- Email: [email protected]
Presence and distribution of leptin and leptin receptor in the canine gallbladder
G Model ACTHIS-51118; No. of Pages 5
ARTICLE IN PRESS Acta Histochemica xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
Presence and distribution of leptin and leptin receptor in the canine gallbladder Sungin Lee, Aeri Lee, Oh-kyeong Kweon, Wan Hee Kim ∗ Department of Veterinary Clinical Sciences, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742, Republic of Korea
a r t i c l e
i n f o
Article history: Received 5 February 2016 Received in revised form 11 September 2016 Accepted 13 September 2016 Available online xxx Keywords: Leptin Leptin receptor Dog Gallbladder RT-PCR Immunohistochemistry
a b s t r a c t The hormone leptin is produced by mature adipocytes and plays an important role in regulating food intake and energy metabolism through its interaction with the leptin receptor. In addition to roles in obesity and obesity-related diseases, leptin has been reported to affect the components and secretion of bile in leptin-deficient mice. Furthermore, gallbladder diseases such as cholelithiasis are known to be associated with serum leptin concentrations in humans. We hypothesized that the canine gallbladder is a source of leptin and that the leptin receptor may be localized in the gallbladder, where it plays a role in regulating the function of this organ. The aim of this study was to demonstrate the presence and expression patterns of leptin and its receptors in normal canine gallbladders using reverse transcriptase-PCR (RT-PCR) and immunohistochemistry. Clinically normal gallbladder tissue samples were obtained from four healthy beagle dogs with similar body condition scores. RT-PCR and sequencing of the amplified PCR products revealed the presence of leptin mRNA and its receptors in the gallbladder. Immunohistochemical investigations demonstrated the expression of leptin and its receptors in the luminal single columnar and tubuloalveolar glandular epithelial cells. In conclusion, the results of this study demonstrated the presence of leptin and its receptors in the gallbladders of dogs. Leptin and its receptor were both localized throughout the cytoplasm of luminal and glandular epithelial cells. These results suggested that the gallbladder is not only a source of leptin, but also a target of leptin though autocrine/paracrine mechanisms. The results of this study could increase the understanding of both the normal physiological functions of the gallbladder and the pathophysiological mechanisms of gallbladder diseases characterized by leptin system dysfunction. © 2016 Published by Elsevier GmbH.
1. Introduction The hormone leptin is produced by mature adipocytes and plays an important role in regulating food intake and energy metabolism in the hypothalamus (Hirscbberg, 1998; Maffei et al., 1995). Leptin binds to and activates leptin receptors, which are part of the class-I cytokine receptor family. Six different isoforms of leptin receptors have been investigated so far, all of which share a common extracellular domain. Although most receptors have transmembrane and cytoplasmic domains, the fifth isoform (Ob-Re), known as the soluble isoform, circulates in the blood stream and does not have transmembrane and intracellular domains (Wang et al., 1996). The intracellular domain determines the characteristics of each of the isoforms. Leptin binds to the extracellular domain of the leptin
∗ Corresponding author. E-mail address: [email protected] (W.H. Kim).
receptor. The Ob-Rb isoform has the longest intracellular domain in addition to functional Janus-activated kinase-2 and signal transducer and activator of transcription binding sites, which play a role in signal transduction and transmission (Bjørbæk et al., 1997; Dam and Jockers, 2013). There is also evidence of signalling by other isoforms, such as erbB2, protein tyrosine phosphate 2/extracellular regulated kinase, and insulin receptor substrate/phosphoinositide 3-kinase (Frühbeck, 2006; Myers, 2004; Schulz and Widmaier, 2006). Since its discovery by Zhang et al. (1994), leptin and its receptors have been studied as important factors in energy metabolism and obesity (Clément et al., 1998; Montague et al., 1997). Furthermore, as the presence and distribution of leptin and its receptors have been reported in several organs and various species, leptin is thought to be involved in multiple clinical and pathological conditions. To understand the link between leptin and obesity, various physiological functions of leptin and its receptors have been studied: leptin expression in the stomach related to food intake in
http://dx.doi.org/10.1016/j.acthis.2016.09.002 0065-1281/© 2016 Published by Elsevier GmbH.
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002
G Model
ARTICLE IN PRESS
ACTHIS-51118; No. of Pages 5
S. Lee et al. / Acta Histochemica xxx (2016) xxx–xxx
2
Table 1 Oligonucleotide primer sequences used for reverse transcriptase-PCR in this study. Target gene
Accession Number
Direction
Sequence (5 to 3)’
Product Size (bp)
Ob
NM 001003070.1 NM 001024634.1
GAPDH
NM 001003142.2
ACCGTATGGGTGTCCTTTATCCT AGAGTGGCTCTGTGGTGTGAGA CTTTTGCCTGCTGGAATCTC TTGCTCCAAAAGCAACAGTG CATTGCCCTCAATGACCACT TCCTTGGAGGCCATGTGGAC
63
Ob-R
Forward Reverse Forward Reverse Forward Reverse
143 105
Ob: leptin, Ob-R: leptin receptor, GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
laboratory animals and humans (Bado et al., 1998; Sobhani et al., 2000) and leptin receptor expression in pancreatic -cells related to anti-obesity effects in laboratory animals (Kieffer et al., 1996). Furthermore, leptin dysregulation could be an important factor in the pathogenesis of cardiovascular (Wallace et al., 2001), endocrine (Leal-Cerro et al., 1996; Seufert et al., 1999), and neoplastic diseases (Rose et al., 2004). The gallbladder stores and concentrates bile through the reabsorption of water and inorganic salts, excreting the resultant mixture into the intestinal tract (Kierszenbaum and Tres, 2015). Bile acid, one of the components of bile, plays a critical role in the digestion and absorption of fats and fat-soluble vitamins in the small intestine. The systemic effect of leptin has been studied in relation to the physiological mechanisms of the gallbladder, and the relationship between leptin and biliary tract diseases has been revealed in human and laboratory animals. A previous study revealed that intraperitoneal leptin administration in ob/ob mice induced gallstone formation and cholesterol crystallization in a dose-dependent manner (Hyogo et al., 2003). Another study demonstrated enlarged gallbladder volume and decreased contractility in Ob/Ob mice. Leptin administration in these mice normalizes gallbladder function (Goldblatt et al., 2002; Swartz-Basile et al., 2007). In addition, alteration of serum leptin concentrations or leptin administration causes gallbladder dysfunction and diseases (Graewin et al., 2008; Sarac et al., 2015) Although many studies have suggested the relationships and effects of leptin on the gallbladder, no study has demonstrated the secretion of leptin and the localization of the leptin receptor in the gallbladder. In the present study, we aimed to demonstrate the presence and expression pattern of leptin and its receptors in the normal canine gallbladder using reverse transcriptase-PCR (RTPCR) and immunohistochemistry as a foundation for future studies on the role of leptin in both normal physiological functions and various diseases of the gallbladder, such as choleithiasis and gallbladder mucocele.
