weight of 40 g or more)-ml polystyrene tube at 6 h (10:00 a.m. to 4:00 p.m.) a day from GD 5.5 to GD 17.5. The conditions of exposure to restraint stress to pregnant
Ac ce p
te
mice were determined in accordance with our previous study [23].
2.2.2. Effects of exposure to acute restraint stress on the emotionality of mice as estimated by the hole-board test
8 week-old naive or prenatally stressed mice were exposed to single restraint stress for 60 min by being inserted into a syringe (50 mL) or left in their home cage in adulthood. Just after the exposure to restraint stress, the emotionality of mice was estimated by the hole-board test [35,36]. Namely, each mouse was placed in the center of the hole-board and allowed to freely explore the apparatus for 5 min. The exploratory behaviors of mice on the hole-board, i.e., distance moved, the number and duration of rearing, and the number and duration of head-dips, were automatically recorded.
2.2.3. Effects of exposure to repeated restraint stress on the emotionality of mice as estimated by the hole-board test
Page 5 of 27
8 week-old naive or prenatally stressed mice were exposed to restraint stress for 60 min/day for 7 days. Just after the exposure to final restraint stress, the emotionality of mice was estimated by the hole-board test. At the end of the experiments, the brain samples for western blotting or immunohistochemistry
ip t
were collected.
2.3. Apparatus for the hole-board test
cr
To investigate the changes in general emotional behaviors, mice were tested using an automatic hole-board apparatus (model ST-1; Muromachi Kikai Co., Ltd, Tokyo, Japan). The apparatus (model
us
ST-1; Muromachi Kikai Co., Ltd, Tokyo, Japan) consisted of a gray wooden box (50 x 50 x 50 cm) with four equidistant holes 3 cm in diameter in the floor [35,36]. An infrared beam sensor was installed on the wall to detect the number and duration of rearing and head-dipping behaviors and the latency to the
an
first head-dipping. Other behavioral parameters such as locus, distance and speed of movement of mice in the hole-board were recorded by an overhead digital video camera; the heads of the mice were
M
painted yellow and the digital video camera followed their center of gravity. Data from the digital video camera were collected through a custom-designed interface (DV-Track; Muromachi Kikai) as a reflection signal. Head-dipping behaviors were double-checked via both an infrared beam sensor and
d
the overhead digital video camera. Thus, head-dipping behavior was counted only when both the head intercepted the infrared beam and the head was detected at the hole by the digital video camera. All of
Ac ce p
Muromachi Kikai).
te
the data were analyzed and stored in a personal computer using analytical software (Comp ACT HBS;
2.4. Western blotting
The midbrain, containing raphe, was quickly removed and homogenized in 6 volumes of ice-cold buffer. The midbrain was removed within 10 min from decapitation and stored at -70 °C for future analysis. The midbrain was homogenized in 6 volumes of ice-cold buffer containing 20 mM Tris-HCl (pH 7.4; Wako Pure Chemical Industries, Ltd, Osaka, Japan), 2 mM ethylenediaminetetraacetic acid (EDTA; Wako Pure Chemical), 10 mM ethylene glycol-bis (2-aminoethylether)-N,N,N’,N’,-tetraacetic acid (EGTA; Wako Pure Chemical), 250 mM sucrose (Wako Pure Chemical), 1 % Triton (Calbiochem-Novabiochem, La Jolla, CA, USA) and a protease inhibitor cocktail (Complete®; Roche Molecular Biochemicals, Mannheim, Germany), using an ultrasound homogenizer (UR-20P, TOMY SEIKO, Co., Ltd., Tokyo, Japan). The homogenates were homogenized again immediately after being centrifuged at 10,000 x g for 1 min at 4 °C. The homogenates were centrifuged at 1,000 x g for 1 min at 4 °C, and the supernatants were collected and stored as test samples at -70 °C for future analysis.
Page 6 of 27
An aliquot of test sample was diluted with an equal volume of electrophoresis sample buffer (Bio-Rad Laboratories, Co., Ltd., CA, USA). Proteins were separated by size on 4-20 % SDS-polyacrylamide gradient gel and transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories) in semi-dry electrophoretic transfer cell (Bio-Rad Laboratories).
ip t
5 % methanol (Wako Pure Chemical) added Tris-glycine buffer (Bio-Rad Laboratories) using a In addition, the molecular markers
(Precision plus protein dual color standards; Bio-Rad Laboratories) were loaded in lanes adjacent to
cr
sample lanes before the commencement of the run. For the immunoblot detection of tryptophan hydroxylase (TPH), membranes were blocked in 0.05 % Tween 20-Tris-Buffered Saline (TTBS)
us
containing 3 % bovine serum albumin (BSA; Sigma Aldrich, Co., Ltd., MO) for 1 hr at room temperature with agitation. The membrane was incubated with primary antibody for TPH (Sigma Chemical) diluted 1:1,000 in TTBS containing 3 % BSA overnight at 4 °C. The membranes were
an
washed in TTBS and then incubated for 30 min at room temperature with horseradish peroxidase-conjugated goat anti rabbit IgG (Jackson Immunoresearch Laboratories, Co., Ltd., PA, USA),
M
which was diluted 1:10,000 in TTBS containing 3 % BSA. After this incubation, the membranes were washed in TTBS. The antigen-antibody-peroxidase complex was then finally detected by enhanced chemiluminescence (Santa Cruz Biotechnology, Co., Ltd., CA, USA), and scanned, optimized and
te
2.5. Immunohistochemistry
d
analyzed by Chemi Doc XRS (Bio-Rad Laboratories).
