- Email: [email protected]
Prenatal zinc supplementation attenuates lipopolysaccharide-induced behavioral impairments in maternal immune activation model
Behavioural Brain Research 377 (2020) 112247
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Research report
Prenatal zinc supplementation attenuates lipopolysaccharide-induced behavioral impairments in maternal immune activation model
T
⁎
Faezeh Alizadeha, Nahid Davoodianb,c, , Haniyeh Kazemib, Maryam Ghasemi-Kasmand,e, Fatemeh Shaerzadehf a
Endocrinology and Metabolism Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran Molecular Medicine Research Center, Hormozgan Health Institute, Hormozgan University of Medical Sciences, Bandar Abbas, Iran c Department of Clinical Biochemistry, Faculty of Medicine, Hormozgan University of Medical Sciences, Bandar Abbas, Iran d Infertility and Reproductive Health Research Center, Health Research Institute, Babol University of Medical Science, Babol, Iran e Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical Sciences, Babol, Iran f Department of Neuroscience, University of Florida College of Medicine and McKnight Brain Institute, Gainesville, FL, 32610, USA b
A R T I C LE I N FO
A B S T R A C T
Keywords: Zinc supplementation Schizophrenia Lipopolysaccharide Working memory Neurodevelopmental deficits
Maternal infection during pregnancy is considered a key risk factor for developing schizophrenia in offspring. There is evidence that maternal exposure to infectious agents is associated with fetal zinc deficiency. Due to the essential role of zinc in brain function and development, in the present study, we activated maternal immune system using lipopolysaccharide (LPS) as a model of schizophrenia to examine whether zinc supplementation throughout pregnancy can reverse LPS-induced deleterious effects. To test the hypothesis, pregnant rats were treated with intraperitoneal injection of either saline or LPS (0.5 mg/kg) at gestational day 15 and 16, and zinc supplementation (30 mg/kg) was administered throughout pregnancy by gavage. At postnatal day 60, Y-maze was used to evaluate working memory of offspring. Moreover, the expression levels of catechol O-methyltransferase (COMT) and glutamate decarboxylase 67 (GAD67) were measured in the frontal cortex of the brain samples. Only male offspring prenatally exposed to LPS showed a significant impairment in working memory. In addition, prenatal LPS exposure causes a moderate decrease in GAD67 expression level in the male pups, while COMT expression was found unchanged. Interestingly, zinc supplementation restored the alterations in working memory as well as GAD67 mRNA level in the male rats. No alteration was detected for neither working memory nor COMT/GAD67 genes expression in female offspring. This study demonstrates that zinc supplementation during pregnancy can attenuate LPS-induced impairments in male pups. These results support the idea to consume zinc supplementation during pregnancy to limit neurodevelopmental deficits induced by infections in offspring.
1. Introduction Schizophrenia is a devastating mental illness affecting an estimated one percent of the world’s population with a higher incidence and earlier onset in males compared to females [1]. Currently, there is no single physical or lab test for schizophrenia and diagnosis is typically based on the behavioral criteria [2]. The clinical features of schizophrenia, which disturb cognition, behavior, perception, and thought, are typically classified into positive, negative, and cognitive symptoms. Positive symptoms, which characterized by the existence of abnormal behavior, include hallucinations, delusions, and catatonic behavior. Negative symptoms, reflecting the absence of normal functions, include
⁎
lack of emotion and interest in life and social withdrawal, while cognitive symptoms are specifically connected to memory, attention, and executive functions [3]. As a multifactorial mental disease, genetic and environmental factors have been identified to be involved in the pathogenesis of schizophrenia [3]. To date, there is a large body of evidence supporting the role for maternal infection and prenatal complications to disturb neurodevelopment which is associated with an elevated risk to develop schizophrenia [4–6]. In line with these findings, animal studies have confirmed that prenatal exposure to infectious agents such as lipopolysaccharide (LPS) and viral mimic polyinosinic-polycytidilic acid (Poly I:C) leads to maternal immune stimulation and ultimately behavioral
Corresponding author at: Department of Biochemistry, Faculty of Medicine, Hormozgan University of Medical Sciences, Bandar Abbas, Iran. E-mail address: [email protected] (N. Davoodian).
https://doi.org/10.1016/j.bbr.2019.112247 Received 7 July 2019; Received in revised form 5 September 2019; Accepted 16 September 2019 Available online 20 September 2019 0166-4328/ © 2019 Elsevier B.V. All rights reserved.
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
deficiency which leads to teratogenicity in fetus [25]. Similar findings were also reported by Chua et al. showing a reduced maternal plasma zinc concentration upon LPS administration (0.5 mg/kg, s.c.) on GD16 in mice [26]. In the present study, we utilized maternal immune activation using LPS as a model of schizophrenia to examine whether zinc supplementation throughout pregnancy can reserve LPS-induced behavioral impairments which were performed by Y-maze tests. In addition, we evaluated the effect of zinc supplementation on LPS mediated changes in GAD67 and COMT mRNA levels in frontal cortex using quantitative real-time PCR (qPCR).
and neurobiological abnormalities related to schizophrenia. As such, different protocols in term of infectious agent’s dose, administration at various time points during gestation, and single or repeated injections have been reported by several in vivo studies which suggested maternal immune activation (MIA) as an excellent model to evaluate the pathophysiology of this psychiatric disease [7–10]. In this context, it is important to note that MIA animal model is a neurodevelopmental model with construct validity for both schizophrenia and autism spectrum disorders (ASD) and predictive validity for schizophrenia. Interestingly, MIA offspring exhibit behavioral impairments, abnormalities in gene expression, and neuropathology associated with both ASD and schizophrenia [11]. Although the particular molecular and cellular mechanisms of schizophrenia are yet to be fully determined, several prominent hypothesizes including dopaminergic, glutamatergic, immune, gamma aminobutyric acid (GABAergic) and neurodevelopmental hypothesis have been identified to be involved in schizophrenia pathophysiology [3]. Of particular interest is dopamine hypothesis which have been based on the fact that all common antipsychotic drugs block the dopamine D2 receptors. Interestingly, the decreased dopaminergic neurotransmission in prefrontal cortex (PFC) has been speculated to be linked to the negative symptoms in schizophrenic patients [12]. In this regard, alterations in gene expression and functional polymorphism of catechol O-methyltransferase (COMT), a key enzyme involved in dopamine inactivation, have been reported as a risk factor for abnormality of dopamine neurotransmission in PFC and schizophrenia development [13,14]. Of additional interest is GABAergic system of brain which has been found to be implicated in the disease pathology. Indeed, dysregulation of the 67 kDa isoform of glutamic acid decarboxylase (GAD67), which is involved in the GABA biosynthesis, has been reported in prefrontal and other brain regions of schizophrenia suffering patients [15]. Nutritional deficiencies such as mineral dyshomeostasis and vitamins deficiencies has been linked to a number of neurological abnormalities including schizophrenia [16]. Consistent with this, numerous investigators have pointed to zinc dyshomeostasis as a key player in depression and several psychiatric disorders [17–19]. Zinc, as a second the most abundant trace element in human body, is required for many biological processes such as immune responses, cell growth and division, wound healing, development and most importantly nervous system functions [20]. Zinc dyshomeostasis in the central nervous system leads to disturbance in synaptic plasticity, cognitive decline, memory and learning impairment [19,21]. In support of this, several animal studies showing a correlation between prenatal zinc deficiency and offspring behavior, cognitive [22], and immune impairments [23] have demonstrated that zinc supplementation of pregnant rats can recover the mentioned deficits in pups. Added to this, a recent study has reported the beneficial effect of zinc supplementation on prevention of offspring neurochemical, biochemical, and behavioral deficits induced by maternal LPS exposure [24]. Of note, it has been shown that maternal exposure to infectious agents is associated with fetal zinc
2. Material and methods 2.1. Animal Wistar rats (12–16 weeks old, 250–270 g; Hormozgan University of Medical Sciences) were kept in a controlled temperature and humidity environment (22 °C/60–70%) with a 12:12 h light-dark cycle (light on: 7 a.m. to 7 p.m.) and unlimited access to food and water. Animal care and experiments were carried out based on National Institutes of Health guide for the care and use of laboratory animals and all experimental protocols used in this study were approved by the local Institutional Ethics Committee approval (HUMS.REC.1396.45).
2.2. Treatment The male and female rats were mated and pregnancy was confirmed by detecting spermatozoa in vaginal smears at the first day after mating (gestational day 1, GD1). From the first day of pregnancy confirmation, the pregnant rats were randomly divided into four groups as follows: Group 1 (control + vehicle, 6 litters) and Group 2 (LPS + vehicle, 6 litters): pregnant rats were treated with intraperitoneal (i.p.) injection of either saline or LPS (0.5 mg/kg) at GD15 and 16, respectively, and also gavaged with vehicle (water) throughout their pregnancy [10]. Group 3 (LPS + Zinc, 6 litters): pregnant rats were administered i.p. injection of LPS (0.5 mg/kg) on GD15-16 and also gavaged with ZnSO4 (30 mg/kg) daily throughout the gestational period [27]. Group 4 (saline + Zinc, 6 litters): pregnant rats received injection of saline (i.p.) on GD15-16 and meanwhile were daily supplemented with ZnSO4 (30 mg/kg) through 21 days of pregnancy (Fig. 1). In the current study, subjects were both female and male offspring which born to these dams. Pups were distributed by sex and treatment on postnatal day (PND) 21 and left undisturbed until behavioral and biochemical experiments at PND 60. For behavioral tests, 2 animals per litter was used. However, to avoid litter effects, the mean of animals within litter was calculated (n = 6). For qPCR, we used one animal per litter (n = 6). The tissues from the excess animals were processed for other experiments not reported here.
Fig. 1. Experimental design. Pregnant rats were received zinc supplementation (30 mg/kg) throughout pregnancy. LPS (0.5 mg/kg, i.p.) or saline was administrated on GD15 and 16. On PND 60, The resulting offspring were subjected to behavioral tests using Y-maze. Afterwards, all pups were sacrificed and the frontal cortex of brain were collected for qPCR. GD: gestational day, PND: postnatal day, LPS: lipopolysaccharide. 2
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
2.3. Behavioral tests
Table 1 Primer sequences for qPCR analysis.
The Y-maze test was conducted to investigate whether prenatal zinc supplementation had any modulating effect on working memory impairment induced by LPS [28]. For this reason, female and male offspring were subjected to both novel recognition test and spontaneous alteration performance around PND 60. Prior to the tests, the pups were handled for three days (5 min daily) and testing was performed during the light cycle between 9 a.m. to 12 a.m.
Genes
Accession No. Primer
Sequences
GAD67
NM_017007.1 Sense Antisense NM_012531.2 Sense Antisense NM_017008.4 Sense Antisense
5'5'5'5'5'5'-
COMT GAPDH
2.3.1. Y-maze spontaneous alternation performance Spatial working memory was assessed using a symmetrical Y-maze consisting of 3 arms with 50 cm length and 10 cm width as described previously [28]. The procedure was a single 8 min session in which every rat was randomly placed at the end of one arm and allowed to explore all three arms freely. Meanwhile, each series of arm entry (defined as when all four paws of the animal were completely within the arm) was visually recorded. The percentage of spontaneous alternation was calculated according to the following formula: Number of alternations/ (total number of arm entries-2) ×100, in which alternation was considered as the number of successive entries in three different arms (ABC, BCA, CBA, etc.).