2. Materials and methods 2.1. Gallbladder sample collection Gallbladder tissue was aseptically harvested from four 2-yearold beagle dogs that were euthanized for other experiments that were not associated with liver and gallbladder function. This experiment was approved by the Institutional Animal Care and Use Committee of Seoul National University (SNU-150423-6). The dogs were clinically healthy with body condition scores of 5 or 6, and were confirmed to have normal gallbladders before euthanasia based on blood analysis, radiography, and ultrasonography. Gallbladder tissue was collected immediately after euthanasia and divided in two portions. One portion was promptly frozen in liquid nitrogen then stored at −80 ◦ C until required for further processing. The other portion was fixed by immersion in 10% neutral buffered formalin overnight at room temperature and subsequently embedded in paraffin blocks for immunohistochemical evaluation. All
gallbladders were reconfirmed to be normal by histopathological examination. 2.2. RT-PCR Total RNA was isolated from gallbladder samples using a HybridR RNA extraction kit (305-101, GeneAll Biotechnology, Seoul, Republic of Korea) according to the manufacturer’s instructions. The concentration of extracted total RNA was quantified using an Implen NanoPhotometer (model 1443, Implen GmbH, Munich, Germany). Specifically, 1000 ng of total RNA was used to synthesize cDNA. cDNA synthesis was performed on PrimeScriptTM 1st strand cDNA synthesis kits (6110A, Takara Bio, Tokyo, Japan) according to the manufacturer’s instructions. The synthesized cDNA was stored at −20 ◦ C. Each DNA template was amplified by PCR using a Mastercycler Pro thermal cycler (Eppendorf, Hauppauge, NY). The total PCR reaction mixture (20 L) contained PCR Premix (i-starTaq, iNtRON, Sungnam, Republic of Korea), 0.2 M forward and 0.2 M reverse primers (Standard Oligo, Bioneer, Daejeon, Korea), 1 L of cDNA, and 17 L of DNase/RNase-free distilled water (UltrapureTM , ThermoFisher Scientific, Waltham, MA, USA). For evaluation of contamination by other DNA, sterile DNase/RNase-free distilled water was used as a negative control. The primer sequences for canine leptin and leptin receptors used in this study are shown in Table 1. These primers for leptin (Fonfara et al., 2011) and its receptors (Mercati et al., 2014) were reported previously. Amplified DNA fragments of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as positive controls to confirm the integrity of the extracted RNA. The PCR conditions used were as follows: initial denaturation at 94 ◦ C (2 min) followed by 35 cycles consisting of denaturation at 94 ◦ C (20 s), annealing at 56 ◦ C (10 s), extension at 72 ◦ C (20 s), and final elongation at 72 ◦ C. The PCR products were analysed by electrophoresis on 1.5% agarose gel (Agarose LE, iNtRON, Sungnam, Republic of Korea). The identity of the amplified PCR products was confirmed by DNA cloning and sequencing. PCR products specific for canine leptin and leptin receptors were confirmed by cloning and sequencing. Purification and extraction of the amplified PCR products from 1.5% TAE agarose gels was conducted using PureLinkTM Quick Gel Extraction and Purification Combo kits (K220001, Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. The products were then ligated into the vector using an All in OneTM PCR Cloning kit (Biofact, Daejeon, Republic of Korea), cloned into Escherichia coli DH5␣, and subsequently sequenced. 2.3. Immunohistochemistry Protein expression of leptin and its receptors was evaluated by immunohistochemistry. Four-m thick paraffin sections were dewaxed in xylene two times for 5 min each and hydrated through a graded series of ethanol (100% twice, 90%, 80%, 70%, and tap water for 3 min each). Sections were incubated with 10-mM citric acid (pH 6.0) buffer for antigen retrieval using a 2100-retriver pressure
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002
G Model ACTHIS-51118; No. of Pages 5
ARTICLE IN PRESS S. Lee et al. / Acta Histochemica xxx (2016) xxx–xxx
3
Fig. 1. (A) Leptin (Ob) and leptin receptor (Ob-R) mRNA expression in the gallbladder of four dogs (1–4) revealed by reverse transcriptase PCR (RT-PCR). The amplified products of Ob (63 bp) and Ob-R (143 bp) were observed in the gallbladder of all dogs. The amplified products of glyceraldehyde 3-phosphate dehydrogenase (105 bp) were used as positive controls to confirm the integrity of the extracted RNA. The right-most bands were used to assess the negative controls (N). (B) The nucleotide sequences of the amplified PCR products. Ref Ob and Ref Ob-R indicate the leptin and leptin receptor sequences obtained from the NCBI sequence database. Seq Ob and Seq Ob-R indicate the leptin and leptin receptor sequences obtained using RT-PCR in this study. Each nucleotide sequence corresponded exactly to the expected sequences of canine leptin and the leptin receptor.