In the immunohistochemical analysis, mice were deeply anesthetized with sodium pentobarbital (70
Ac ce p
mg/kg, i.p.) and perfusion-fixed with 4% paraformaldehyde (Wako Pure Chemical Industries Ltd., Osaka, Japan) in PBS. The brains were then quickly removed after perfusion, and thick coronal sections of the midbrain, including the dorsal raphe nuclei (DRN), were initially dissected using Brain Blocker. The brain coronal sections were postfixed in 4 % paraformaldehyde for 2 hr. After the brains were permeated with 20 % sucrose for 1 day and 30 % sucrose for 2 days, they were frozen in embedding compound (Sakura Finetechnical, Tokyo, Japan) on dry ice and stored at -30 °C until use. Frozen 10-μ-m-thick coronal sections were cut with a cryostat (Sakura Finetechnical) and thaw-mounted on amino silane coated glass slides (Matsunami Glass Ind., Ltd., Osaka, Japan). The brain sections were incubated with 10 % normal goat serum in ice-cold PBS for 60 min to block nonspecific antibody binding and then with the tryptophan hydroxylase (TPH) mouse monoclonal antibody (1:600; Sigma Chemical) for 2 days at 4 °C. The samples were then rinsed with PBS and incubated with the appropriate secondary antibody conjugated with Alexa 488 (1:1000) for 2 h at room temperature. The slides were then coverslipped with PermaFluor Aqueous mounting medium (Immunon, Pittsburgh, PA,
Page 7 of 27
USA). Fluorescence immunolabeling was detected using a confocal laser-scanning microscope (FV1000; Olympus Optical, Tokyo, Japan). The intensity of TPH-like immunoreactivity in dorsal raphe nuclei (DRN) was analyzed and quantified by computer-assisted densitometry using Image J software
ip t
(National Institutes of Health, MD).
2.6. RT-PCR
cr
Adult offspring that had been exposed to prenatal restraint stress was sacrificed by decapitation at 8 week-old. Their midbrain, containing raphe, were removed quickly. In addition, the embryonic
us
hindbrain was removed at GD12.5 from dams that had been exposed to restraint stress GD5.5-11.5. In the RNA preparation and semiquantitative analysis by reverse transcription-PCR, total RNA was extracted using the SV Total RNA Isolation System (Promega, Madison, WI, USA) following the
an
instructions of the manufacturer. Similarly, total RNA in the embryonic hindbrain was extracted. To prepare first strand cDNA, 1 μg of RNA was incubated in 100 μL of buffer containing 10 mM DTT, 2.5
M
mM MgCl2, dNTP mix, 200 U of reverse transcriptase III (Invitrogen, Carlsbad, CA, USA) and 0.1 mM oligo (dT) 12-18 (Invitrogen). The targeted genes were amplified in 50 μL of a PCR solution containing MgCl2, dNTP mix and DNA polymerase (Invitrogen) with synthesized primers. The sequences of
d
mouse gene-specific primers are provided in Table 1. Samples were heated to 94 °C for 5 min, 55 °C for 1 min, and 72 °C for 1 min, and cycled 35 times through 94 °C for 30 sec, 55 °C for 1 min, and 72 °C electrophoresis
with
the
te
for 1 min. The final incubation was at 72 °C for 7 min. The mixture was subjected to 2 % agarose gel indicated
markers
and
primers
for
the
internal
standard
Ac ce p
glyceraldehyde-3-phosphate dehydrogenase. Each sample was applied to more than two lanes in the same gel. The agarose gel was stained with ethidium bromide and photographed with ultraviolet transillumination. The intensity of the bands was analyzed and quantified by computer-assisted densitometry using NIH Image software.
2.7. Statistical analysis
The data are presented as the mean with S.E.M. The statistical analyses were performed using one-way ANOVA with the Bonferroni/Dunnett multiple comparison test or Student’s t-test.
Page 8 of 27
3. Results 3.1. Effects of exposure to prenatal restraint stress on the emotional response to acute or chronic restraint stress in mice as estimated by the hole-board test
ip t
The effects of exposure to acute or repeated restraint stress on the emotionality of mice that had been exposed to prenatal restraint stress as estimated by the hole-board test are shown in Figs. 1 and 2. A single exposure to restraint stress for 60 min induced significant decreases in the moving distance,
cr
rearing behaviors and head-dipping behaviors in the hole-board test in naive mice that had not been exposed to prenatal restraint stress (Fig. 1A-E). These emotional stress responses disappeared in naive
us
mice that were exposed to the same duration of restraint stress repeatedly once a day for 7 days (Fig. 2A-E), which suggests the development of stress adaptation. In contrast, mice that had been exposed
an
to prenatal restraint stress did not develop stress adaptation, and still showed a significant decrease in the number and duration of head-dipping behaviors after chronic exposure to restraint stress for 60 min/day for 7 days (Fig. 2D, E). CC (control-control) means the group of mice that had not been
M
exposed to prenatal stress and postnatal acute/chronic stress. CS (control-stress) means the group of mice that had not been exposed to prenatal stress and exposed to postnatal acute/chronic stress. SC (stress-control) means the group of mice that had been exposed to prenatal stress and not exposed to
d
postnatal acute/chronic stress. SS (stress-stress) means the group of mice that had been exposed to prenatal stress and postnatal acute/chronic stress. Each mean value was follows. (Fig.1) Number of
te
animals: CC: 10, CS: 12, SC: 7, SS: 7. Moving distance: CC: 3016 ± 215, CS: 1774 ± 291, SC: 2337 ± 188, SS: 1717 ± 299 (F(3,32)=5.486, p<0.01), Rearing count: CC: 35.7 ± 2.4, CS: 12.0 ± 3.1, SC: 26.1 ±
Ac ce p
4.8, SS: 12.0 ± 2.9 (F(3,32)=13.393, p<0.001). Rearing duration: CC: 36.4 ± 3.4, CS: 9.2 ± 2.7, SC: 24.1 ± 7.5, SS: 8.9 ± 2.6 (F(3,32)=11.537, p<0.001). Head dip count: CC: 33.1 ± 4.7, CS: 6.9 ± 2.2, SC: 27.1 ± 4.1, SS: 12.4 ± 2.8 (F(3,32)=13.093, p<0.001). Head dip duration: CC: 12.9 ± 2.6, CS: 2.8 ± 1.2, SC: 10.9 ± 2.5, SS: 3.6 ± 0.9 (F(3,32)=7.338, p<0.001). 18.