GCTGGAAGGCATGGAAGGTTTTA -3' ACGGGTGCAATTTCATATGTGAACATA -3' CTTGACCACTGGAAAGACCG -3' CGATGACGTTGTCAGCTAGGA -3' ACGGCAAGTTCAACGGCACAG -3' GACATACTCAGCACCAGCATCACC -3'
2.6. Statistical analysis Statistical analysis was conducted using GraphPad prism 6 software (GraphPad software Inc. San Diego, CA, USA). The results of behavioral tests and qPCR were analyzed using 2-way analysis of variance (ANOVA) followed by Bonferroni post hoc test with prenatal treatment (saline vs LPS) and maternal supplementation (vehicle vs zinc) as between group variables. The data are presented as mean ± SEM and a value of p < 0.05 was considered to be statistically significant. 3. Results 3.1. Spatial working memory and recognition memory impairments were improved by maternal zinc supplementation
2.3.2. Y-maze recognition memory test The recognition memory test is based on an innate curiosity of rodents to explore novel areas. The test was conducted using a Y-maze as previously described by Sarnyai et al. with some modifications [29]. The test session consisted of two different trials including training and test trials. During the training trial, rats were allowed to freely explore maze with one blocked arm for 5 min followed by a 15-min inter-trial interval. Afterwards, rats were returned to the maze with all accessible arms for 2 min (test trial). The time spent within the novel arm was recorded and the recognition memory index was calculated as follow: (the time spent in the novel arm / total time spent in all arms during the first minute of the second trial) ×100.
To investigate whether prenatal zinc supplementation has the capacity to prevent LPS-induced memory impairment, two memory tasks including spontaneous alternation and recognition memory were performed on male and female offspring. While no significant difference in spontaneous alternation was observed for the female offspring (Fig. 2B), male pups exhibited a moderate decrease in prenatal LPS + vehicle treated group compared to control + vehicle (F (1, 26) = 8.594, p < 0.01). Prenatal zinc supplementation, however, significantly reversed the working memory impairment induced by LPS (F (1, 26) = 9.270, p < 0.01) (Fig. 2A). A similar trend was also observed for the recognition memory test in male offspring with a significant deficient memory in rats prenatally exposed to LPS compared to the control + vehicle group (F (1, 29) = 7.933, p < 0.01) (Fig. 2C). As expected, prenatal zinc supplementation was able to prevent LPS-induced impairment and pups spent more time in the novel arm compared to the LPS + vehicle treated group (F (1, 29) = 4.279, p < 0.05) (Fig. 2C). In contrast, female offspring in all treated group exhibited no different preference for the novel arm compared to the control group (Fig. 2D).
2.4. Tissue collection On PND 60–62, animals (n = 6 per each group, one animal per litter which selected randomly) were euthanized with asphyxiation by CO2 and brain samples were collected for further analysis. For qPCR, frontal cortex of brain tissues was dissected on ice, immediately snap-frozen in liquid nitrogen and finally stored at -80 °C until RNA extraction based on a study by Chiu et al [30]. 2.5. RNA extraction and qPCR
3.2. Maternal zinc supplementation reverses LPS-induced reduction in GAD67 expression level but has no effect on COMT mRNA level
RNA extraction and qPCR experiments were carried out in accordance with MIQE guidelines [31]. TRI reagent (Sigma-Aldrich, USA) was used to extract total RNA from the samples. Total RNA concentrations and purity were assessed using Nanodrop (Thermo Ficher, USA) and agarose gel electrophoresis, followed by DNase treatment (Fermentas, USA) according to the manufacturer’s instructions. One microgram of RNA samples was submitted to reverse transcription with a cDNA synthesis kit (Thermo Ficher, USA) using oligo-dT primers based on the manufacturer’s protocol. In order to evaluate gene expression, cDNA was amplified in triplicate using specific primers targeting GAD67 and COMT (Table 1) in SYBR Premix Ex Taq II (Takara, Japan). The reaction was performed in a Mic qPCR system (Australia) with a three-step procedure. The PCR cycling was initiated at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. As a reference gene, the expression of GAPDH was used to normalize the expression levels of target genes. Finally, the relative quantification of gene expression was calculated using the comparative Ct (2−ΔΔCt) method.
qPCR was applied to address whether improvement in working memory of LPS + Zinc group was associated with changes in GAD67 and COMT expression level. To investigate this, total RNA was extracted from the frontal cortex and the expression level of both genes was measured in offspring of all treated group. As shown in Fig. 3A, GAD67 expression was significantly down-regulated upon prenatal LPS exposure by two-fold (F (1, 12) = 11.82, p < 0.01) in male pups. Interestingly, prenatal zinc supplementation (LPS + Zinc group) was found to significantly elevate the mRNA level of GAD67 by nearly twofold (F (1, 12) = 15.57, p < 0.05) compared to the LPS + vehicle group (Fig. 3A). No significant change in GAD67 expression was detected for the female pups (Fig. 3B) in different experimental groups. Our data indicated that the mRNA level of COMT remained unchanged following prenatal LPS administration, with no significant effect of maternal zinc supplementation for both treated male and female offspring (Fig. 3C-D). 3
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
Fig. 2. Behavioral impairments were improved by maternal zinc supplementation in male offspring prenatally exposed to LPS. Prenatally exposed to LPS induced a significant decrease in both spontaneous alternation and recognition memory tests compared to control. These deficits were reversed by zinc supplementation throughout pregnancy (A, C). No significant behavioral impairments were observed for female offspring (B, D). Data are expressed as mean ± SEM, n = 6. **p < 0.01 relative to control + vehicle group. #p < 0.05, ##p < 0.01 relative to LPS + vehicle group. LPS: lipopolysaccharide.
4. Discussion
phenotype associated with schizophrenia in the offspring. In contrast, no alteration in working memory was observed in LPS-exposed female offspring. However, the general consensus from the literatures is that males display an earlier symptoms onset of the disease compared to the females [1], there are controversial results about the sex difference in cognitive performance of schizophrenic patients. While Roesch-Ely et al. reported a lack of any significant gender difference in working memory related to PFC [36], a recent study has documented more cognitive impairments in working memory in the male than female schizophrenic patients [37]. Similar to the human studies, conflicting results have been observed in animal models of schizophrenia. In line with our results, significant deficits in working memory was reported in the male offspring prenatally exposed to LPS (0.5 mg/kg, s.c.) at GD10/ 11 [9]. Using a similar protocol with a different LPS dose (0.1 mg/kg, i.p., GD15/16), however, Santos-Toscano et al. showed that female pups exhibited worse impairments in working memory than males upon maternal LPS treatment [8]. Further research in the model of MIA found that prenatal treatment with Poly I:C (5 mg/kg, i.v., GD7) induces impairment in spatial working memory of male pups using the Morris water maze [38]. The discrepancies observed in these studies may be due to the differences in methodology, infectious agents, animal strains, and the age of the animals. Given the important role of PFC in cognition as well as the implication of neurotransmitters–in particular dopamine and GABA in the pathophysiology of schizophrenia, for the first time, we evaluated the expression levels of GAD and COMT in frontal cortex in a MIA model of schizophrenia. Of note, due to the inconsistency in anatomical and functional definition of PFC area in rat [39], it was difficult to isolate the exact area. Therefore, in the present study, frontal cortex was dissected which contains PFC for gene expression analysis. Evidence has presented GAD67 as an important gene involved in the pathophysiology of schizophrenia [3]. The majority of postmortem studies have consistently found the diminished mRNA level of GAD67
As a devastating psychiatric disorder, schizophrenia has been found to be related to both genetic and environmental risk factors [3]. In particular, environmental factors including prenatal infection, malnutrition, drug abuse, and birth complications have become the focus of investigation in recent years with regard to schizophrenia etiology [3,32]. An increasing number of studies have revealed a tight connection between the altered level of trace elements and an increased risk for schizophrenia [33–35]. In the present study, we investigated the beneficial effects of zinc supplementation on both male and female offspring prenatally exposed to maternal LPS. The main findings of the study are as follow: (1) the prenatal treatment with LPS resulted in significant working memory impairments as well as a decreased expression level of GAD67 in the frontal cortex of male offspring. (2) prenatal zinc supplementation was able to ameliorate the mentioned deficits induced by maternal LPS exposure. (3) by contrast, LPS exposure was ineffective on behavioral phenotype, GAD67, and COMT expression level in female offspring. 4.1. The effects of prenatal treatment with LPS According to the neurodevelopmental hypothesis, maternal infection during pregnancy is a key risk factor for the development of schizophrenia in the offspring [3]. Based on this evidence, a number of studies did provide support for the use of MIA as a model to study the pathophysiology of schizophrenia. These studies also demonstrated that animals prenatally exposed to infectious agents such as LPS, showed significant behavioral impairments, evident in a variety of behavioral experiments including Morris water maze, T-maze, and pre-pulse inhibition (PPI) [7–10]. Consistent with these reports, we showed the impaired working memory in LPS-exposed male pups confirming that maternal infection induced by LPS makes a long-lasting behavioral 4
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
Fig. 3. Reduction in GAD67 mRNA level was reversed by maternal zinc supplementation in male offspring prenatally exposed to LPS. Maternal LPS treatment led to a significant decrease in the expression level of GAD67 in the frontal cortex of male offspring. This reduction was reversed by zinc supplementation throughout pregnancy (A). No significant difference in GAD67 expression level was detected for female offspring (B). COMT mRNA level was unchanged between the groups for both male and female pups (C, D). GAPDH expression was used for normalization of the target genes. Data are expressed as mean ± SEM, n = 6. **p < 0.01 relative to control + vehicle group. #p < 0.05 relative to LPS + vehicle group. LPS: lipopolysaccharide, GAD67: glutamate decarboxylase 67, COMT: catechol O-methyltransferase.
at 12 weeks [47]. The reason for this discrepancy might be explained by the difference in animal model and the age of testing.