cooker (PickCell Laboratories, Amsterdam, Netherlands) for 20 min. Endogenous peroxidase activity was quenched by incubating twice with peroxidase-blocking (3% hydrogen peroxide) solution for 15 min. Normal horse serum (10% v/v in phosphate-buffered saline) was applied to sections for 1 h to block non-specific binding of the primary antibody. The sections were incubated overnight at 4 ◦ C with rabbit polyclonal anti-Ob antibody (1:500; sc-842, Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit polyclonal antiOb-R antibody (1:300; sc-1834-R, Santa Cruz Biotechnology, Santa Cruz, CA, USA), and normal rabbit polyclonal antibody (sc-2027, Santa Cruz Biotechnology, Santa cruz, CA, USA) to serve as a negative control. The sections were exposed to the secondary antibody ImmPRESSTM HRP Anti-Rabbit IgG (Peroxidase) Polymer Detection Kit derived from horse serum (MP-7401, Vector, CA, USA) for 1 h. They were visualized using a reaction with 3,3 -diaminobenzidine tetrahydrochloride (ImmPACTTM DAB peroxidase substrate kit, Vector, CA, USA) for 30 s. Counterstaining of the sections was performed with Mayer’s Hematoxylin for 1 min. Washing was performed between each procedure using Tris Buffered Saline with 0.05% Tween 20. The results of immunostaining were analysed using a light microscope (Olympus BX41, Olympus Optical, Tokyo, Japan) connected to a 130-megapixel digital camera (Tomoro ACQUCAM Pro, Techsan Community Co., Korea).
3. Results 3.1. RT-PCR Leptin and leptin receptors were detected in all of the normal canine gallbladder samples used (Fig. 1A). GAPDH was amplified in parallel, while no amplification products were detected in any of the negative control samples. This suggested good RNA integrity and proper product accumulation for both leptin and its receptors. 3.2. Analysis of amplified PCR products The sequence of each cloned amplified product was compared with published sequences of leptin and leptin receptors from the NCBI (National Center for Biotechnology Information) using ClustalW. The sequence of each cloned product matched the known sequences of canine leptin and leptin receptors (Fig. 1B). 3.3. Immunohistochemistry Immunohistochemistry revealed strong immunoreactivity for leptin (Fig. 2A) and leptin receptors (Fig. 2C) in the normal canine gallbladder. Leptin and its receptors were expressed in similar patterns. Strong positive staining for both leptin and the receptors was located in the cytoplasm of the luminal simple columnar epithelium (arrow in Fig. 2A and C). In addition, immunopositive reactions
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002
G Model ACTHIS-51118; No. of Pages 5
ARTICLE IN PRESS S. Lee et al. / Acta Histochemica xxx (2016) xxx–xxx
4
Fig. 2. Leptin (A) and leptin receptor (C) immunohistochemistry in the canine gallbladder. (A)(C) Immunopositive reactions localized in the luminal epithelium (arrow) and the epithelium of the tubuloalveolar glands (arrowhead). No specific staining is present in the negative controls used for both leptin (B) and the leptin receptor (D). Cell nuclei (blue) were stained with Mayer’s Hematoxylin. Scale bars = 100 m. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
were also present in the tubuloalveolar glands (arrowhead in Fig. 2A and C) at the lamina propria-submucosa. However, no specific reactions for leptin or its receptors were observed in the muscularis and adventitia or in the negative controls (Fig. 2B and D). 4. Discussion In this study, RT-PCR and immunohistochemistry revealed that leptin and leptin receptor are localized in the cytoplasm of luminal and glandular epithelial cells in the gallbladder, which are both in direct contact with bile. We hypothesize that this coexpression of leptin and its receptor may imply autocrine/paracrine mechanisms within the gallbladder. Although leptin binds to and activates leptin receptors on the surface of cells, the majority of leptin receptors are localized in intracellular compartments (Belouzard et al., 2004). Furthermore, the cytoplasmic immunostaining of leptin receptors in the luminal and glandular epithelia demonstrated in this study is in accordance with the cytoplasmic localization of leptin receptors in the brain (Couce et al., 1997; De Matteis and Cinti, 1998), adipose tissue (Bornstein et al., 2000), and enterocytes (Barrenetxe et al., 2002), suggesting that a similar signaling mechanism may be involved in these tissues. The roles of the gallbladder epithelium are to maintain the gallbladder environment and to regulate the bile components by secreting mucin, in addition to secreting and/or reabsorbing water and electrolytes. The neck of the gallbladder epithelium contains tubuloalveolar mucus glands that secrete mucus to create a surface that protects the wall of the biliary tree. Our hypothesis that leptin acts through autocrine/paracrine mechanisms is supported by previous studies. Ob/ob mice have enlarged volume and decreased contractility of the gallbladder (Swartz-Basile et al., 2007). Furthermore, Goldblatt et al. (2002) suggested that leptin may play a role in regulation of bile