(Fig.2) Number of animals: CC: 15, CS: 17, SC: 15, SS:
Moving distance: CC: 2464 ± 123, CS: 2760 ± 194, SC: 2490 ± 131, SS: 1973 ± 209 (F(3,61)=3.792,
p<0.05). Rearing count: CC: 27.0 ± 2.8, CS: 20.5 ± 2.1, SC: 25.9 ± 2.6, SS: 19.2 ± 2.7 (F(3,61)=2.297, p=0.087). Rearing duration: CC: 26.3 ± 4.6, CS: 15.9 ± 2.1, SC: 22.6 ± 3.6, SS: 14.5 ± 2.5 (F(3,61)=3.000, p<0.05). Head dip count: CC: 32.5 ± 2.2, CS: 25.7 ± 2.4, SC: 29.9 ± 2.1, SS: 16.5 ± 2.0 (F(3,61)=10.613, p<0.001). Head dip duration: CC: 13.6 ± 1.5, CS: 9.3 ± 1.3, SC: 13.4 ± 1.6, SS: 5.8 ± 0.9 (F(3,61)=8.019, p<0.001).
3.2. Effects of exposure to prenatal restraint stress on the expression of tryptophan hydroxylase (TPH) in the raphe of mice exposed to chronic restraint stress.
Page 9 of 27
The change in the protein level of TPH in the mouse midbrain after exposure to chronic restraint stress is shown in Fig. 3. Western blotting showed that protein levels of whole-cell TPH in the midbrain were significantly increased in naive mice that had been exposed to chronic restraint stress for 60 In contrast, in prenatally stressed mice
ip t
min/day for 7 days, i.e. stress-adapted mice (Fig. 3B; p<0.05).
that had been exposed to chronic restraint stress for 60 min/day for 7 days, i.e. stress-maladaptive mice, protein levels of TPH were significantly decreased after chronic exposure to restraint stress (Fig. 3B; Immunohistochemical analysis showed a similar tendency (Fig. 3C, D). CC
cr
p<0.001).
(control-control) means the group of mice that had not been exposed to prenatal stress and postnatal
us
chronic stress. CS (control-stress) means the group of mice that had not been exposed to prenatal stress and exposed to postnatal chronic stress. SC (stress-control) means the group of mice that had been exposed to prenatal stress and not exposed to postnatal chronic stress. SS (stress-stress) means the group
an
of mice that had been exposed to prenatal stress and postnatal chronic stress. Each mean value was follows: (Fig.3B) Number of samples: CC: 8, CS: 7, SC: 7, SS: 8. CC: 100.0 ± 2.1, CS: 116.9 ± 7.0, SC:
M
111.4 ± 2.0, SS: 90.1 ± 6.5 (F(3,26)=5.714, p=0.004). (Fig.3D) Number of samples: CC: 8, CS: 7, SC: 7, SS: 8. CC: 100.0 ± 15.9, CS: 124.5 ± 12.5, SC: 129.0 ± 20.5, SS: 97.3 ± 18.2 (F(3,12)=0.918, p=0.462).
prenatally exposed to restraint stress.
d
3.3. Down-regulation of the expression of Lmx1b mRNAs in the embryonic hindbrain of mice that were
te
In the RT-PCR assay, exposure to prenatal restraint stress produced a significant decrease in Lmx1b mRNA (p<0.05, Fig. 4A, B) and a tendency for a decrease in Pet1 (p=0.06, Fig. 4C, D) mRNA
Ac ce p
production in the hindbrain of embryonic mice (GD 12.5). On the other hand, under these conditions, no changes in the levels of Mash1 (Fig. 4E, F) or Shh (Fig. 4G, H) mRNA were noted. Each mean value was follows: Lmx1b: CONT: 100.0 ± 5.8, PRS: 80.5 ± 4.0, Pet1: CONT: 100.0 ± 5.3, PRS: 88.8 ± 2.9, Mash1: CONT: 100.0 ± 6.8, PRS: 96.6 ± 3.3, Shh: CONT: 100.0 ± 4.1, PRS: 105.5 ± 5.1.
3.4. Down-regulation of the expression of Lmx1b mRNA in raphe of mice that were prenatally exposed to restraint stress.
In the RT-PCR assay, exposure to prenatal restraint stress produced a significant decrease in Lmx1b mRNA production in the midbrain, which contains raphe, of offspring (p<0.05, Fig. 5A, B). On the other hand, under these conditions, no changes in the levels of Pet1 mRNA were noted (Fig. 5C, D). Each mean value was follows: Lmx1b: CONT: 100.0 ± 5.5, PRS: 84.2 ± 1.6, Pet1: CONT: 100.0 ± 1.7, PRS: 103.3 ± 2.9.
Page 10 of 27
4. Discussion A growing body of evidence obtained from experimental studies using animal models and epidemiological studies in human populations suggests that prenatal stress is associated with adverse
ip t
health outcomes in offspring [37]. In a previous study, we also investigated the emotional abnormality in two types of prenatal stress in a model that is created by exposing pregnant mice to weak or strong restraint stress. We found that exposure to excessive prenatal stress could increase anxiety levels in
cr
offspring [23]. These results suggest that mice exposed to strong prenatal stress could reflect the clinical situation in which severe stressful situations during pregnancy impair the emotional
us
development of offspring.