in the dorsolateral PFC (DLPFC) region which results in decreased GABA concentrations and eventually cognitive impairment in schizophrenic patients [40]. Our results also showed a significant decrease in GAD67 expression in frontal cortex of the male rats prenatally treated with LPS. In agreement with this finding, Bullock et al. also demonstrated the reduced expression of GAD67 in the cerebellum in phencyclidine (PCP) treated rat model. In addition, they reported the similar results in lateral cerebellar hemisphere of patients suffering from schizophrenia [41]. Added to this, Sandhu et al. described disruption of social behavior as well as reduced intermale aggression in male GAD67 haplodeficient mice [42]. These findings provide strong support for the idea that GABAergic interneurons may be responsible for some of cognitive impairments observed in schizophrenia. Several studies demonstrated the role of dopaminergic impairments in prefrontal brain regions of schizophrenic patients [3]. COMT, which has been identified as being involved in cognition, is expressed significantly at the higher level in the PFC compared to the dopaminergic areas of brain, striatum, and brainstem [43]. Despite of apparent inconsistency in the literature, numerous studies have described the association between COMT polymorphism and cognitive impairments in patients with schizophrenia [44,45]. A recent meta-analysis by González-Castro et al. have reported a statistical relation between COMT genotype and the risk of schizophrenia [46]. Interestingly, no evidence was found for the relation between COMT mRNA level and COMT genotype in this disease [13,14] supporting that enzyme activity is more critical parameter than mRNA and protein levels. In line with this finding, our result also showed unchanged COMT mRNA level between treated groups. In an animal model of prenatal asphyxia, however, increased COMT expression was observed in medial PFC of male offspring
4.2. The effects of prenatal zinc supplementation It is well-known that zinc, having critical role in many cellular processes, is an essential trace element for normal brain growth and functions [48]. In this regard, zinc dyshomeostasis has been identified to strongly affect cognition which ultimately results in neurological abnormalities [17,18]. Added to this, several studies have demonstrated an intimate connection between zinc deficiency and impairments in learning and working memory, in which reduction in Brainderived neurotrophic factor (BDNF) has been suggested as a possible mechanism [21,22]. Another possible mechanism is that zinc, acting as an antagonist, is capable of inducing functional changes in N-methyl-Daspartate (NMDA) receptor [49] and is therefore considered as a putative modulator of neuronal signaling. Interestingly, an animal study has shown that gestational exposure to LPS leads to a sharp reduction in maternal zinc plasma level which induces abnormalities in fetuses [25,26]. Another study by the same group demonstrated that zinc supplementation throughout pregnancy can prevent the memory impairment induced by prenatal LPS exposure (0.3 mg/kg, s.c., GD8) [50]. Likewise, our results revealed that zinc supplementation given from the first day of pregnancy attenuated spatial working memory impairment as well as recognition memory deficit in the male pups prenatally treated with LPS. Similar trends were also presented by more recent study in which zinc supplementation during pregnancy was found to reverse the effects of LPS (0.2 mg/kg, i.p., GD14) on behavioral, neurochemical, and biochemical parameters in the offspring [24]. In 5
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
addition to this work, results from Kirsten et al. also suggested a beneficial effect of maternal zinc supplementation to prevent communication impairment and BDNF hyperactivity in the offspring prenatally exposed to LPS (0.1 mg/kg, i.p., GD9.5) [51]. The molecular mechanisms how zinc exerts a protective effect on the cognition deficits induced by LPS remain largely elusive. One potential mechanism is that zinc supplementation may prevent the fetal zinc deficiency induced by maternal infection. There is evidence that maternal treatment with LPS induces a dramatic increase in hepatic metallothionein, a zinc-binding protein, followed by the movement of zinc from plasma to the liver and eventually reduction in available zinc for fetal transfer [25]. Another mechanism for the protective effect of zinc might be due to its antioxidant property by which it can modulate the adverse effects induced by LPS [52]. In addition, our study revealed that zinc supplementation restored the expression of GAD67 disrupted by prenatally exposed to LPS treatment in male pups. As of today, a significant number of studies have highlighted the dysregulation of GAD67 in multiple brain regions, in particular, the PFC of schizophrenia subjects [15,53]. However, there are a few studies which have examined the effect of pharmacological treatments to prevent this impairment [54,55]. The underlying mechanisms how zinc supplementation could improve the GAD67 expression in the male rats exposed prenatally to LPS is not clear, although several possible mechanisms may account for this result. Zinc serves as an essential component of many proteins structure, in particular RNA polymerase and zinc-finger proteins, a large family of transcription factors, which are of utmost importance for gene expression [56]. Additionally, it should be noted that zinc efficiently involves in neurogenesis during brain development. As zinc deficiency leads to the reduction in cell proliferation and increase in apoptosis, consequently results in the neurogenesis impairment and decreased number of cells [48]. Therefore, this evidence leads to the assumption that zinc supplementation indirectly affects the expression of GAD67 in LPS + zinc group. Taken together, the present study demonstrates that maternal LPS exposure causes working memory impairments and decrease in the expression of GAD67, without altering COMT expression in male offspring compared to the control. However, no significant changes in working memory and the expression levels of GAD67 and COMT was detected for female pups. Given that females display later age of symptoms onset compared to the males [1], the evaluation of behavioral tests and genes expression in the older female pups would be of interest. In addition, the present data highlights the therapeutic effect of zinc supplementation throughout pregnancy to limit neurodevelopmental deficits in fetus induced by infectious agents.
[4] A.S. Brown, E.J. Derkits, Prenatal infection and schizophrenia: a review of epidemiologic and translational studies, Am. J. Psychiatry 167 (3) (2009) 261–280, https://doi.org/10.1176/appi.ajp.2009.09030361. [5] A.S. Brown, J. Hooton, C.A. Schaefer, H. Zhang, E. Petkova, V. Babulas, M. Perrin, J.M. Gorman, E.S. Susser, Elevated maternal interleukin-8 levels and risk of schizophrenia in adult offspring, Am. J. Psychiatry 161 (5) (2004) 889–895, https:// doi.org/10.1176/appi.ajp.161.5.889. [6] S.L. Buka, M.T. Tsuang, E.F. Torrey, M.A. Klebanoff, R.L. Wagner, R.H. Yolken, Maternal cytokine levels during pregnancy and adult psychosis, Brain Behav. Immun. 15 (4) (2001) 411–420 https://linkinghub.elsevier.com/retrieve/pii/ S0889159101906440. [7] D. Mattei, A. Djodari-Irani, R. Hadar, A. Pelz, L.F. de Cossío, T. Goetz, M. Matyash, H. Kettenmann, C. Winter, S.A. Wolf, Minocycline rescues decrease in neurogenesis, increase in microglia cytokines and deficits in sensorimotor gating in an animal model of schizophrenia, Brain Behav. Immun. 38 (2014) 175–184, https://doi.org/ 10.1016/j.bbi.2014.01.019. [8] R. Santos-Toscano, É. Borcel, M. Ucha, J. Orihuel, R. Capellán, D. Roura-Martínez, E. Ambrosio, A. Higuera-Matas, Unaltered cocaine self-administration in the prenatal LPS rat model of schizophrenia, Prog. Neuropsychopharmacol. Biol. Psychiatry 69 (2016) 38–48, https://doi.org/10.1016/j.pnpbp.2016.04.008. [9] U. Waterhouse, V.E. Roper, K.A. Brennan, B.A. Ellenbroek, Nicotine ameliorates schizophrenia-like cognitive deficits induced by maternal LPS exposure: a study in rats, Dis. Model. Mech. 9 (10) (2016) 1159–1167, https://doi.org/10.1242/dmm. 025072. [10] L. Wischhof, E. Irrsack, C. Osorio, M. Koch, Prenatal LPS-exposure–a neurodevelopmental rat model of schizophrenia–differentially affects cognitive functions, myelination and parvalbumin expression in male and female offspring, Prog. Neuropsychopharmacol. Biol. Psychiatry 57 (2015) 17–30, https://doi.org/10. 1016/j.pnpbp.2014.10.004. [11] J. Prata, S.G. Santos, M.I. Almeida, R. Coelho, M.A. Barbosa, Bridging Autism Spectrum disorders and Schizophrenia through inflammation and biomarkers-preclinical and clinical investigations, J. Neuroinflammation 14 (1) (2017) 179, https://doi.org/10.1186/s12974-017-0938-y. [12] O.D. Howes, S. Kapur, The dopamine hypothesis of schizophrenia: version III—the final common pathway, Schizophr. Bull. 35 (3) (2009) 549–562, https://doi.org/ 10.1093/schbul/sbp006. [13] M. Matsumoto, C.S. Weickert, S. Beltaifa, B. Kolachana, J. Chen, T.M. Hyde, M.M. Herman, D.R. Weinberger, J.E. Kleinman, Catechol O-methyltransferase (COMT) mRNA expression in the dorsolateral prefrontal cortex of patients with schizophrenia, Neuropsychopharmacology 28 (8) (2003) 1521, https://doi.org/10. 1038/sj.npp.1300218. [14] E. Tunbridge, P.W. Burnet, M.S. Sodhi, P.J. Harrison, Catechol‐o‐methyltransferase (COMT) and proline dehydrogenase (PRODH) mRNAs in the dorsolateral prefrontal cortex in schizophrenia, bipolar disorder, and major depression, Synapse 51 (2) (2004) 112–118, https://doi.org/10.1002/syn.10286. [15] S. Akbarian, H.-S. Huang, Molecular and cellular mechanisms of altered GAD1/ GAD67 expression in schizophrenia and related disorders, Brain Res. Rev. 52 (2) (2006) 293–304, https://doi.org/10.1016/j.brainresrev.2006.04.001. [16] H.E. Brown, J.L. Roffman, Vitamin supplementation in the treatment of schizophrenia, CNS Drugs 28 (7) (2014) 611–622 https://link.springer.com/article/10. 1007%2Fs40263-014-0172-4. [17] O. Grønli, J.M. Kvamme, O. Friborg, R. Wynn, Zinc deficiency is common in several psychiatric disorders, PLoS One 8 (12) (2013) e82793, https://doi.org/10.1371/ journal.pone.0082793. [18] M.A. Petrilli, T.M. Kranz, K. Kleinhaus, P. Joe, M. Getz, P. Johnson, M.V. Chao, D. Malaspina, The emerging role for zinc in depression and psychosis, Front. Pharmacol. 8 (2017) 414, https://doi.org/10.3389/fphar.2017.00414. [19] S.M. Hancock, D.I. Finkelstein, P.A. Adlard, Glia and zinc in ageing and Alzheimer’s disease: a mechanism for cognitive decline? Front. Aging Neurosci. 6 (2014) 137, https://doi.org/10.3389/fnagi.2014.00137. [20] A. Prakash, K. Bharti, A.B.A. Majeed, Zinc: indications in brain disorders, Fundam. Clin. Pharmacol. 29 (2) (2015) 131–149, https://doi.org/10.1111/fcp.12110. [21] V. Frazzini, A. Granzotto, M. Bomba, N. Massetti, V. Castelli, M. d’Aurora, M. Punzi, M. Iorio, A. Mosca, S.D. Pizzi, The pharmacological perturbation of brain zinc impairs BDNF-related signaling and the cognitive performances of young mice, Sci. Rep. 8 (1) (2018) 9768, https://doi.org/10.1038/s41598-018-28083-9. [22] X. Yu, W. Chen, Z. Wei, T. Ren, X. Yang, X. Yu, Effects of maternal mild zinc deficiency and different ways of zinc supplementation for offspring on learning and memory, Food Nutr. Res. 60 (1) (2016) 29467, https://doi.org/10.3402/fnr.v60. 29467. [23] R. Raqib, M.B. Hossain, S.L. Kelleher, C.B. Stephensen, B. Lönnerdal, Zinc supplementation of pregnant rats with adequate zinc nutriture suppresses immune functions in their offspring, J. Nutr. 137 (4) (2007) 1037–1042, https://doi.org/10. 1093/jn/137.4.1037. [24] N. Sharma, P. Arora, B. Nehru, Prenatal zinc supplementation to lipopolysaccharide infected female rats prevents neurochemical, behavioral and biochemical deficits produced in infants, Neuroimmunol Neuroinflammation. 4 (4) (2017) 33–45, https://doi.org/10.20517/2347-8659.2016.38. [25] L.C. Carey, P.L. Berbée, P. Coyle, J.C. Philcox, A.M. Rofe, Zinc treatment prevents lipopolysaccharide‐induced teratogenicity in mice, Birth Defects Res A Clin Mol Teratol. 67 (4) (2003) 240–245, https://doi.org/10.1002/bdra.10035. [26] J.S. Chua, C.J. Cowley, J. Manavis, A.M. Rofe, P. Coyle, Prenatal exposure to lipopolysaccharide results in neurodevelopmental damage that is ameliorated by zinc in mice, Brain Behav. Immun. 26 (2) (2012) 326–336, https://doi.org/10.1016/j. bbi.2011.10.002. [27] A. Moazedi, Z. Ghotbeddin, G. Parham, Comparison of the effects of dose-dependent
Declaration of Competing Interest The Authors declare no conflict of interest. Acknowledgements This research was supported by a grant [No. 960105] from Research Vice-Chancellor of Hormozgan University of Medical Sciences (HUMS), Iran and was done as a part of Master of Science thesis in Clinical Biochemistry. References [1] J.J. McGrath, F.P. Féron, T.H. Burne, A. Mackay-Sim, D.W. Eyles, The neurodevelopmental hypothesis of schizophrenia: a review of recent developments, Ann. Med. 35 (2) (2003) 86–93. [2] A.P. Association, Diagnostic and Statistical Manual of Mental Disorders (DSM-5®), American Psychiatric Pub, 2013. [3] U.E. Lang, I. Puls, D.J. Müller, N. Strutz-Seebohm, J. Gallinat, Molecular mechanisms of schizophrenia, Cell. Physiol. Biochem. 20 (6) (2007) 687–702, https://doi. org/10.1159/000110430.