secretion by modulating gallbladder motility. These researchers demonstrated that leptin-deficient mice have decreased gallbladder motility caused by decreased responses to neuropeptide Y, cholecystokinin, and acetylcholine. Moreover, leptin is involved in fat metabolism through modulation of bile composition and gallbladder contraction. A previous study showed that leptin administration may influence regulation of mRNA-encoding genes involved in bile salt synthesis and transport (Liang and Tall, 2001). However, further studies are needed to elucidate the exact mechanism underlying the relationship between leptin and fat metabolism in the gallbladder. Leptin may work through an endocrine pathway via leptin receptor in the gallbladder. This hypothesis is strengthened by previous research confirming that systemically injected leptin regulates gallbladder genes involved in transport of water, sodium, chloride, and bicarbonate, and demonstrating that leptin influences gallbladder bile volume and pH in ob/ob mice (Swartz-Basile et al., 2007). Another study showed that intraperitoneally injected leptin modulated gallbladder genes, including those coding for leptin receptor, cholecystokinine A receptor, acetylcholine 2 receptor, and Ca+ /calmodulin-dependent protein kinase, which are all related to the pathogenesis of gallstones (Graewin et al., 2008). Although various gallbladder morbidities have been increasingly researched in small animals, their exact pathogenesis and etiology are not yet fully understood. Gallbladder dysmotility results in hypersecretion of mucus and increased water absorption from bile, which is a main cause of various gallbladder diseases, including cholelithiasis and mucocele (Doty et al., 1983; Kesimer et al., 2015; Tsukagoshi et al., 2012). Considering the results of our study and the fact that gallbladder function is altered according to presence of leptin (Liang and Tall, 2001; Swartz-Basile et al., 2007), leptin may be the key to understand the pathophysiology of these gallbladder diseases as well as the healthy physiology of the gallbladder. Interestingly, a relationship between cholelithiasis
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002
G Model ACTHIS-51118; No. of Pages 5
ARTICLE IN PRESS S. Lee et al. / Acta Histochemica xxx (2016) xxx–xxx
and serum leptin level also has been observed in patients with this disease (Sarac et al., 2015). Although the influence of leptin on the gallbladder has been widely suspected and studied, its direct expression in the gallbladder has not yet been confirmed. This is a novel finding of the current study. Leptin has been shown to be produced in several organs of the gastrointestinal tract, including the stomach (Bado et al., 1998; Sobhani et al., 2000) and pancreas (Kieffer et al., 1996), while leptin receptors have been demonstrated in the small intestine (Lostao et al., 1998). The findings of the present study combined with these previous reports suggest that digestion and absorption of fat in the digestive organs may be regulated systemically by leptin through endocrine and paracrine/autocrine mechanisms. However, further studies are needed to rule out the possibility of leptin acting through an exocrine mechanism via bile, similar to the mechanism seen in the gastric mucosa (Cammisotto et al., 2005). One limitation of this study is that the leptin receptor antibody used in this study detected all isoforms of leptin receptor, which have different and distinct physiologic roles and signal transduction mechanisms. Further studies concerning the types of leptin receptors and their signaling mechanisms in the gallbladder are required. In conclusion, this study demonstrated presence of leptin and leptin receptor in the gallbladders of dogs. Leptin and its receptor were both localized throughout the cytoplasm of luminal and glandular epithelial cells. These results suggest that the gallbladder is not only a source of leptin, but also a target of leptin through autocrine/paracrine mechanisms. These findings could increase our understanding of the normal physiologic functions of the gallbladder as well as the pathophysiologic mechanisms of gallbladder diseases characterized by leptin system dysfunction. Conflict of interest The authors declare that they have no conflict of interest Acknowledgment The authors wish to thank M.S. Yum SY for her excellent technical assistance. References Bado, A., Levasseur, S., Attoub, S., Kermorgant, S., Laigneau, J.-P., Bortoluzzi, M.-N., Moizo, L., Lehy, T., Guerre-Millo, M., Le Marchand-Brustel, Y., 1998. The stomach is a source of leptin. Nature 394, 790–793. ˜ Barrenetxe, J., Villaro, A.C., Guembe, L., Pascual, I., Munoz-Navas, M., Barber, A., Lostao, M.P., 2002. Distribution of the long leptin receptor isoform in brush border, basolateral membrane, and cytoplasm of enterocytes. Gut 50, 797–802. Belouzard, S., Delcroix, D., Rouillé, Y., 2004. Low levels of expression of leptin receptor at the cell surface result from constitutive endocytosis and intracellular retention in the biosynthetic pathway. J. Biol. Chem. 279, 28499–28508. Bjørbæk, C., Uotani, S., da Silva, B., Flier, J.S., 1997. Divergent signaling capacities of the long and short isoforms of the leptin receptor. J. Biol. Chem. 272, 32686–32695. Bornstein, S.R., Abu-Asab, M., Glasow, A., Päth, G., Hauner, H., Tsokos, M., Chrousos, G.P., Scherbaum, W.A., 2000. Immunohistochemical and ultrastructural localization of leptin and leptin receptor in human white adipose tissue and differentiating human adipose cells in primary culture. Diabetes 49, 532–538. Cammisotto, P.G., Renaud, C., Gingras, D., Delvin, E., Levy, E., Bendayan, M., 2005. Endocrine and exocrine secretion of leptin by the gastric mucosa. J. Histochem. Cytochem. 53, 851–860. Clément, K., Vaisse, C., Lahlou, N., Cabrol, S., Pelloux, V., Cassuto, D., Gourmelen, M., Dina, C., Chambaz, J., Lacorte, J.-M., 1998. A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 392, 398–401. Couce, M.E., Burguera, B., Parisi, J.E., Jensen, M.D., Lloyd, R.V., 1997. Localization of leptin receptor in the human brain. Neuroendocrinology 66, 145–150.