On the other hand, Selye, who pioneered research on the biological effects of exposure to stress stimuli,
an
noticed that the body adapts to external stressors in terms of a biological pattern that is actually predictable, so that the internal balance, or homeostasis, is restored and maintained [38,39]. The ability to adapt to stress is an important defensive function of a living body, and impairment of this
M
ability may contribute to some stress-related disorders. In the present study, we investigated the association between exposure to prenatal stress and the ability to adapt to stress in adulthood. The present study demonstrated that a single exposure to restraint stress for 60 min produced a decrease in
d
the moving distance, head-dipping behaviors and rearing behaviors in naive mice, which had not been exposed to prenatal restraint stress, in the hole-board test, and these acute emotional responses were
te
recovered by exposure to repeated restraint stress for 60 min/day for 7 days. These findings are in good agreement with previous reports in rats [24-30], and confirm the development of stress adaptation.
Ac ce p
However, mice that had been exposed to prenatal restraint stress continued to show a decrease in head-dipping behavior in the hole-board test after chronic exposure to restraint stress for 60 min/day for 7 days. Because only exposure to prenatal stress failed to change the behaviors in hole-board, these behavioral abnormalities have not been caused by natural locomotive activity by hypoplasia in offspring. These results indicate that severe stressful situations during pregnancy impair the ability to adapt to stress in adulthood.
Previous studies in stress-adaptive and -maladaptive animals have provided evidence that an increase in brain 5-HT signaling may be a key factor in the adaptation to repeated exposure to stress [24-27]. We also found that 5-HT1A receptor agonists can produce emotional resistance to stress stimuli in mice [32-34].
Another key finding of the present study is that the rate-limiting enzyme in 5-HT synthesis,
tryptophan hydroxylase, was increased in raphe obtained from stress-adapted mice.
In contrast, a
decrease in tryptophan hydroxylase was observed in stress-maladapted mice that had been exposed to prenatal stress. These results indicate that the constitutive activation of brain 5-HT neurons could be
Page 11 of 27
necessary for the development of stress adaptation, and this mechanism may be affected by exposure to prenatal restraint stress. As mentioned above, a few preclinical reports have suggested that prenatal stress could affect central 5-HT neurons. Peters et al. reported that maternal stress increased fetal brain
ip t
5-HT synthesis in rats [18]. They also found that offspring that had been exposed to prenatal stress showed region-specific changes in brain 5-HT, 5-HIAA and noradrenaline levels in infancy [17]. Hayashi et al. reported that maternal stress induced synaptic loss associated with disruption of 5-HT
cr
neurotransmission and developmental disabilities in offspring [22]. In addition to these precedent articles, we previously reported that 5-HT-positive neurons were significantly increased in the dorsal
us
raphe nuclei (DRN) in the same model of prenatal stress as used in the present study [23]. Moreover, Konnno et al. reported that early postnatal stress induce abnormalities of emotional behavior of rats in elevated plus maze [40]. They also found that same behavior was observed in rats with raphe nuclei
an
lesions. These previous reports and our present findings suggest that prenatal stress could disrupt the development of central 5-HT neurons. Thus, future studies should focus on the changes in functional
M
molecules involved in the development of 5-HT neurons.
With the accumulation of recent preclinical reports, the mechanisms that underlie the development of 5-HT neurons are becoming clear. The synthesis of 5-HT neurons is restricted to a very limited
d
number of cells in the brainstem raphe nuclei with a vast axonal network. These cells express markers of the serotonin lineage, such as the rate-limiting enzyme in serotonin synthesis, tryptophan hydroxylase
te
2, a serotonin transporter, and transcription factors. Pet1, LIM homeobox transcription factor 1b (Lmx1b), NK transcription factor-related, locus 2 (Nkx2.2), Mouse achaete-scute homolog 1 (Mash1),
Ac ce p
GATA-motif binding (Gata) 2, Gata3, and Paired-like homeodomain protein 2b (Phox2b) form a transcriptional network, which specifies the differentiation of serotonergic neurons around embryonic day 11 in the mouse [41-46]. These cells are generated in rhombomeres r1-r3 and r5-r7 caudal to the midbrain-hindbrain organizer under the control of fibroblast growth factors 4 and 8 and sonic hedgehog (Shh) from precursors, which have produced motoneurons before. In the present study, the RT-PCR assay show a significant decrease in Lmx1b mRNA and a tendency for a decrease in Pet1 mRNA production in the hindbrain of embryonic mice (GD12.5) that had been exposed to prenatal stress. On the other hand, under these conditions, no changes in the levels of Mash1 and Shh mRNA were noted. Lmx1b and Pet1 participate in the specification and differentiation of serotonergic neurons, whereas Shh and Mash1 play an important role in the development of various neurons. Therefore, the present findings indicate that prenatal restraint stress disrupts the specification and differentiation of serotonergic neurons through a decrease in the expression of Pet1 and Lmx1b.
Page 12 of 27
The RT-PCR assay also showed that the expression of Lmx1b, but not Pet1, was downregulated in raphe of adult mice that had been exposed to prenatal restraint stress. Pet1 and Lmx1b are also expressed in adult raphe nuclei and are required across the lifespan of the mouse.