6
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
[28]
[29]
[30]
[31]
[32] [33]
[34]
[35]
[36]
[37]
[38]
[39] [40]
[41]
[42]
[43]
zinc chloride on short-term and long-term memory in young male rats, Pak. J. Biol. Sci. 10 (16) (2007) 2704–2708. M. Ghasemi‐Kasman, L. Zare, H. Baharvand, M. Javan, In vivo conversion of astrocytes to myelinating cells by miR‐302/367 and valproate to enhance myelin repair, J. Tissue Eng. Regen. Med. 12 (1) (2018) e462–e472, https://doi.org/10. 1002/term.2276. Z. Sarnyai, E.L. Sibille, C. Pavlides, R.J. Fenster, B.S. McEwen, M. Tóth, Impaired hippocampal-dependent learning and functional abnormalities in the hippocampus in mice lacking serotonin1A receptors, Proc. Natl. Acad. Sci. U.S.A. 97 (26) (2000) 14731–14736, https://doi.org/10.1073/pnas.97.26.14731. K. Chiu, W.M. Lau, H.T. Lau, K.-F. So, R.C.-C. Chang, Micro-dissection of rat brain for RNA or protein extraction from specific brain region, J. Vis. Exp. 7 (2007) 269, https://doi.org/10.3791/269. S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M.W. Pfaffl, G.L. Shipley, The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments, Clin. Chem. 55 (4) (2009) 611–622, https://doi.org/10.1373/clinchem.2008.112797. K.I. Vadakkan, A structure-function mechanism for schizophrenia, Front. Psychiatry 3 (2012) 108, https://doi.org/10.3389/fpsyt.2012.00108. L. Cai, T. Chen, J. Yang, K. Zhou, X. Yan, W. Chen, L. Sun, L. Li, S. Qin, P. Wang, Serum trace element differences between Schizophrenia patients and controls in the Han Chinese population, Sci. Rep. 5 (2015) 15013, https://doi.org/10.1038/ srep15013. P. Joe, M. Petrilli, D. Malaspina, J. Weissman, Zinc in schizophrenia: a meta-analysis, Gen. Hosp. Psychiatry 53 (2018) 19–24, https://doi.org/10.1016/j. genhosppsych.2018.04.004. M. Yanik, A. Kocyigit, H. Tutkun, H. Vural, H. Herken, Plasma manganese, selenium, zinc, copper, and iron concentrations in patients with schizophrenia, Biol. Trace Elem. Res. 98 (2) (2004) 109–117, https://doi.org/10.1385/BTER:98:2:109. D. Roesch-Ely, E. Hornberger, S. Weiland, C. Hornstein, P. Parzer, C. Thomas, M. Weisbrod, Do sex differences affect prefrontal cortex associated cognition in schizophrenia? Schizophr. Res. 107 (2-3) (2009) 255–261, https://doi.org/10. 1016/j.schres.2008.09.021. B. Zhang, M. Han, S. Tan, F. De Yang, Y. Tan, S. Jiang, X. Zhang, X.-F. Huang, Gender differences measured by the MATRICS consensus cognitive battery in chronic schizophrenia patients, Sci. Rep. 7 (1) (2017) 11821, https://doi.org/10. 1038/s41598-017-12027-w. U. Meyer, I. Knuesel, M. Nyffeler, J. Feldon, Chronic clozapine treatment improves prenatal infection-induced working memory deficits without influencing adult hippocampal neurogenesis, Psychopharmacology (Berl.) 208 (4) (2010) 531–543, https://doi.org/10.1007/s00213-009-1754-6. H.B. Uylings, H.J. Groenewegen, B. Kolb, Do rats have a prefrontal cortex? Behav. Brain Res. 146 (1-2) (2003) 3–17, https://doi.org/10.1016/j.bbr.2003.09.028. J.C. de Jonge, C.H. Vinkers, H. Pol, E. Hilleke, A. Marsman, GABAergic mechanisms in schizophrenia: linking postmortem and in vivo studies, Front. Psychiatry 8 (2017) 118, https://doi.org/10.3389/fpsyt.2017.00118. W.M. Bullock, F. Bolognani, P. Botta, C.F. Valenzuela, N.I. Perrone-Bizzozero, Schizophrenia-like GABAergic gene expression deficits in cerebellar Golgi cells from rats chronically exposed to low-dose phencyclidine, Neurochem. Int. 55 (8) (2009) 775–782, https://doi.org/10.1016/j.neuint.2009.07.010. K. Sandhu, D. Lang, B. Müller, S. Nullmeier, Y. Yanagawa, H. Schwegler, O. Stork, Glutamic acid decarboxylase 67 haplodeficiency impairs social behavior in mice, Genes Brain Behav. 13 (4) (2014) 439–450, https://doi.org/10.1111/gbb.12131. M. Matsumoto, C.S. Weickert, M. Akil, B. Lipska, T. Hyde, M. Herman, J. Kleinman,
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
7
D. Weinberger, Catechol O-methyltransferase mRNA expression in human and rat brain: evidence for a role in cortical neuronal function, Neuroscience 116 (1) (2003) 127–137, https://doi.org/10.1016/S0306-4522(02)00556-0. K.E. Lewandowski, Relationship of catechol-O-methyltransferase to schizophrenia and its correlates: evidence for associations and complex interactions, Harv. Rev. Psychiatry 15 (5) (2007) 233–244, https://doi.org/10.1080/10673220701650409. C.T. Matsuzaka, D. Christofolini, V.K. Ota, A. Gadelha, A.A. Berberian, C. Noto, D.R. Mazzotti, L.M. Spindola, P.N. Moretti, M.A. Smith, Catechol-O-methyltransferase (COMT) polymorphisms modulate working memory in individuals with schizophrenia and healthy controls, Braz J Psychiatry. 39 (4) (2017) 302–308, https://doi.org/10.1590/1516-4446-2016-1987. T.B. González-Castro, Y. Hernandez-Diaz, I.E. Juárez-Rojop, M.L. López-Narváez, C.A. Tovilla-Zárate, A. Fresan, The role of a Catechol-O-Methyltransferase (COMT) Val158Met genetic polymorphism in schizophrenia: a systematic review and updated meta-analysis on 32,816 subjects, Neuromolecular Med. 18 (2) (2016) 216–231, https://doi.org/10.1007/s12017-016-8392-z. T. Wakuda, K. Iwata, Y. Iwata, A. Anitha, T. Takahashi, K. Yamada, M.M. Vasu, H. Matsuzaki, K. Suzuki, N. Mori, Perinatal asphyxia alters neuregulin-1 and COMT gene expression in the medial prefrontal cortex in rats, Prog. Neuropsychopharmacol. Biol. Psychiatry 56 (2015) 149–154, https://doi.org/10. 1016/j.pnpbp.2014.08.002. C.W. Levenson, D. Morris, Zinc and neurogenesis: making new neurons from development to adulthood, Adv. Nutr. 2 (2) (2011) 96–100, https://doi.org/10.3945/ an.110.000174. R.E. Sirrieh, D.M. MacLean, V. Jayaraman, Amino-terminal domain tetramer organization and structural effects of zinc binding in the N-methyl-D-aspartate (NMDA) receptor, J. Biol. Chem. 288 (31) (2013) 22555–22564, https://doi.org/ 10.1074/jbc.M113.482356. P. Coyle, N. Tran, J.N. Fung, B.L. Summers, A.M. Rofe, Maternal dietary zinc supplementation prevents aberrant behaviour in an object recognition task in mice offspring exposed to LPS in early pregnancy, Behav. Brain Res. 197 (1) (2009) 210–218, https://doi.org/10.1016/j.bbr.2008.08.022. T.B. Kirsten, N. Queiroz-Hazarbassanov, M.M. Bernardi, L.F. Felicio, Prenatal zinc prevents communication impairments and BDNF disturbance in a rat model of autism induced by prenatal lipopolysaccharide exposure, Life Sci. 130 (2015) 12–17, https://doi.org/10.1016/j.lfs.2015.02.027. G.G. Mackenzie, M.P. Zago, L. Aimo, P.I. Oteiza, Zinc deficiency in neuronal biology, IUBMB Life 59 (4-5) (2007) 299–307, https://doi.org/10.1080/ 15216540701225966. A.C. Mitchell, Y. Jiang, C. Peter, S. Akbarian, Transcriptional regulation of GAD1 GABA synthesis gene in the prefrontal cortex of subjects with schizophrenia, Schizophr. Res. 167 (1-3) (2015) 28–34, https://doi.org/10.1016/j.schres.2014.10. 020. N. Goto, R. Yoshimura, S. Kakeda, J. Moriya, H. Hori, K. Hayashi, A. IkenouchiSugita, W. Nakano-Umene, A. Katsuki, J. Nishimura, No alterations of brain GABA after 6 months of treatment with atypical antipsychotic drugs in early-stage firstepisode schizophrenia, Prog. Neuropsychopharmacol. Biol. Psychiatry 34 (8) (2010) 1480–1483, https://doi.org/10.1016/j.pnpbp.2010.08.007. O. Kelemen, I. Kiss, G. Benedek, S. Kéri, Perceptual and cognitive effects of antipsychotics in first-episode schizophrenia: the potential impact of GABA concentration in the visual cortex, Prog. Neuropsychopharmacol. Biol. Psychiatry 47 (2013) 13–19, https://doi.org/10.1016/j.pnpbp.2013.07.024. T.V. O’halloran, Transition metals in control of gene expression, Science 261 (5122) (1993) 715–725, https://doi.org/10.1126/science.8342038.