5
Dam, J., Jockers, R., 2013. Hunting for the functions of short leptin receptor isoforms. Mol. Metab. 2, 327–328. De Matteis, R., Cinti, S., 1998. Ultrastructural immunolocalization of leptin receptor in mouse brain. Neuroendocrinology 68, 412–419. Doty, J.E., Pitt, H.A., Kuchenbecker, S.L., Porter-Fink, V., DenBesten, L.W., 1983. Role of gallbladder mucus in the pathogenesis of cholesterol gallstones. Am. J. Surg. 145, 54–61. Fonfara, S., Hetzel, U., Tew, S., Dukes-Mcewan, J., Cripps, P., Clegg, P., 2011. Leptin expression in dogs with cardiac disease and congestive heart failure. J. Vet. Intern. Med. 25, 1017–1024. Frühbeck, G., 2006. Intracellular signalling pathways activated by leptin. Biochem. J. 393, 7–20. Goldblatt, M.I., Swartz-Basile, D.A., Svatek, C.L., Nakeeb, A., Pitt, H.A., 2002. Decreased gallbladder response in leptin-deficient obese mice. J. Gastrointest. Surg. 6, 438–444. Graewin, S.J., Kiely, J.M., Lu, D., Svatek, C.L., Al-Azzawi, H.H., Swartz-Basile, D.A., Pitt, H.A., 2008. Leptin regulates gallbladder genes related to gallstone pathogenesis in leptin-deficient mice. J. Am. Coll. Surg. 206, 503–510. Hirscbberg, A.L., 1998. Hormonal regulation of appetite and food intake. Ann. Med. 30, 7–20. Hyogo, H., Roy, S., Cohen, D.E., 2003. Restoration of gallstone susceptibility by leptin in C57BL/6J ob/ob mice. J. Lipid Res. 44, 1232–1240. Kesimer, M., Cullen, J., Cao, R., Radicioni, G., Mathews, K.G., Seiler, G., Gookin, J.L., 2015. Excess secretion of gel-forming mucins and associated innate defense proteins with defective mucin un-Packaging underpin gallbladder mucocele formation in dogs. PLoS One 10, e0138988. Kieffer, T.J., Heller, R.S., Habener, J.F., 1996. Leptin receptors expressed on pancreatic -cells. Biochem. Biophys. Res. Commun. 224, 522–527. Kierszenbaum, A.L., Tres, L., 2015. Histology and Cell Biology: an Introduction to Pathology. Elsevier Health Sciences. Leal-Cerro, A., Considine, R., Peino, R., Venegas, E., Astorga, R., Casanueva, F., Dieguez, C., 1996. Serum immunoreactive-leptin levels are increased in patients with Cushing’s syndrome. Horm. Metab. Res. 28, 711–713. Liang, C.-P., Tall, A.R., 2001. Transcriptional profiling reveals global defects in energy metabolism, lipoprotein, and bile acid synthesis and transport with reversal by leptin treatment in ob/ob mouse liver. J. Biol. Chem. 276, 49066–49076. Lostao, M.P., Urdaneta, E., Martı´ınez-Ansó, E., Barber, A., Martı´ınez, J.A., 1998. Presence of leptin receptors in rat small intestine and leptin effect on sugar absorption. FEBS Lett. 423, 302–306. Maffei, M., Fei, H., Lee, G.-H., Dani, C., Leroy, P., Zhang, Y., Proenca, R., Negrel, R., Ailhaud, G., Friedman, J.M., 1995. Increased expression in adipocytes of ob RNA in mice with lesions of the hypothalamus and with mutations at the db locus. Proc. Natl. Acad. Sci. U. S. A. 92, 6957–6960. Mercati, F., Maranesi, M., Dall’Aglio, C., Scocco, P., Pascucci, L., Boiti, C., Ceccarelli, P., 2014. Leptin receptor is expressed by epidermis and skin appendages in dog. Acta Histochem. 116, 1270–1275. Montague, C.T., Farooqi, I.S., Whitehead, J.P., Soos, M.A., Rau, H., Wareham, N.J., Sewter, C.P., Digby, J.E., Mohammed, S.N., Hurst, J.A., 1997. Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387, 903–907. Myers, M.G., 2004. Leptin receptor signaling and the regulation of mammalian physiology. Recent Prog. Horm. Res. 59, 287–304. Rose, D., Komninou, D., Stephenson, G., 2004. Obesity, adipocytokines, and insulin resistance in breast cancer. Obes. Rev. 5, 153–165. Sarac, S., Atamer, A., Atamer, Y., Can, A.S., Bilici, A., Tacyildiz, I., Kocyigit, Y., Yenice, N., 2015. Leptin levels and lipoprotein profiles in patients with cholelithiasis. J. Int. Med. Res. 43, 385–392. Schulz, L.C., Widmaier, E.P., 2006. Leptin receptors. In: Castracane, V.D., Henson, M.C. (Eds.), Leptin. Springer, US, pp. 11–31. Seufert, J., Kieffer, T.J., Leech, C.A., Holz, G.G., Moritz, W., Ricordi, C., Habener, J.F., 1999. Leptin suppression of insulin secretion and gene expression in human pancreatic islets: implications for the development of adipogenic diabetes mellitus 1. J. Clin. Endocrinol. Metab. 84, 670–676. Sobhani, I., Bado, A., Vissuzaine, C., Buyse, M., Kermorgant, S., Laigneau, J., Attoub, S., Lehy, T., Henin, D., Mignon, M., 2000. Leptin secretion and leptin receptor in the human stomach. Gut 47, 178–183. Swartz-Basile, D.A., Lu, D., Basile, D.P., Graewin, S.J., Al-Azzawi, H., Kiely, J.M., Mathur, A., Yancey, K., Pitt, H.A., 2007. Leptin regulates gallbladder genes related to absorption and secretion. Am. J. Physiol. Gastrointest. Liver Physiol. 293, G84–90. Tsukagoshi, T., Ohno, K., Tsukamoto, A., Fukushima, K., Takahashi, M., Nakashima, K., Fujino, Y., Tsujimoto, H., 2012. Decreased gallbladder emptying in dogs with biliary sludge or gallbladder mucocele. Vet. Radiol. Ultrasound 53, 84–91. Wallace, A.M., McMahon, A.D., Packard, C.J., Kelly, A., Shepherd, J., Gaw, A., Sattar, N., 2001. Plasma leptin and the risk of cardiovascular disease in the west of Scotland coronary prevention study (WOSCOPS). Circulation 104, 3052–3056. Wang, M.-Y., Yan, T.Z., Newgard, C.B., Unger, R.H., 1996. A novel leptin receptor isoform in rat. FEBS Lett. 392, 87–90. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J.M., 1994. Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425–432.