Behavioral
ip t
pathogenesis can result from both developmental and adult-onset alterations in serotonergic transcription [47-49]. In addition, while Lmx1b and Pet1 likely act in parallel to regulate central 5-HTergic systems, some of the expression of Lmx1b in adult brain is independent of Pet1 [49].
cr
Interestingly, Dai et al. reported that the contextual fear learning and memory induced by foot-shock conditioning was markedly enhanced in the 5-HT deficient mice achieved by inactivating Lmx1b
us
selectively in raphe nuclei [50]. This report strongly suggests that Lmx1b also play a critical role in functional regulation of raphe 5-HT neurons. Taken together, these findings suggest that the functional disruption of Lmx1b-positive 5-HT neurons may be induced by excessive prenatal stress.
an
In summary, we found that excessive prenatal stress induced long-term emotional vulnerability to stress associated with functional abnormalities in central 5-HT neurons in mice. Furthermore, the
M
disruption of 5-HT neuron development seems to also be induced by exposure to stress during gestation. The present findings provide evidence that prenatal stress is an important risk factor that may underlie
Ac ce p
te
d
the presence of neuropsychiatric disorders in adulthood.
Page 13 of 27
【Figure legends】 Fig. 1 Effect of prenatal restraint stress on the behavioral responses of mice to acute restraint stress in
ip t
the hole-board test. A single exposure to restraint stress for 60 min induced significant decreases in the moving distance (A), rearing counts (B) and duration (C), and head-dip counts (D) and duration (E) in the hole-board in control naive mice (CC vs CS). Similar phenomena were observed in mice that
cr
had been exposed to prenatal restraint stress (SC vs SS). Each column represents the mean with SEM of 7-12 mice. *p<0.05, **p<0.01, ***p<0.001 vs CC, #p<0.05, ##p<0.01###p<0.001 vs CS, $p<0.05 vs
us
SC. CC; control - control, CS; control - exposure to acute restraint stress, SC; exposure to prenatal
an
restraint stress - control, SS; exposure to prenatal restraint stress - exposure to acute restraint stress. Fig. 2
Effect of prenatal restraint stress on the behavioral responses of mice to chronic restraint stress in
M
the hole-board test. Chronic exposure to restraint stress (60 min / day, 7 days) in adulthood did not affect the moving distance (A), rearing counts (B) or duration (C), or head-dip counts (D) or duration (E) in the hole-board in control mice. On the other hand, significant changes in head-dip counts (D)
d
and duration (E) were observed in mice that had been exposed to prenatal restraint stress. Each column represents the mean with SEM of 15-18 mice. *p<0.05, ***p<0.001 vs CC, ##p<0.01 vs CS,
te
$$p<0.01 vs SC. CC; control - control, CS; control - exposure to acute restraint stress, SC; exposure to prenatal restraint stress - control, SS; exposure to prenatal restraint stress - exposure to acute restraint
Fig. 3
Ac ce p
stress.
Effect of strong prenatal restraint stress on the expression of tryptophan hydroxylase (TPH) in the raphe of mice exposed to chronic restraint stress. (A) Representative Western blotting for TPH proteins. (B) Chronic exposure to restraint stress (60 min / day, 7 days) in adulthood increased TPH levels in the raphe of control naive mice. On the other hand, a significant decrease in the TPH level was observed in prenatally stressed mice after chronic exposure to restraint stress. Each column represents the mean with SEM of 7-8 mice. *p<0.05 vs CC, ###p<0.001 vs CS, $$p<0.01 vs SC. Scale bars: 200 µm. (C) Typical photographs of TPH-like immunoreactivity (IR) in the DRN mice. (D) The results of a quantitative analysis of TPH-IR in the DRN are shown in panel D. Chronic exposure to restraint stress in adulthood also tend to increased TPH-like immunoreactivities (IRs) in the dorsal raphe nuclei of control naive mice.
On the other hand, a tending to decrease in TPH-IRs was observed in
Page 14 of 27
prenatally stressed mice after chronic exposure to restraint stress. The column represents the mean with SEM of 4 independent samples. CC; control - control, CS; control - exposure to acute restraint stress, acute restraint stress. GAPDH; glyceraldehyde-3-phosphate dehydrogenase. Fig. 4
ip t
SC; exposure to prenatal restraint stress - control, SS; exposure to prenatal restraint stress - exposure to
in the hindbrain of embryonic mice.
cr
Effect of strong prenatal restraint stress on the expression of Lmx1b, Pet1, Mash1 and Shh mRNA Representative RT-PCR for Lmx1b (A), Pet1 (C), Mash1 (E)
us
and Shh (G) mRNA in the hindbrain of prenatal restraint stress-exposed and control naive embryonic mice. A significant decrease in the expression of Lmx1b (B) and a tendency for a decrease in the expression of Pet1 (D) mRNA were observed in the hindbrain of embryonic mice that had been
an
prenatally exposed to restraint stress. On the other hand, no changes were observed in the expression of Mash1 (F) and Shh (H) mRNAs. Each column represents the mean with SEM of 3 independent dams.
M
*p<0.05 vs. control mice. CONT; control, PRS; prenatal restraint stress, Pet1; pheochromocytoma 12 ETS, Lmx1b; LIM homeobox transcription factor 1 beta, Mash1; mouse achaete-scute homolog 1, Shh;
d
sonic hedgehog. GAPDH; glyceraldehyde-3-phosphate dehydrogenase. Fig. 5
of mice.
te
Effect of strong prenatal restraint stress on the expression of Lmx1b and Pet1 mRNA in the raphe Representative RT-PCR for Lmx1b (A) and Pet1 (C) mRNA in the raphe of prenatal restraint
Ac ce p
stress-exposed and control naive mice. A significant decrease in the expression of Lmx1b (B), but not Pet1 (D), mRNA was observed in the raphe of mice that were exposed to restraint stress prenatally. Each column represents the mean with SEM of 9 mice. *p<0.05 vs. control mice. CONT: control, PRS: prenatal restraint stress. Lmx1b; LIM homeobox transcription factor 1 beta, Pet1; pheochromocytoma 12 ETS. GAPDH; glyceraldehyde-3-phosphate dehydrogenase.