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Research report
Prenatal zinc supplementation attenuates lipopolysaccharide-induced behavioral impairments in maternal immune activation model
T
⁎
Faezeh Alizadeha, Nahid Davoodianb,c, , Haniyeh Kazemib, Maryam Ghasemi-Kasmand,e, Fatemeh Shaerzadehf a
Endocrinology and Metabolism Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran Molecular Medicine Research Center, Hormozgan Health Institute, Hormozgan University of Medical Sciences, Bandar Abbas, Iran c Department of Clinical Biochemistry, Faculty of Medicine, Hormozgan University of Medical Sciences, Bandar Abbas, Iran d Infertility and Reproductive Health Research Center, Health Research Institute, Babol University of Medical Science, Babol, Iran e Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical Sciences, Babol, Iran f Department of Neuroscience, University of Florida College of Medicine and McKnight Brain Institute, Gainesville, FL, 32610, USA b
A R T I C LE I N FO
A B S T R A C T
Keywords: Zinc supplementation Schizophrenia Lipopolysaccharide Working memory Neurodevelopmental deficits
Maternal infection during pregnancy is considered a key risk factor for developing schizophrenia in offspring. There is evidence that maternal exposure to infectious agents is associated with fetal zinc deficiency. Due to the essential role of zinc in brain function and development, in the present study, we activated maternal immune system using lipopolysaccharide (LPS) as a model of schizophrenia to examine whether zinc supplementation throughout pregnancy can reverse LPS-induced deleterious effects. To test the hypothesis, pregnant rats were treated with intraperitoneal injection of either saline or LPS (0.5 mg/kg) at gestational day 15 and 16, and zinc supplementation (30 mg/kg) was administered throughout pregnancy by gavage. At postnatal day 60, Y-maze was used to evaluate working memory of offspring. Moreover, the expression levels of catechol O-methyltransferase (COMT) and glutamate decarboxylase 67 (GAD67) were measured in the frontal cortex of the brain samples. Only male offspring prenatally exposed to LPS showed a significant impairment in working memory. In addition, prenatal LPS exposure causes a moderate decrease in GAD67 expression level in the male pups, while COMT expression was found unchanged. Interestingly, zinc supplementation restored the alterations in working memory as well as GAD67 mRNA level in the male rats. No alteration was detected for neither working memory nor COMT/GAD67 genes expression in female offspring. This study demonstrates that zinc supplementation during pregnancy can attenuate LPS-induced impairments in male pups. These results support the idea to consume zinc supplementation during pregnancy to limit neurodevelopmental deficits induced by infections in offspring.
1. Introduction Schizophrenia is a devastating mental illness affecting an estimated one percent of the world’s population with a higher incidence and earlier onset in males compared to females [1]. Currently, there is no single physical or lab test for schizophrenia and diagnosis is typically based on the behavioral criteria [2]. The clinical features of schizophrenia, which disturb cognition, behavior, perception, and thought, are typically classified into positive, negative, and cognitive symptoms. Positive symptoms, which characterized by the existence of abnormal behavior, include hallucinations, delusions, and catatonic behavior. Negative symptoms, reflecting the absence of normal functions, include
⁎
lack of emotion and interest in life and social withdrawal, while cognitive symptoms are specifically connected to memory, attention, and executive functions [3]. As a multifactorial mental disease, genetic and environmental factors have been identified to be involved in the pathogenesis of schizophrenia [3]. To date, there is a large body of evidence supporting the role for maternal infection and prenatal complications to disturb neurodevelopment which is associated with an elevated risk to develop schizophrenia [4–6]. In line with these findings, animal studies have confirmed that prenatal exposure to infectious agents such as lipopolysaccharide (LPS) and viral mimic polyinosinic-polycytidilic acid (Poly I:C) leads to maternal immune stimulation and ultimately behavioral
Corresponding author at: Department of Biochemistry, Faculty of Medicine, Hormozgan University of Medical Sciences, Bandar Abbas, Iran. E-mail address: [email protected] (N. Davoodian).
https://doi.org/10.1016/j.bbr.2019.112247 Received 7 July 2019; Received in revised form 5 September 2019; Accepted 16 September 2019 Available online 20 September 2019 0166-4328/ © 2019 Elsevier B.V. All rights reserved.
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
deficiency which leads to teratogenicity in fetus [25]. Similar findings were also reported by Chua et al. showing a reduced maternal plasma zinc concentration upon LPS administration (0.5 mg/kg, s.c.) on GD16 in mice [26]. In the present study, we utilized maternal immune activation using LPS as a model of schizophrenia to examine whether zinc supplementation throughout pregnancy can reserve LPS-induced behavioral impairments which were performed by Y-maze tests. In addition, we evaluated the effect of zinc supplementation on LPS mediated changes in GAD67 and COMT mRNA levels in frontal cortex using quantitative real-time PCR (qPCR).
and neurobiological abnormalities related to schizophrenia. As such, different protocols in term of infectious agent’s dose, administration at various time points during gestation, and single or repeated injections have been reported by several in vivo studies which suggested maternal immune activation (MIA) as an excellent model to evaluate the pathophysiology of this psychiatric disease [7–10]. In this context, it is important to note that MIA animal model is a neurodevelopmental model with construct validity for both schizophrenia and autism spectrum disorders (ASD) and predictive validity for schizophrenia. Interestingly, MIA offspring exhibit behavioral impairments, abnormalities in gene expression, and neuropathology associated with both ASD and schizophrenia [11]. Although the particular molecular and cellular mechanisms of schizophrenia are yet to be fully determined, several prominent hypothesizes including dopaminergic, glutamatergic, immune, gamma aminobutyric acid (GABAergic) and neurodevelopmental hypothesis have been identified to be involved in schizophrenia pathophysiology [3]. Of particular interest is dopamine hypothesis which have been based on the fact that all common antipsychotic drugs block the dopamine D2 receptors. Interestingly, the decreased dopaminergic neurotransmission in prefrontal cortex (PFC) has been speculated to be linked to the negative symptoms in schizophrenic patients [12]. In this regard, alterations in gene expression and functional polymorphism of catechol O-methyltransferase (COMT), a key enzyme involved in dopamine inactivation, have been reported as a risk factor for abnormality of dopamine neurotransmission in PFC and schizophrenia development [13,14]. Of additional interest is GABAergic system of brain which has been found to be implicated in the disease pathology. Indeed, dysregulation of the 67 kDa isoform of glutamic acid decarboxylase (GAD67), which is involved in the GABA biosynthesis, has been reported in prefrontal and other brain regions of schizophrenia suffering patients [15]. Nutritional deficiencies such as mineral dyshomeostasis and vitamins deficiencies has been linked to a number of neurological abnormalities including schizophrenia [16]. Consistent with this, numerous investigators have pointed to zinc dyshomeostasis as a key player in depression and several psychiatric disorders [17–19]. Zinc, as a second the most abundant trace element in human body, is required for many biological processes such as immune responses, cell growth and division, wound healing, development and most importantly nervous system functions [20]. Zinc dyshomeostasis in the central nervous system leads to disturbance in synaptic plasticity, cognitive decline, memory and learning impairment [19,21]. In support of this, several animal studies showing a correlation between prenatal zinc deficiency and offspring behavior, cognitive [22], and immune impairments [23] have demonstrated that zinc supplementation of pregnant rats can recover the mentioned deficits in pups. Added to this, a recent study has reported the beneficial effect of zinc supplementation on prevention of offspring neurochemical, biochemical, and behavioral deficits induced by maternal LPS exposure [24]. Of note, it has been shown that maternal exposure to infectious agents is associated with fetal zinc
2. Material and methods 2.1. Animal Wistar rats (12–16 weeks old, 250–270 g; Hormozgan University of Medical Sciences) were kept in a controlled temperature and humidity environment (22 °C/60–70%) with a 12:12 h light-dark cycle (light on: 7 a.m. to 7 p.m.) and unlimited access to food and water. Animal care and experiments were carried out based on National Institutes of Health guide for the care and use of laboratory animals and all experimental protocols used in this study were approved by the local Institutional Ethics Committee approval (HUMS.REC.1396.45).
2.2. Treatment The male and female rats were mated and pregnancy was confirmed by detecting spermatozoa in vaginal smears at the first day after mating (gestational day 1, GD1). From the first day of pregnancy confirmation, the pregnant rats were randomly divided into four groups as follows: Group 1 (control + vehicle, 6 litters) and Group 2 (LPS + vehicle, 6 litters): pregnant rats were treated with intraperitoneal (i.p.) injection of either saline or LPS (0.5 mg/kg) at GD15 and 16, respectively, and also gavaged with vehicle (water) throughout their pregnancy [10]. Group 3 (LPS + Zinc, 6 litters): pregnant rats were administered i.p. injection of LPS (0.5 mg/kg) on GD15-16 and also gavaged with ZnSO4 (30 mg/kg) daily throughout the gestational period [27]. Group 4 (saline + Zinc, 6 litters): pregnant rats received injection of saline (i.p.) on GD15-16 and meanwhile were daily supplemented with ZnSO4 (30 mg/kg) through 21 days of pregnancy (Fig. 1). In the current study, subjects were both female and male offspring which born to these dams. Pups were distributed by sex and treatment on postnatal day (PND) 21 and left undisturbed until behavioral and biochemical experiments at PND 60. For behavioral tests, 2 animals per litter was used. However, to avoid litter effects, the mean of animals within litter was calculated (n = 6). For qPCR, we used one animal per litter (n = 6). The tissues from the excess animals were processed for other experiments not reported here.
Fig. 1. Experimental design. Pregnant rats were received zinc supplementation (30 mg/kg) throughout pregnancy. LPS (0.5 mg/kg, i.p.) or saline was administrated on GD15 and 16. On PND 60, The resulting offspring were subjected to behavioral tests using Y-maze. Afterwards, all pups were sacrificed and the frontal cortex of brain were collected for qPCR. GD: gestational day, PND: postnatal day, LPS: lipopolysaccharide. 2
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
2.3. Behavioral tests
Table 1 Primer sequences for qPCR analysis.
The Y-maze test was conducted to investigate whether prenatal zinc supplementation had any modulating effect on working memory impairment induced by LPS [28]. For this reason, female and male offspring were subjected to both novel recognition test and spontaneous alteration performance around PND 60. Prior to the tests, the pups were handled for three days (5 min daily) and testing was performed during the light cycle between 9 a.m. to 12 a.m.
Genes
Accession No. Primer
Sequences
GAD67
NM_017007.1 Sense Antisense NM_012531.2 Sense Antisense NM_017008.4 Sense Antisense
5'5'5'5'5'5'-
COMT GAPDH
2.3.1. Y-maze spontaneous alternation performance Spatial working memory was assessed using a symmetrical Y-maze consisting of 3 arms with 50 cm length and 10 cm width as described previously [28]. The procedure was a single 8 min session in which every rat was randomly placed at the end of one arm and allowed to explore all three arms freely. Meanwhile, each series of arm entry (defined as when all four paws of the animal were completely within the arm) was visually recorded. The percentage of spontaneous alternation was calculated according to the following formula: Number of alternations/ (total number of arm entries-2) ×100, in which alternation was considered as the number of successive entries in three different arms (ABC, BCA, CBA, etc.).