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002
ARTICLE IN PRESS Acta Histochemica xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
Presence and distribution of leptin and leptin receptor in the canine gallbladder Sungin Lee, Aeri Lee, Oh-kyeong Kweon, Wan Hee Kim ∗ Department of Veterinary Clinical Sciences, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742, Republic of Korea
a r t i c l e
i n f o
Article history: Received 5 February 2016 Received in revised form 11 September 2016 Accepted 13 September 2016 Available online xxx Keywords: Leptin Leptin receptor Dog Gallbladder RT-PCR Immunohistochemistry
a b s t r a c t The hormone leptin is produced by mature adipocytes and plays an important role in regulating food intake and energy metabolism through its interaction with the leptin receptor. In addition to roles in obesity and obesity-related diseases, leptin has been reported to affect the components and secretion of bile in leptin-deficient mice. Furthermore, gallbladder diseases such as cholelithiasis are known to be associated with serum leptin concentrations in humans. We hypothesized that the canine gallbladder is a source of leptin and that the leptin receptor may be localized in the gallbladder, where it plays a role in regulating the function of this organ. The aim of this study was to demonstrate the presence and expression patterns of leptin and its receptors in normal canine gallbladders using reverse transcriptase-PCR (RT-PCR) and immunohistochemistry. Clinically normal gallbladder tissue samples were obtained from four healthy beagle dogs with similar body condition scores. RT-PCR and sequencing of the amplified PCR products revealed the presence of leptin mRNA and its receptors in the gallbladder. Immunohistochemical investigations demonstrated the expression of leptin and its receptors in the luminal single columnar and tubuloalveolar glandular epithelial cells. In conclusion, the results of this study demonstrated the presence of leptin and its receptors in the gallbladders of dogs. Leptin and its receptor were both localized throughout the cytoplasm of luminal and glandular epithelial cells. These results suggested that the gallbladder is not only a source of leptin, but also a target of leptin though autocrine/paracrine mechanisms. The results of this study could increase the understanding of both the normal physiological functions of the gallbladder and the pathophysiological mechanisms of gallbladder diseases characterized by leptin system dysfunction. © 2016 Published by Elsevier GmbH.
1. Introduction The hormone leptin is produced by mature adipocytes and plays an important role in regulating food intake and energy metabolism in the hypothalamus (Hirscbberg, 1998; Maffei et al., 1995). Leptin binds to and activates leptin receptors, which are part of the class-I cytokine receptor family. Six different isoforms of leptin receptors have been investigated so far, all of which share a common extracellular domain. Although most receptors have transmembrane and cytoplasmic domains, the fifth isoform (Ob-Re), known as the soluble isoform, circulates in the blood stream and does not have transmembrane and intracellular domains (Wang et al., 1996). The intracellular domain determines the characteristics of each of the isoforms. Leptin binds to the extracellular domain of the leptin
∗ Corresponding author. E-mail address: [email protected] (W.H. Kim).
receptor. The Ob-Rb isoform has the longest intracellular domain in addition to functional Janus-activated kinase-2 and signal transducer and activator of transcription binding sites, which play a role in signal transduction and transmission (Bjørbæk et al., 1997; Dam and Jockers, 2013). There is also evidence of signalling by other isoforms, such as erbB2, protein tyrosine phosphate 2/extracellular regulated kinase, and insulin receptor substrate/phosphoinositide 3-kinase (Frühbeck, 2006; Myers, 2004; Schulz and Widmaier, 2006). Since its discovery by Zhang et al. (1994), leptin and its receptors have been studied as important factors in energy metabolism and obesity (Clément et al., 1998; Montague et al., 1997). Furthermore, as the presence and distribution of leptin and its receptors have been reported in several organs and various species, leptin is thought to be involved in multiple clinical and pathological conditions. To understand the link between leptin and obesity, various physiological functions of leptin and its receptors have been studied: leptin expression in the stomach related to food intake in
http://dx.doi.org/10.1016/j.acthis.2016.09.002 0065-1281/© 2016 Published by Elsevier GmbH.
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002
G Model
ARTICLE IN PRESS
ACTHIS-51118; No. of Pages 5
S. Lee et al. / Acta Histochemica xxx (2016) xxx–xxx
2
Table 1 Oligonucleotide primer sequences used for reverse transcriptase-PCR in this study. Target gene
Accession Number
Direction
Sequence (5 to 3)’
Product Size (bp)
Ob
NM 001003070.1 NM 001024634.1
GAPDH
NM 001003142.2
ACCGTATGGGTGTCCTTTATCCT AGAGTGGCTCTGTGGTGTGAGA CTTTTGCCTGCTGGAATCTC TTGCTCCAAAAGCAACAGTG CATTGCCCTCAATGACCACT TCCTTGGAGGCCATGTGGAC
63
Ob-R
Forward Reverse Forward Reverse Forward Reverse
143 105
Ob: leptin, Ob-R: leptin receptor, GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
laboratory animals and humans (Bado et al., 1998; Sobhani et al., 2000) and leptin receptor expression in pancreatic -cells related to anti-obesity effects in laboratory animals (Kieffer et al., 1996). Furthermore, leptin dysregulation could be an important factor in the pathogenesis of cardiovascular (Wallace et al., 2001), endocrine (Leal-Cerro et al., 1996; Seufert et al., 1999), and neoplastic diseases (Rose et al., 2004). The gallbladder stores and concentrates bile through the reabsorption of water and inorganic salts, excreting the resultant mixture into the intestinal tract (Kierszenbaum and Tres, 2015). Bile acid, one of the components of bile, plays a critical role in the digestion and absorption of fats and fat-soluble vitamins in the small intestine. The systemic effect of leptin has been studied in relation to the physiological mechanisms of the gallbladder, and the relationship between leptin and biliary tract diseases has been revealed in human and laboratory animals. A previous study revealed that intraperitoneal leptin administration in ob/ob mice induced gallstone formation and cholesterol crystallization in a dose-dependent manner (Hyogo et al., 2003). Another study demonstrated enlarged gallbladder volume and decreased contractility in Ob/Ob mice. Leptin administration in these mice normalizes gallbladder function (Goldblatt et al., 2002; Swartz-Basile et al., 2007). In addition, alteration of serum leptin concentrations or leptin administration causes gallbladder dysfunction and diseases (Graewin et al., 2008; Sarac et al., 2015) Although many studies have suggested the relationships and effects of leptin on the gallbladder, no study has demonstrated the secretion of leptin and the localization of the leptin receptor in the gallbladder. In the present study, we aimed to demonstrate the presence and expression pattern of leptin and its receptors in the normal canine gallbladder using reverse transcriptase-PCR (RTPCR) and immunohistochemistry as a foundation for future studies on the role of leptin in both normal physiological functions and various diseases of the gallbladder, such as choleithiasis and gallbladder mucocele.