Page 15 of 27
【Referece】 1.
Kitamura T, Shima S, Sugawara M, Toda MA. Psychological and social correlates of the onset of
2.
ip t
affective disorders among pregnant women. Psychol Med 1993; 23: 967-75. [PMID: 8134520]
Field T, Diego M, Hernandez-Reif M. Prenatal depression effects on the fetus and newborn: a review. Infant Behav Dev 2006; 29: 445-55. [PMID: 17138297]
Koenig JI, Kirkpatrick B, Lee P. Glucocorticoid hormones and early brain development in
cr
3.
schizophrenia. Neuropsychopharmacology 2002; 27: 309-18. [PMID: 12093605]
Walker E, Mittal V, Tessner K. Stress and the hypothalamic pituitary adrenal axis in the
us
4.
developmental course of schizophrenia. Annu Rev Clin Psychol 2008; 4: 189-216. [PMID: 5.
an
18370616]
Ronald A, Pennell CE, Whitehouse AJ. Prenatal Maternal Stress Associated with ADHD and Autistic Traits in early Childhood. Front Psychol 2010; 1: 223. [PMID: 21833278] Vallée M, Mayo W, Dellu F, Le Moal M, Simon H, Maccari S. Prenatal stress induces high anxiety
M
6.
and postnatal handling induces low anxiety in adult offspring: correlation with stress-induced corticosterone secretion. J Neurosci 1997; 17: 2626-36. [PMID: 9065522] Nishio H, Kasuga S, Ushijima M, Harada Y. Prenatal stress and postnatal development of neonatal
d
7.
te
rats--sex-dependent effects on emotional behavior and learning ability of neonatal rats. Int J Dev Neurosci 2001; 19: 37-45. [PMID: 11226753] 8.
Dugovic C, Maccari S, Weibel L, Turek FW, Van Reeth O. High corticosterone levels in
Ac ce p
prenatally stressed rats predict persistent paradoxical sleep alterations. J Neurosci 1999; 19: 8656-64. [PMID: 10493766] 9.
Hayashi A, Nagaoka M, Yamada K, Ichitani Y, Miake Y, Okado N. Maternal stress induces synaptic loss and developmental disabilities of offspring. Int J Dev Neurosci 1998; 16: 209-16. [PMID: 9785117]
10.
Vallée M, MacCari S, Dellu F, Simon H, Le Moal M, Mayo W. Long-term effects of prenatal stress and postnatal handling on age-related glucocorticoid secretion and cognitive performance: a longitudinal study in the rat. Eur J Neurosci 1999; 11: 2906-16. [PMID: 10457187]
11.
Secoli SR, Teixeira NA. Chronic prenatal stress affects development and behavioral depression in rats. Stress 1998; 2: 273-80. [PMID: 9876258]
12.
Zimmerberg B, Blaskey LG. Prenatal stress effects are partially ameliorated by prenatal administration of the neurosteroid allopregnanolone. Pharmacol Biochem Behav 1998; 59: 819-27. [PMID: 9586837]
Page 16 of 27
13.
Alonso SJ, Castellano MA, Quintero M, Navarro E. Action of antidepressant drugs on maternal stress-induced hypoactivity in female rats. Methods Find Exp Clin Pharmacol 1999; 21: 291-5. [PMID: 10399138] Lehmann J, Stöhr T, Feldon J. Long-term effects of prenatal stress experiences and postnatal
ip t
14.
maternal separation on emotionality and attentional processes. Behav Brain Res 2000; 107: 133-44. [PMID: 10628737]
Lephart ED, Watson MA, Jacobson NA, Rhees RW, Ladle DR. Calbindin-D28k is regulated by
cr
15.
adrenal steroids in hypothalamic tissue during prenatal development. Brain Res Dev Brain Res 16.
us
1997; 100: 117-20. [PMID: 9174253]
Szuran TF, Pliska V, Pokorny J, Welzl H. Prenatal stress in rats: effects on plasma corticosterone, hippocampal glucocorticoid receptors, and maze performance. Physiol Behav 2000; 71: 353-62.
17.
an
[PMID: 11150568]
Peters DA. Prenatal stress: effects on brain biogenic amine and plasma corticosterone levels.
18.
M
Pharmacol Biochem Behav 1982; 17: 721-5. [PMID: 6184733]
Peters DA. Maternal stress increases fetal brain and neonatal cerebral cortex 5-hydroxytryptamine synthesis in rats: a possible mechanism by which stress influences brain development. Pharmacol
19.
d
Biochem Behav 1990; 35: 943-7. [PMID: 1693214]
Weinstock M. Does prenatal stress impair coping and regulation of hypothalamic-pituitary-adrenal
20.
te
axis? Neurosci Biobehav Rev 1997; 21: 1-10. [PMID: 8994205] Murphy DL, Pigott TA. A comparative examination of a role for serotonin in obsessive
Ac ce p
compulsive disorder, panic disorder, and anxiety. J Clin Psychiatry 1990; 51 Suppl: 53-8; discussion 59-60. [PMID: 2139026] 21.
Nordquist N, Oreland L. Serotonin, genetic variability, behaviour, and psychiatric disorders--a review. Ups J Med Sci 2010; 115: 2-10. [PMID: 20187845]
22.
Hayashi A, Nagaoka M, Yamada K, Ichitani Y, Miake Y, Okado N. Maternal stress induces synaptic loss and developmental disabilities of offspring. Int J Dev Neurosci 1998; 16: 209-16. [PMID: 9785117]
23.