GCTGGAAGGCATGGAAGGTTTTA -3' ACGGGTGCAATTTCATATGTGAACATA -3' CTTGACCACTGGAAAGACCG -3' CGATGACGTTGTCAGCTAGGA -3' ACGGCAAGTTCAACGGCACAG -3' GACATACTCAGCACCAGCATCACC -3'
2.6. Statistical analysis Statistical analysis was conducted using GraphPad prism 6 software (GraphPad software Inc. San Diego, CA, USA). The results of behavioral tests and qPCR were analyzed using 2-way analysis of variance (ANOVA) followed by Bonferroni post hoc test with prenatal treatment (saline vs LPS) and maternal supplementation (vehicle vs zinc) as between group variables. The data are presented as mean ± SEM and a value of p < 0.05 was considered to be statistically significant. 3. Results 3.1. Spatial working memory and recognition memory impairments were improved by maternal zinc supplementation
2.3.2. Y-maze recognition memory test The recognition memory test is based on an innate curiosity of rodents to explore novel areas. The test was conducted using a Y-maze as previously described by Sarnyai et al. with some modifications [29]. The test session consisted of two different trials including training and test trials. During the training trial, rats were allowed to freely explore maze with one blocked arm for 5 min followed by a 15-min inter-trial interval. Afterwards, rats were returned to the maze with all accessible arms for 2 min (test trial). The time spent within the novel arm was recorded and the recognition memory index was calculated as follow: (the time spent in the novel arm / total time spent in all arms during the first minute of the second trial) ×100.
To investigate whether prenatal zinc supplementation has the capacity to prevent LPS-induced memory impairment, two memory tasks including spontaneous alternation and recognition memory were performed on male and female offspring. While no significant difference in spontaneous alternation was observed for the female offspring (Fig. 2B), male pups exhibited a moderate decrease in prenatal LPS + vehicle treated group compared to control + vehicle (F (1, 26) = 8.594, p < 0.01). Prenatal zinc supplementation, however, significantly reversed the working memory impairment induced by LPS (F (1, 26) = 9.270, p < 0.01) (Fig. 2A). A similar trend was also observed for the recognition memory test in male offspring with a significant deficient memory in rats prenatally exposed to LPS compared to the control + vehicle group (F (1, 29) = 7.933, p < 0.01) (Fig. 2C). As expected, prenatal zinc supplementation was able to prevent LPS-induced impairment and pups spent more time in the novel arm compared to the LPS + vehicle treated group (F (1, 29) = 4.279, p < 0.05) (Fig. 2C). In contrast, female offspring in all treated group exhibited no different preference for the novel arm compared to the control group (Fig. 2D).
2.4. Tissue collection On PND 60–62, animals (n = 6 per each group, one animal per litter which selected randomly) were euthanized with asphyxiation by CO2 and brain samples were collected for further analysis. For qPCR, frontal cortex of brain tissues was dissected on ice, immediately snap-frozen in liquid nitrogen and finally stored at -80 °C until RNA extraction based on a study by Chiu et al [30]. 2.5. RNA extraction and qPCR
3.2. Maternal zinc supplementation reverses LPS-induced reduction in GAD67 expression level but has no effect on COMT mRNA level
RNA extraction and qPCR experiments were carried out in accordance with MIQE guidelines [31]. TRI reagent (Sigma-Aldrich, USA) was used to extract total RNA from the samples. Total RNA concentrations and purity were assessed using Nanodrop (Thermo Ficher, USA) and agarose gel electrophoresis, followed by DNase treatment (Fermentas, USA) according to the manufacturer’s instructions. One microgram of RNA samples was submitted to reverse transcription with a cDNA synthesis kit (Thermo Ficher, USA) using oligo-dT primers based on the manufacturer’s protocol. In order to evaluate gene expression, cDNA was amplified in triplicate using specific primers targeting GAD67 and COMT (Table 1) in SYBR Premix Ex Taq II (Takara, Japan). The reaction was performed in a Mic qPCR system (Australia) with a three-step procedure. The PCR cycling was initiated at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. As a reference gene, the expression of GAPDH was used to normalize the expression levels of target genes. Finally, the relative quantification of gene expression was calculated using the comparative Ct (2−ΔΔCt) method.
qPCR was applied to address whether improvement in working memory of LPS + Zinc group was associated with changes in GAD67 and COMT expression level. To investigate this, total RNA was extracted from the frontal cortex and the expression level of both genes was measured in offspring of all treated group. As shown in Fig. 3A, GAD67 expression was significantly down-regulated upon prenatal LPS exposure by two-fold (F (1, 12) = 11.82, p < 0.01) in male pups. Interestingly, prenatal zinc supplementation (LPS + Zinc group) was found to significantly elevate the mRNA level of GAD67 by nearly twofold (F (1, 12) = 15.57, p < 0.05) compared to the LPS + vehicle group (Fig. 3A). No significant change in GAD67 expression was detected for the female pups (Fig. 3B) in different experimental groups. Our data indicated that the mRNA level of COMT remained unchanged following prenatal LPS administration, with no significant effect of maternal zinc supplementation for both treated male and female offspring (Fig. 3C-D). 3
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
Fig. 2. Behavioral impairments were improved by maternal zinc supplementation in male offspring prenatally exposed to LPS. Prenatally exposed to LPS induced a significant decrease in both spontaneous alternation and recognition memory tests compared to control. These deficits were reversed by zinc supplementation throughout pregnancy (A, C). No significant behavioral impairments were observed for female offspring (B, D). Data are expressed as mean ± SEM, n = 6. **p < 0.01 relative to control + vehicle group. #p < 0.05, ##p < 0.01 relative to LPS + vehicle group. LPS: lipopolysaccharide.
4. Discussion
phenotype associated with schizophrenia in the offspring. In contrast, no alteration in working memory was observed in LPS-exposed female offspring. However, the general consensus from the literatures is that males display an earlier symptoms onset of the disease compared to the females [1], there are controversial results about the sex difference in cognitive performance of schizophrenic patients. While Roesch-Ely et al. reported a lack of any significant gender difference in working memory related to PFC [36], a recent study has documented more cognitive impairments in working memory in the male than female schizophrenic patients [37]. Similar to the human studies, conflicting results have been observed in animal models of schizophrenia. In line with our results, significant deficits in working memory was reported in the male offspring prenatally exposed to LPS (0.5 mg/kg, s.c.) at GD10/ 11 [9]. Using a similar protocol with a different LPS dose (0.1 mg/kg, i.p., GD15/16), however, Santos-Toscano et al. showed that female pups exhibited worse impairments in working memory than males upon maternal LPS treatment [8]. Further research in the model of MIA found that prenatal treatment with Poly I:C (5 mg/kg, i.v., GD7) induces impairment in spatial working memory of male pups using the Morris water maze [38]. The discrepancies observed in these studies may be due to the differences in methodology, infectious agents, animal strains, and the age of the animals. Given the important role of PFC in cognition as well as the implication of neurotransmitters–in particular dopamine and GABA in the pathophysiology of schizophrenia, for the first time, we evaluated the expression levels of GAD and COMT in frontal cortex in a MIA model of schizophrenia. Of note, due to the inconsistency in anatomical and functional definition of PFC area in rat [39], it was difficult to isolate the exact area. Therefore, in the present study, frontal cortex was dissected which contains PFC for gene expression analysis. Evidence has presented GAD67 as an important gene involved in the pathophysiology of schizophrenia [3]. The majority of postmortem studies have consistently found the diminished mRNA level of GAD67
As a devastating psychiatric disorder, schizophrenia has been found to be related to both genetic and environmental risk factors [3]. In particular, environmental factors including prenatal infection, malnutrition, drug abuse, and birth complications have become the focus of investigation in recent years with regard to schizophrenia etiology [3,32]. An increasing number of studies have revealed a tight connection between the altered level of trace elements and an increased risk for schizophrenia [33–35]. In the present study, we investigated the beneficial effects of zinc supplementation on both male and female offspring prenatally exposed to maternal LPS. The main findings of the study are as follow: (1) the prenatal treatment with LPS resulted in significant working memory impairments as well as a decreased expression level of GAD67 in the frontal cortex of male offspring. (2) prenatal zinc supplementation was able to ameliorate the mentioned deficits induced by maternal LPS exposure. (3) by contrast, LPS exposure was ineffective on behavioral phenotype, GAD67, and COMT expression level in female offspring. 4.1. The effects of prenatal treatment with LPS According to the neurodevelopmental hypothesis, maternal infection during pregnancy is a key risk factor for the development of schizophrenia in the offspring [3]. Based on this evidence, a number of studies did provide support for the use of MIA as a model to study the pathophysiology of schizophrenia. These studies also demonstrated that animals prenatally exposed to infectious agents such as LPS, showed significant behavioral impairments, evident in a variety of behavioral experiments including Morris water maze, T-maze, and pre-pulse inhibition (PPI) [7–10]. Consistent with these reports, we showed the impaired working memory in LPS-exposed male pups confirming that maternal infection induced by LPS makes a long-lasting behavioral 4
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
Fig. 3. Reduction in GAD67 mRNA level was reversed by maternal zinc supplementation in male offspring prenatally exposed to LPS. Maternal LPS treatment led to a significant decrease in the expression level of GAD67 in the frontal cortex of male offspring. This reduction was reversed by zinc supplementation throughout pregnancy (A). No significant difference in GAD67 expression level was detected for female offspring (B). COMT mRNA level was unchanged between the groups for both male and female pups (C, D). GAPDH expression was used for normalization of the target genes. Data are expressed as mean ± SEM, n = 6. **p < 0.01 relative to control + vehicle group. #p < 0.05 relative to LPS + vehicle group. LPS: lipopolysaccharide, GAD67: glutamate decarboxylase 67, COMT: catechol O-methyltransferase.
at 12 weeks [47]. The reason for this discrepancy might be explained by the difference in animal model and the age of testing.