2. Materials and methods 2.1. Gallbladder sample collection Gallbladder tissue was aseptically harvested from four 2-yearold beagle dogs that were euthanized for other experiments that were not associated with liver and gallbladder function. This experiment was approved by the Institutional Animal Care and Use Committee of Seoul National University (SNU-150423-6). The dogs were clinically healthy with body condition scores of 5 or 6, and were confirmed to have normal gallbladders before euthanasia based on blood analysis, radiography, and ultrasonography. Gallbladder tissue was collected immediately after euthanasia and divided in two portions. One portion was promptly frozen in liquid nitrogen then stored at −80 ◦ C until required for further processing. The other portion was fixed by immersion in 10% neutral buffered formalin overnight at room temperature and subsequently embedded in paraffin blocks for immunohistochemical evaluation. All
gallbladders were reconfirmed to be normal by histopathological examination. 2.2. RT-PCR Total RNA was isolated from gallbladder samples using a HybridR RNA extraction kit (305-101, GeneAll Biotechnology, Seoul, Republic of Korea) according to the manufacturer’s instructions. The concentration of extracted total RNA was quantified using an Implen NanoPhotometer (model 1443, Implen GmbH, Munich, Germany). Specifically, 1000 ng of total RNA was used to synthesize cDNA. cDNA synthesis was performed on PrimeScriptTM 1st strand cDNA synthesis kits (6110A, Takara Bio, Tokyo, Japan) according to the manufacturer’s instructions. The synthesized cDNA was stored at −20 ◦ C. Each DNA template was amplified by PCR using a Mastercycler Pro thermal cycler (Eppendorf, Hauppauge, NY). The total PCR reaction mixture (20 L) contained PCR Premix (i-starTaq, iNtRON, Sungnam, Republic of Korea), 0.2 M forward and 0.2 M reverse primers (Standard Oligo, Bioneer, Daejeon, Korea), 1 L of cDNA, and 17 L of DNase/RNase-free distilled water (UltrapureTM , ThermoFisher Scientific, Waltham, MA, USA). For evaluation of contamination by other DNA, sterile DNase/RNase-free distilled water was used as a negative control. The primer sequences for canine leptin and leptin receptors used in this study are shown in Table 1. These primers for leptin (Fonfara et al., 2011) and its receptors (Mercati et al., 2014) were reported previously. Amplified DNA fragments of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as positive controls to confirm the integrity of the extracted RNA. The PCR conditions used were as follows: initial denaturation at 94 ◦ C (2 min) followed by 35 cycles consisting of denaturation at 94 ◦ C (20 s), annealing at 56 ◦ C (10 s), extension at 72 ◦ C (20 s), and final elongation at 72 ◦ C. The PCR products were analysed by electrophoresis on 1.5% agarose gel (Agarose LE, iNtRON, Sungnam, Republic of Korea). The identity of the amplified PCR products was confirmed by DNA cloning and sequencing. PCR products specific for canine leptin and leptin receptors were confirmed by cloning and sequencing. Purification and extraction of the amplified PCR products from 1.5% TAE agarose gels was conducted using PureLinkTM Quick Gel Extraction and Purification Combo kits (K220001, Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. The products were then ligated into the vector using an All in OneTM PCR Cloning kit (Biofact, Daejeon, Republic of Korea), cloned into Escherichia coli DH5␣, and subsequently sequenced. 2.3. Immunohistochemistry Protein expression of leptin and its receptors was evaluated by immunohistochemistry. Four-m thick paraffin sections were dewaxed in xylene two times for 5 min each and hydrated through a graded series of ethanol (100% twice, 90%, 80%, 70%, and tap water for 3 min each). Sections were incubated with 10-mM citric acid (pH 6.0) buffer for antigen retrieval using a 2100-retriver pressure
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002
G Model ACTHIS-51118; No. of Pages 5
ARTICLE IN PRESS S. Lee et al. / Acta Histochemica xxx (2016) xxx–xxx
3
Fig. 1. (A) Leptin (Ob) and leptin receptor (Ob-R) mRNA expression in the gallbladder of four dogs (1–4) revealed by reverse transcriptase PCR (RT-PCR). The amplified products of Ob (63 bp) and Ob-R (143 bp) were observed in the gallbladder of all dogs. The amplified products of glyceraldehyde 3-phosphate dehydrogenase (105 bp) were used as positive controls to confirm the integrity of the extracted RNA. The right-most bands were used to assess the negative controls (N). (B) The nucleotide sequences of the amplified PCR products. Ref Ob and Ref Ob-R indicate the leptin and leptin receptor sequences obtained from the NCBI sequence database. Seq Ob and Seq Ob-R indicate the leptin and leptin receptor sequences obtained using RT-PCR in this study. Each nucleotide sequence corresponded exactly to the expected sequences of canine leptin and the leptin receptor.