Miyagawa K, Tsuji M, Takeda H. Possible involvement of histone acetylation in the development of emotional resistance to stress stimuli in mice. Behav Brain Res 2012; 235: 318-25. [PMID: 22963996]
24.
Kennett GA, Dickinson SL, Curzon G. Central serotonergic responses and behavioural adaptation to repeated immobilisation: the effect of the corticosterone synthesis inhibitor metyrapone. Eur J Pharmacol 1985; 119: 143-52. [PMID: 4092729]
Page 17 of 27
25.
Kennett GA, Dickinson SL, Curzon G. Enhancement of some 5-HT-dependent behavioural responses following repeated immobilization in rats. Brain Res 1985; 330: 253-63. [PMID: 4039215] Kennett GA, Chaouloff F, Marcou M, Curzon G. Female rats are more vulnerable than males in an
ip t
26.
animal model of depression: the possible role of serotonin. Brain Res 1986; 382: 416-21. [PMID: 3756525]
Ohi K, Mikuni M, Takahashi K. Stress adaptation and hypersensitivity in 5-HT neuronal systems
cr
27.
after repeated foot shock. Pharmacol Biochem Behav 1989; 34: 603-8. [PMID: 2623017] Haleem DJ, Parveen T. Brain regional serotonin synthesis following adaptation to repeated restraint. Neuroreport 1994; 5: 1785-8. [PMID: 7827332] 29.
us
28.
Haleem DJ. Adaptation to repeated restraint stress in rats: failure of ethanol-treated rats to adapt in
30.
an
the stress schedule. Alcohol Alcohol 1996; 31: 471-7. [PMID: 8949963]
Tsuji M, Takeda H, Matsumiya T. Brain 5-HT1A receptors as important mediators in the
31.
M
development of stress adaptation. Curr Neuropharmacol 2003; 1: 315-24. Tsuji M, Takeuchi T, Miyagawa K, Ishii D, Imai T, Takeda K, Kitajima M, Takeda H. Yokukansan, a traditional Japanese herbal medicine, alleviates the emotional abnormality induced 32.
d
by maladaptation to stress in mice. Phytomedicine 2013. [PMID: 24129119] Tsuji M, Takeda H, Matsumiya T. Different effects of 5-HT1A receptor agonists and
te
benzodiazepine anxiolytics on the emotional state of naive and stressed mice: a study using the hole-board test. Psychopharmacology (Berl) 2000; 152: 157-66. [PMID: 11057519] Tsuji M, Takeda H, Matsumiya T. Protective effects of 5-HT1A receptor agonists against
Ac ce p
33.
emotional changes produced by stress stimuli are related to their neuroendocrine effects. Br J Pharmacol 2001; 134: 585-95. [PMID: 11588113] 34.
Tsuji M, Takeda H, Matsumiya T. Modulation of passive avoidance in mice by the 5-HT1A receptor agonist flesinoxan: comparison with the benzodiazepine receptor agonist diazepam. Neuropsychopharmacology 2003; 28: 664-74. [PMID: 12655311]
35.
Takeda H, Tsuji M, Matsumiya T. Changes in head-dipping behavior in the hole-board test reflect the anxiogenic and/or anxiolytic state in mice. Eur J Pharmacol 1998; 350: 21-9. [PMID: 9683010]
36.
Tsuji M, Takeda H, Matsumiya T. Different effects of 5-HT1A receptor agonists and benzodiazepine anxiolytics on the emotional state of naive and stressed mice: a study using the hole-board test. Psychopharmacology (Berl) 2000; 152: 157-66. [PMID: 11057519]
37.
Beydoun H, Saftlas AF. Physical and mental health outcomes of prenatal maternal stress in human and animal studies: a review of recent evidence. Paediatr Perinat Epidemiol 2008; 22: 438-66.
Page 18 of 27
[PMID:18782252] 38.
Selye H. Syndrome produced by diverse nocuous agents. Nature 1936; 138: 32. [PMID: 9722327]
39.
SELYE H. The general adaptation syndrome and the diseases of adaptation. J Clin Endocrinol
40.
ip t
Metab 1946; 6: 117-230. [PMID: 21025115]
Konnno K, Matsumoto M, Togashi H, Yamaguchi T, Izumi T, Watanabe M, Iwanaga T, Yoshioka M. Early postnatal stress affects the serotonergic function in the median raphe nuclei of adult rats.
41.
cr
Brain Res 2007; 1172: 60-6. [PMID: 17825274]
Hendricks T, Francis N, Fyodorov D, Deneris ES. The ETS domain factor Pet-1 is an early and genes. J Neurosci 1999; 19: 10348-56. [PMID: 10575032]
42.
us
precise marker of central serotonin neurons and interacts with a conserved element in serotonergic Hendricks TJ, Fyodorov DV, Wegman LJ, Lelutiu NB, Pehek EA, Yamamoto B, Silver J, Weeber
an
EJ, Sweatt JD, Deneris ES. Pet-1 ETS gene plays a critical role in 5-HT neuron development and is required for normal anxiety-like and aggressive behavior. Neuron 2003; 37: 233-47. 43.
M
[PMID:12546819]
Brunet JF, Pattyn A. Phox2 genes - from patterning to connectivity. Curr Opin Genet Dev 2002; 12: 435-40. [PMID: 12100889]
Pattyn A, Vallstedt A, Dias JM, Samad OA, Krumlauf R, Rijli FM, Brunet JF, Ericson J.
d
44.
Coordinated temporal and spatial control of motor neuron and serotonergic neuron generation from 45.
te
a common pool of CNS progenitors. Genes Dev 2003; 17: 729-37.