in the dorsolateral PFC (DLPFC) region which results in decreased GABA concentrations and eventually cognitive impairment in schizophrenic patients [40]. Our results also showed a significant decrease in GAD67 expression in frontal cortex of the male rats prenatally treated with LPS. In agreement with this finding, Bullock et al. also demonstrated the reduced expression of GAD67 in the cerebellum in phencyclidine (PCP) treated rat model. In addition, they reported the similar results in lateral cerebellar hemisphere of patients suffering from schizophrenia [41]. Added to this, Sandhu et al. described disruption of social behavior as well as reduced intermale aggression in male GAD67 haplodeficient mice [42]. These findings provide strong support for the idea that GABAergic interneurons may be responsible for some of cognitive impairments observed in schizophrenia. Several studies demonstrated the role of dopaminergic impairments in prefrontal brain regions of schizophrenic patients [3]. COMT, which has been identified as being involved in cognition, is expressed significantly at the higher level in the PFC compared to the dopaminergic areas of brain, striatum, and brainstem [43]. Despite of apparent inconsistency in the literature, numerous studies have described the association between COMT polymorphism and cognitive impairments in patients with schizophrenia [44,45]. A recent meta-analysis by González-Castro et al. have reported a statistical relation between COMT genotype and the risk of schizophrenia [46]. Interestingly, no evidence was found for the relation between COMT mRNA level and COMT genotype in this disease [13,14] supporting that enzyme activity is more critical parameter than mRNA and protein levels. In line with this finding, our result also showed unchanged COMT mRNA level between treated groups. In an animal model of prenatal asphyxia, however, increased COMT expression was observed in medial PFC of male offspring
4.2. The effects of prenatal zinc supplementation It is well-known that zinc, having critical role in many cellular processes, is an essential trace element for normal brain growth and functions [48]. In this regard, zinc dyshomeostasis has been identified to strongly affect cognition which ultimately results in neurological abnormalities [17,18]. Added to this, several studies have demonstrated an intimate connection between zinc deficiency and impairments in learning and working memory, in which reduction in Brainderived neurotrophic factor (BDNF) has been suggested as a possible mechanism [21,22]. Another possible mechanism is that zinc, acting as an antagonist, is capable of inducing functional changes in N-methyl-Daspartate (NMDA) receptor [49] and is therefore considered as a putative modulator of neuronal signaling. Interestingly, an animal study has shown that gestational exposure to LPS leads to a sharp reduction in maternal zinc plasma level which induces abnormalities in fetuses [25,26]. Another study by the same group demonstrated that zinc supplementation throughout pregnancy can prevent the memory impairment induced by prenatal LPS exposure (0.3 mg/kg, s.c., GD8) [50]. Likewise, our results revealed that zinc supplementation given from the first day of pregnancy attenuated spatial working memory impairment as well as recognition memory deficit in the male pups prenatally treated with LPS. Similar trends were also presented by more recent study in which zinc supplementation during pregnancy was found to reverse the effects of LPS (0.2 mg/kg, i.p., GD14) on behavioral, neurochemical, and biochemical parameters in the offspring [24]. In 5
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
addition to this work, results from Kirsten et al. also suggested a beneficial effect of maternal zinc supplementation to prevent communication impairment and BDNF hyperactivity in the offspring prenatally exposed to LPS (0.1 mg/kg, i.p., GD9.5) [51]. The molecular mechanisms how zinc exerts a protective effect on the cognition deficits induced by LPS remain largely elusive. One potential mechanism is that zinc supplementation may prevent the fetal zinc deficiency induced by maternal infection. There is evidence that maternal treatment with LPS induces a dramatic increase in hepatic metallothionein, a zinc-binding protein, followed by the movement of zinc from plasma to the liver and eventually reduction in available zinc for fetal transfer [25]. Another mechanism for the protective effect of zinc might be due to its antioxidant property by which it can modulate the adverse effects induced by LPS [52]. In addition, our study revealed that zinc supplementation restored the expression of GAD67 disrupted by prenatally exposed to LPS treatment in male pups. As of today, a significant number of studies have highlighted the dysregulation of GAD67 in multiple brain regions, in particular, the PFC of schizophrenia subjects [15,53]. However, there are a few studies which have examined the effect of pharmacological treatments to prevent this impairment [54,55]. The underlying mechanisms how zinc supplementation could improve the GAD67 expression in the male rats exposed prenatally to LPS is not clear, although several possible mechanisms may account for this result. Zinc serves as an essential component of many proteins structure, in particular RNA polymerase and zinc-finger proteins, a large family of transcription factors, which are of utmost importance for gene expression [56]. Additionally, it should be noted that zinc efficiently involves in neurogenesis during brain development. As zinc deficiency leads to the reduction in cell proliferation and increase in apoptosis, consequently results in the neurogenesis impairment and decreased number of cells [48]. Therefore, this evidence leads to the assumption that zinc supplementation indirectly affects the expression of GAD67 in LPS + zinc group. Taken together, the present study demonstrates that maternal LPS exposure causes working memory impairments and decrease in the expression of GAD67, without altering COMT expression in male offspring compared to the control. However, no significant changes in working memory and the expression levels of GAD67 and COMT was detected for female pups. Given that females display later age of symptoms onset compared to the males [1], the evaluation of behavioral tests and genes expression in the older female pups would be of interest. In addition, the present data highlights the therapeutic effect of zinc supplementation throughout pregnancy to limit neurodevelopmental deficits in fetus induced by infectious agents.
[4] A.S. Brown, E.J. Derkits, Prenatal infection and schizophrenia: a review of epidemiologic and translational studies, Am. J. Psychiatry 167 (3) (2009) 261–280, https://doi.org/10.1176/appi.ajp.2009.09030361. [5] A.S. Brown, J. Hooton, C.A. Schaefer, H. Zhang, E. Petkova, V. Babulas, M. Perrin, J.M. Gorman, E.S. Susser, Elevated maternal interleukin-8 levels and risk of schizophrenia in adult offspring, Am. J. Psychiatry 161 (5) (2004) 889–895, https:// doi.org/10.1176/appi.ajp.161.5.889. [6] S.L. Buka, M.T. Tsuang, E.F. Torrey, M.A. Klebanoff, R.L. Wagner, R.H. Yolken, Maternal cytokine levels during pregnancy and adult psychosis, Brain Behav. Immun. 15 (4) (2001) 411–420 https://linkinghub.elsevier.com/retrieve/pii/ S0889159101906440. [7] D. Mattei, A. Djodari-Irani, R. Hadar, A. Pelz, L.F. de Cossío, T. Goetz, M. Matyash, H. Kettenmann, C. Winter, S.A. Wolf, Minocycline rescues decrease in neurogenesis, increase in microglia cytokines and deficits in sensorimotor gating in an animal model of schizophrenia, Brain Behav. Immun. 38 (2014) 175–184, https://doi.org/ 10.1016/j.bbi.2014.01.019. [8] R. Santos-Toscano, É. Borcel, M. Ucha, J. Orihuel, R. Capellán, D. Roura-Martínez, E. Ambrosio, A. Higuera-Matas, Unaltered cocaine self-administration in the prenatal LPS rat model of schizophrenia, Prog. Neuropsychopharmacol. Biol. Psychiatry 69 (2016) 38–48, https://doi.org/10.1016/j.pnpbp.2016.04.008. [9] U. Waterhouse, V.E. Roper, K.A. Brennan, B.A. Ellenbroek, Nicotine ameliorates schizophrenia-like cognitive deficits induced by maternal LPS exposure: a study in rats, Dis. Model. Mech. 9 (10) (2016) 1159–1167, https://doi.org/10.1242/dmm. 025072. [10] L. Wischhof, E. Irrsack, C. Osorio, M. Koch, Prenatal LPS-exposure–a neurodevelopmental rat model of schizophrenia–differentially affects cognitive functions, myelination and parvalbumin expression in male and female offspring, Prog. Neuropsychopharmacol. Biol. Psychiatry 57 (2015) 17–30, https://doi.org/10. 1016/j.pnpbp.2014.10.004. [11] J. Prata, S.G. Santos, M.I. Almeida, R. Coelho, M.A. Barbosa, Bridging Autism Spectrum disorders and Schizophrenia through inflammation and biomarkers-preclinical and clinical investigations, J. Neuroinflammation 14 (1) (2017) 179, https://doi.org/10.1186/s12974-017-0938-y. [12] O.D. Howes, S. Kapur, The dopamine hypothesis of schizophrenia: version III—the final common pathway, Schizophr. Bull. 35 (3) (2009) 549–562, https://doi.org/ 10.1093/schbul/sbp006. [13] M. Matsumoto, C.S. Weickert, S. Beltaifa, B. Kolachana, J. Chen, T.M. Hyde, M.M. Herman, D.R. Weinberger, J.E. Kleinman, Catechol O-methyltransferase (COMT) mRNA expression in the dorsolateral prefrontal cortex of patients with schizophrenia, Neuropsychopharmacology 28 (8) (2003) 1521, https://doi.org/10. 1038/sj.npp.1300218. [14] E. Tunbridge, P.W. Burnet, M.S. Sodhi, P.J. Harrison, Catechol‐o‐methyltransferase (COMT) and proline dehydrogenase (PRODH) mRNAs in the dorsolateral prefrontal cortex in schizophrenia, bipolar disorder, and major depression, Synapse 51 (2) (2004) 112–118, https://doi.org/10.1002/syn.10286. [15] S. Akbarian, H.-S. Huang, Molecular and cellular mechanisms of altered GAD1/ GAD67 expression in schizophrenia and related disorders, Brain Res. Rev. 52 (2) (2006) 293–304, https://doi.org/10.1016/j.brainresrev.2006.04.001. [16] H.E. Brown, J.L. Roffman, Vitamin supplementation in the treatment of schizophrenia, CNS Drugs 28 (7) (2014) 611–622 https://link.springer.com/article/10. 1007%2Fs40263-014-0172-4. [17] O. Grønli, J.M. Kvamme, O. Friborg, R. Wynn, Zinc deficiency is common in several psychiatric disorders, PLoS One 8 (12) (2013) e82793, https://doi.org/10.1371/ journal.pone.0082793. [18] M.A. Petrilli, T.M. Kranz, K. Kleinhaus, P. Joe, M. Getz, P. Johnson, M.V. Chao, D. Malaspina, The emerging role for zinc in depression and psychosis, Front. Pharmacol. 8 (2017) 414, https://doi.org/10.3389/fphar.2017.00414. [19] S.M. Hancock, D.I. Finkelstein, P.A. Adlard, Glia and zinc in ageing and Alzheimer’s disease: a mechanism for cognitive decline? Front. Aging Neurosci. 6 (2014) 137, https://doi.org/10.3389/fnagi.2014.00137. [20] A. Prakash, K. Bharti, A.B.A. Majeed, Zinc: indications in brain disorders, Fundam. Clin. Pharmacol. 29 (2) (2015) 131–149, https://doi.org/10.1111/fcp.12110. [21] V. Frazzini, A. Granzotto, M. Bomba, N. Massetti, V. Castelli, M. d’Aurora, M. Punzi, M. Iorio, A. Mosca, S.D. Pizzi, The pharmacological perturbation of brain zinc impairs BDNF-related signaling and the cognitive performances of young mice, Sci. Rep. 8 (1) (2018) 9768, https://doi.org/10.1038/s41598-018-28083-9. [22] X. Yu, W. Chen, Z. Wei, T. Ren, X. Yang, X. Yu, Effects of maternal mild zinc deficiency and different ways of zinc supplementation for offspring on learning and memory, Food Nutr. Res. 60 (1) (2016) 29467, https://doi.org/10.3402/fnr.v60. 29467. [23] R. Raqib, M.B. Hossain, S.L. Kelleher, C.B. Stephensen, B. Lönnerdal, Zinc supplementation of pregnant rats with adequate zinc nutriture suppresses immune functions in their offspring, J. Nutr. 137 (4) (2007) 1037–1042, https://doi.org/10. 1093/jn/137.4.1037. [24] N. Sharma, P. Arora, B. Nehru, Prenatal zinc supplementation to lipopolysaccharide infected female rats prevents neurochemical, behavioral and biochemical deficits produced in infants, Neuroimmunol Neuroinflammation. 4 (4) (2017) 33–45, https://doi.org/10.20517/2347-8659.2016.38. [25] L.C. Carey, P.L. Berbée, P. Coyle, J.C. Philcox, A.M. Rofe, Zinc treatment prevents lipopolysaccharide‐induced teratogenicity in mice, Birth Defects Res A Clin Mol Teratol. 67 (4) (2003) 240–245, https://doi.org/10.1002/bdra.10035. [26] J.S. Chua, C.J. Cowley, J. Manavis, A.M. Rofe, P. Coyle, Prenatal exposure to lipopolysaccharide results in neurodevelopmental damage that is ameliorated by zinc in mice, Brain Behav. Immun. 26 (2) (2012) 326–336, https://doi.org/10.1016/j. bbi.2011.10.002. [27] A. Moazedi, Z. Ghotbeddin, G. Parham, Comparison of the effects of dose-dependent
Declaration of Competing Interest The Authors declare no conflict of interest. Acknowledgements This research was supported by a grant [No. 960105] from Research Vice-Chancellor of Hormozgan University of Medical Sciences (HUMS), Iran and was done as a part of Master of Science thesis in Clinical Biochemistry. References [1] J.J. McGrath, F.P. Féron, T.H. Burne, A. Mackay-Sim, D.W. Eyles, The neurodevelopmental hypothesis of schizophrenia: a review of recent developments, Ann. Med. 35 (2) (2003) 86–93. [2] A.P. Association, Diagnostic and Statistical Manual of Mental Disorders (DSM-5®), American Psychiatric Pub, 2013. [3] U.E. Lang, I. Puls, D.J. Müller, N. Strutz-Seebohm, J. Gallinat, Molecular mechanisms of schizophrenia, Cell. Physiol. Biochem. 20 (6) (2007) 687–702, https://doi. org/10.1159/000110430.
6
Behavioural Brain Research 377 (2020) 112247
F. Alizadeh, et al.
[28]
[29]
[30]
[31]
[32] [33]
[34]
[35]
[36]
[37]
[38]
[39] [40]
[41]
[42]
[43]
zinc chloride on short-term and long-term memory in young male rats, Pak. J. Biol. Sci. 10 (16) (2007) 2704–2708. M. Ghasemi‐Kasman, L. Zare, H. Baharvand, M. Javan, In vivo conversion of astrocytes to myelinating cells by miR‐302/367 and valproate to enhance myelin repair, J. Tissue Eng. Regen. Med. 12 (1) (2018) e462–e472, https://doi.org/10. 1002/term.2276. Z. Sarnyai, E.L. Sibille, C. Pavlides, R.J. Fenster, B.S. McEwen, M. Tóth, Impaired hippocampal-dependent learning and functional abnormalities in the hippocampus in mice lacking serotonin1A receptors, Proc. Natl. Acad. Sci. U.S.A. 97 (26) (2000) 14731–14736, https://doi.org/10.1073/pnas.97.26.14731. K. Chiu, W.M. Lau, H.T. Lau, K.-F. So, R.C.-C. Chang, Micro-dissection of rat brain for RNA or protein extraction from specific brain region, J. Vis. Exp. 7 (2007) 269, https://doi.org/10.3791/269. S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M.W. Pfaffl, G.L. Shipley, The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments, Clin. Chem. 55 (4) (2009) 611–622, https://doi.org/10.1373/clinchem.2008.112797. K.I. Vadakkan, A structure-function mechanism for schizophrenia, Front. Psychiatry 3 (2012) 108, https://doi.org/10.3389/fpsyt.2012.00108. L. Cai, T. Chen, J. Yang, K. Zhou, X. Yan, W. Chen, L. Sun, L. Li, S. Qin, P. Wang, Serum trace element differences between Schizophrenia patients and controls in the Han Chinese population, Sci. Rep. 5 (2015) 15013, https://doi.org/10.1038/ srep15013. P. Joe, M. Petrilli, D. Malaspina, J. Weissman, Zinc in schizophrenia: a meta-analysis, Gen. Hosp. Psychiatry 53 (2018) 19–24, https://doi.org/10.1016/j. genhosppsych.2018.04.004. M. Yanik, A. Kocyigit, H. Tutkun, H. Vural, H. Herken, Plasma manganese, selenium, zinc, copper, and iron concentrations in patients with schizophrenia, Biol. Trace Elem. Res. 98 (2) (2004) 109–117, https://doi.org/10.1385/BTER:98:2:109. D. Roesch-Ely, E. Hornberger, S. Weiland, C. Hornstein, P. Parzer, C. Thomas, M. Weisbrod, Do sex differences affect prefrontal cortex associated cognition in schizophrenia? Schizophr. Res. 107 (2-3) (2009) 255–261, https://doi.org/10. 1016/j.schres.2008.09.021. B. Zhang, M. Han, S. Tan, F. De Yang, Y. Tan, S. Jiang, X. Zhang, X.-F. Huang, Gender differences measured by the MATRICS consensus cognitive battery in chronic schizophrenia patients, Sci. Rep. 7 (1) (2017) 11821, https://doi.org/10. 1038/s41598-017-12027-w. U. Meyer, I. Knuesel, M. Nyffeler, J. Feldon, Chronic clozapine treatment improves prenatal infection-induced working memory deficits without influencing adult hippocampal neurogenesis, Psychopharmacology (Berl.) 208 (4) (2010) 531–543, https://doi.org/10.1007/s00213-009-1754-6. H.B. Uylings, H.J. Groenewegen, B. Kolb, Do rats have a prefrontal cortex? Behav. Brain Res. 146 (1-2) (2003) 3–17, https://doi.org/10.1016/j.bbr.2003.09.028. J.C. de Jonge, C.H. Vinkers, H. Pol, E. Hilleke, A. Marsman, GABAergic mechanisms in schizophrenia: linking postmortem and in vivo studies, Front. Psychiatry 8 (2017) 118, https://doi.org/10.3389/fpsyt.2017.00118. W.M. Bullock, F. Bolognani, P. Botta, C.F. Valenzuela, N.I. Perrone-Bizzozero, Schizophrenia-like GABAergic gene expression deficits in cerebellar Golgi cells from rats chronically exposed to low-dose phencyclidine, Neurochem. Int. 55 (8) (2009) 775–782, https://doi.org/10.1016/j.neuint.2009.07.010. K. Sandhu, D. Lang, B. Müller, S. Nullmeier, Y. Yanagawa, H. Schwegler, O. Stork, Glutamic acid decarboxylase 67 haplodeficiency impairs social behavior in mice, Genes Brain Behav. 13 (4) (2014) 439–450, https://doi.org/10.1111/gbb.12131. M. Matsumoto, C.S. Weickert, M. Akil, B. Lipska, T. Hyde, M. Herman, J. Kleinman,
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
7
D. Weinberger, Catechol O-methyltransferase mRNA expression in human and rat brain: evidence for a role in cortical neuronal function, Neuroscience 116 (1) (2003) 127–137, https://doi.org/10.1016/S0306-4522(02)00556-0. K.E. Lewandowski, Relationship of catechol-O-methyltransferase to schizophrenia and its correlates: evidence for associations and complex interactions, Harv. Rev. Psychiatry 15 (5) (2007) 233–244, https://doi.org/10.1080/10673220701650409. C.T. Matsuzaka, D. Christofolini, V.K. Ota, A. Gadelha, A.A. Berberian, C. Noto, D.R. Mazzotti, L.M. Spindola, P.N. Moretti, M.A. Smith, Catechol-O-methyltransferase (COMT) polymorphisms modulate working memory in individuals with schizophrenia and healthy controls, Braz J Psychiatry. 39 (4) (2017) 302–308, https://doi.org/10.1590/1516-4446-2016-1987. T.B. González-Castro, Y. Hernandez-Diaz, I.E. Juárez-Rojop, M.L. López-Narváez, C.A. Tovilla-Zárate, A. Fresan, The role of a Catechol-O-Methyltransferase (COMT) Val158Met genetic polymorphism in schizophrenia: a systematic review and updated meta-analysis on 32,816 subjects, Neuromolecular Med. 18 (2) (2016) 216–231, https://doi.org/10.1007/s12017-016-8392-z. T. Wakuda, K. Iwata, Y. Iwata, A. Anitha, T. Takahashi, K. Yamada, M.M. Vasu, H. Matsuzaki, K. Suzuki, N. Mori, Perinatal asphyxia alters neuregulin-1 and COMT gene expression in the medial prefrontal cortex in rats, Prog. Neuropsychopharmacol. Biol. Psychiatry 56 (2015) 149–154, https://doi.org/10. 1016/j.pnpbp.2014.08.002. C.W. Levenson, D. Morris, Zinc and neurogenesis: making new neurons from development to adulthood, Adv. Nutr. 2 (2) (2011) 96–100, https://doi.org/10.3945/ an.110.000174. R.E. Sirrieh, D.M. MacLean, V. Jayaraman, Amino-terminal domain tetramer organization and structural effects of zinc binding in the N-methyl-D-aspartate (NMDA) receptor, J. Biol. Chem. 288 (31) (2013) 22555–22564, https://doi.org/ 10.1074/jbc.M113.482356. P. Coyle, N. Tran, J.N. Fung, B.L. Summers, A.M. Rofe, Maternal dietary zinc supplementation prevents aberrant behaviour in an object recognition task in mice offspring exposed to LPS in early pregnancy, Behav. Brain Res. 197 (1) (2009) 210–218, https://doi.org/10.1016/j.bbr.2008.08.022. T.B. Kirsten, N. Queiroz-Hazarbassanov, M.M. Bernardi, L.F. Felicio, Prenatal zinc prevents communication impairments and BDNF disturbance in a rat model of autism induced by prenatal lipopolysaccharide exposure, Life Sci. 130 (2015) 12–17, https://doi.org/10.1016/j.lfs.2015.02.027. G.G. Mackenzie, M.P. Zago, L. Aimo, P.I. Oteiza, Zinc deficiency in neuronal biology, IUBMB Life 59 (4-5) (2007) 299–307, https://doi.org/10.1080/ 15216540701225966. A.C. Mitchell, Y. Jiang, C. Peter, S. Akbarian, Transcriptional regulation of GAD1 GABA synthesis gene in the prefrontal cortex of subjects with schizophrenia, Schizophr. Res. 167 (1-3) (2015) 28–34, https://doi.org/10.1016/j.schres.2014.10. 020. N. Goto, R. Yoshimura, S. Kakeda, J. Moriya, H. Hori, K. Hayashi, A. IkenouchiSugita, W. Nakano-Umene, A. Katsuki, J. Nishimura, No alterations of brain GABA after 6 months of treatment with atypical antipsychotic drugs in early-stage firstepisode schizophrenia, Prog. Neuropsychopharmacol. Biol. Psychiatry 34 (8) (2010) 1480–1483, https://doi.org/10.1016/j.pnpbp.2010.08.007. O. Kelemen, I. Kiss, G. Benedek, S. Kéri, Perceptual and cognitive effects of antipsychotics in first-episode schizophrenia: the potential impact of GABA concentration in the visual cortex, Prog. Neuropsychopharmacol. Biol. Psychiatry 47 (2013) 13–19, https://doi.org/10.1016/j.pnpbp.2013.07.024. T.V. O’halloran, Transition metals in control of gene expression, Science 261 (5122) (1993) 715–725, https://doi.org/10.1126/science.8342038.