[PMID: 12651891]
Pattyn A, Simplicio N, van Doorninck JH, Goridis C, Guillemot F, Brunet JF. Ascl1/Mash1 is
Ac ce p
required for the development of central serotonergic neurons. Nat Neurosci 2004; 7: 589-95. [PMID: 15133515] 46.
Alenina N, Bashammakh S, Bader M. Specification and differentiation of serotonergic neurons. Stem Cell Rev 2006; 2: 5-10. [PMID: 17142880]
47.
Dai JX, Hu ZL, Shi M, Guo C, Ding YQ. Postnatal ontogeny of the transcription factor Lmx1b in the mouse central nervous system. J Comp Neurol 2008; 509: 341-55. [PMID: 18512225]
48.
Liu C, Maejima T, Wyler SC, Casadesus G, Herlitze S, Deneris ES. Pet-1 is required across different stages of life to regulate serotonergic function. Nat Neurosci 2010; 13: 1190-8. [PMID: 20818386]
49.
Song NN, Xiu JB, Huang Y, Chen JY, Zhang L, Gutknecht L, Lesch KP, Li H, Ding YQ. Adult raphe-specific deletion of Lmx1b leads to central serotonin deficiency. PLoS One 2011; 6: e15998. [PMID: 21246047]
50.
Dai JX, Han HL, Tian M, Cao J, Xiu JB, Song NN, Huang Y, Xu TL, Ding YQ, Xu L. Enhanced
Page 19 of 27
contextual fear memory in central serotonin-deficient mice. Proc Natl Acad Sci USA 105(33);
Ac ce p
te
d
M
an
us
cr
ip t
11981-6. [PMID: 18695238]
Page 20 of 27
Research Highlights 1. Acute emotional stress response disappeared in naive mice that had been exposed to repeated 2. Prenatally stressed mice did not develop this stress adaptation.
ip t
restraint stress.
3. A decrease in tryptophan hydroxylase was observed in stress-maladaptive mice.
cr
4. The transcription factor Lmx1b was decreased in the embryonic hindbrain and adult raphe of
Ac ce p
te
d
M
an
us
prenatally stressed mice.
Page 21 of 27
Figure(s)
cs
sc
ss
(C)
ss
ip t sc
an
ss
###
M
ed
sc
cs
*** $ ***
cc
cs
sc
ss
pt
cs
$
Head dip count (counts/5 min)
Rearing duration (sec/5 min)
***
***
cc
ce
(E)
##
Ac
Head dip duration (sec/5min)
cc
(D)
*#
*** $
***
cr
cc
**
##
us
Moving distance (cm)
**
Rearing count (counts/5 min)
(B)
(A)
** $
***
cc
cs
sc
Prenatal stress
Postnatal acute stress
Abbreviat ions
−
−
CC
−
+
CS
+
−
SC
+
+
SS
ss
Page 22 of 27
(A)
sc
(D)
ip t cc
cs
an
sc
sc
Ac
ce
pt
ss
cc
cs
sc
*** $$
cc
ss
*** ## $$
M cs
ed
cc (E) Head dip duration (sec/5min)
ss
cr
cs
Head dip count (counts/5 min)
cc
Rearing duration (sec/5 min)
(C)
us
Moving distance (cm)
Rearing count (counts/5 min)
(B)
cs
sc
ss
Prenatal stress
Postnatal chronic stress
Abbrevi ations
−
−
CC
−
+
CS
+
−
SC
+
+
SS
ss
Page 23 of 27
(Figure 2)
(C)
(kDa) 75 50
TPH
37 25
GAPDH
cc CC
CS
SC
cs
ip t
(A)
SS
sc
ss
CC
CS
SC
M
an
% of CC
### $$
us
*
cr
(B)
SS
ed
(D)
160
Abbrevi ations
−
−
CC
−
+
+
−
+
+
ce
Ac
CS
SC SS
140 120 100
% of CC
Postnatal chronic stress
pt
Prenatal stress
80 60 40 20 0 CC
CS
SC
SS
Page 24 of 27
(Figure 3)
Lmx1b
Pet1
GAPDH
GAPDH
(D)
PRS
M
CONT (E)
GAPDH PRS
ce
pt
CONT
Ac
% of control
(F)
ed
Mash1
CONT
PRS
PRS
cr
an
*
CONT
us
PRS
% of control
% of control
CONT
(G)
CONT
PRS
Shh GAPDH
(H)
CONT
PRS
% of control
(B)
ip t
(C)
(A)
CONT
PRS
Page 25 of 27
(Figure 4)
ip t Pet1
CONT
PRS
CONT
(D)
PRS
PRS
CONT
PRS
Ac
ce
pt
CONT
ed
M
% of control
*
% of control
us
GAPDH
GAPDH
(B)
cr
(C)
Lmx1b
an
(A)
Page 26 of 27
(Figure 5)
us
cr
ip t
Table(s)
Table 1. Primer sequences
antisense primer (5'-3')
Length
Pet1
CGCACTTGGGGGGTCATTATCAC
GCCTGATGTTCAAGGAAGACCTCGG
210bp
Lmx1b
GCAGCGGCTGCATGGAGAAGATCGC
GGTTCTGAAACCAGACCTGGACCAC
465bp
Mash1
GGCTCAACTTCAGCGGCTTC
GTTGGTAAAGTCCAGCAGCTC
398bp
Shh
CTGGCCAGATGTTTTCTGGT
GAPDH
CCCACGGCAAGTTCAACGG
M
an
sense primer (5'-3’)
CATGTCGGGGTTGTAATTGG
427bp bp = base pairs
Ac
ce
pt
ed
CTTTCCAGAGGGGCCATCCA
243bp
Page 27 of 27