cooker (PickCell Laboratories, Amsterdam, Netherlands) for 20 min. Endogenous peroxidase activity was quenched by incubating twice with peroxidase-blocking (3% hydrogen peroxide) solution for 15 min. Normal horse serum (10% v/v in phosphate-buffered saline) was applied to sections for 1 h to block non-specific binding of the primary antibody. The sections were incubated overnight at 4 ◦ C with rabbit polyclonal anti-Ob antibody (1:500; sc-842, Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit polyclonal antiOb-R antibody (1:300; sc-1834-R, Santa Cruz Biotechnology, Santa Cruz, CA, USA), and normal rabbit polyclonal antibody (sc-2027, Santa Cruz Biotechnology, Santa cruz, CA, USA) to serve as a negative control. The sections were exposed to the secondary antibody ImmPRESSTM HRP Anti-Rabbit IgG (Peroxidase) Polymer Detection Kit derived from horse serum (MP-7401, Vector, CA, USA) for 1 h. They were visualized using a reaction with 3,3 -diaminobenzidine tetrahydrochloride (ImmPACTTM DAB peroxidase substrate kit, Vector, CA, USA) for 30 s. Counterstaining of the sections was performed with Mayer’s Hematoxylin for 1 min. Washing was performed between each procedure using Tris Buffered Saline with 0.05% Tween 20. The results of immunostaining were analysed using a light microscope (Olympus BX41, Olympus Optical, Tokyo, Japan) connected to a 130-megapixel digital camera (Tomoro ACQUCAM Pro, Techsan Community Co., Korea).
3. Results 3.1. RT-PCR Leptin and leptin receptors were detected in all of the normal canine gallbladder samples used (Fig. 1A). GAPDH was amplified in parallel, while no amplification products were detected in any of the negative control samples. This suggested good RNA integrity and proper product accumulation for both leptin and its receptors. 3.2. Analysis of amplified PCR products The sequence of each cloned amplified product was compared with published sequences of leptin and leptin receptors from the NCBI (National Center for Biotechnology Information) using ClustalW. The sequence of each cloned product matched the known sequences of canine leptin and leptin receptors (Fig. 1B). 3.3. Immunohistochemistry Immunohistochemistry revealed strong immunoreactivity for leptin (Fig. 2A) and leptin receptors (Fig. 2C) in the normal canine gallbladder. Leptin and its receptors were expressed in similar patterns. Strong positive staining for both leptin and the receptors was located in the cytoplasm of the luminal simple columnar epithelium (arrow in Fig. 2A and C). In addition, immunopositive reactions
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002
G Model ACTHIS-51118; No. of Pages 5
ARTICLE IN PRESS S. Lee et al. / Acta Histochemica xxx (2016) xxx–xxx
4
Fig. 2. Leptin (A) and leptin receptor (C) immunohistochemistry in the canine gallbladder. (A)(C) Immunopositive reactions localized in the luminal epithelium (arrow) and the epithelium of the tubuloalveolar glands (arrowhead). No specific staining is present in the negative controls used for both leptin (B) and the leptin receptor (D). Cell nuclei (blue) were stained with Mayer’s Hematoxylin. Scale bars = 100 m. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
were also present in the tubuloalveolar glands (arrowhead in Fig. 2A and C) at the lamina propria-submucosa. However, no specific reactions for leptin or its receptors were observed in the muscularis and adventitia or in the negative controls (Fig. 2B and D). 4. Discussion In this study, RT-PCR and immunohistochemistry revealed that leptin and leptin receptor are localized in the cytoplasm of luminal and glandular epithelial cells in the gallbladder, which are both in direct contact with bile. We hypothesize that this coexpression of leptin and its receptor may imply autocrine/paracrine mechanisms within the gallbladder. Although leptin binds to and activates leptin receptors on the surface of cells, the majority of leptin receptors are localized in intracellular compartments (Belouzard et al., 2004). Furthermore, the cytoplasmic immunostaining of leptin receptors in the luminal and glandular epithelia demonstrated in this study is in accordance with the cytoplasmic localization of leptin receptors in the brain (Couce et al., 1997; De Matteis and Cinti, 1998), adipose tissue (Bornstein et al., 2000), and enterocytes (Barrenetxe et al., 2002), suggesting that a similar signaling mechanism may be involved in these tissues. The roles of the gallbladder epithelium are to maintain the gallbladder environment and to regulate the bile components by secreting mucin, in addition to secreting and/or reabsorbing water and electrolytes. The neck of the gallbladder epithelium contains tubuloalveolar mucus glands that secrete mucus to create a surface that protects the wall of the biliary tree. Our hypothesis that leptin acts through autocrine/paracrine mechanisms is supported by previous studies. Ob/ob mice have enlarged volume and decreased contractility of the gallbladder (Swartz-Basile et al., 2007). Furthermore, Goldblatt et al. (2002) suggested that leptin may play a role in regulation of bile
secretion by modulating gallbladder motility. These researchers demonstrated that leptin-deficient mice have decreased gallbladder motility caused by decreased responses to neuropeptide Y, cholecystokinin, and acetylcholine. Moreover, leptin is involved in fat metabolism through modulation of bile composition and gallbladder contraction. A previous study showed that leptin administration may influence regulation of mRNA-encoding genes involved in bile salt synthesis and transport (Liang and Tall, 2001). However, further studies are needed to elucidate the exact mechanism underlying the relationship between leptin and fat metabolism in the gallbladder. Leptin may work through an endocrine pathway via leptin receptor in the gallbladder. This hypothesis is strengthened by previous research confirming that systemically injected leptin regulates gallbladder genes involved in transport of water, sodium, chloride, and bicarbonate, and demonstrating that leptin influences gallbladder bile volume and pH in ob/ob mice (Swartz-Basile et al., 2007). Another study showed that intraperitoneally injected leptin modulated gallbladder genes, including those coding for leptin receptor, cholecystokinine A receptor, acetylcholine 2 receptor, and Ca+ /calmodulin-dependent protein kinase, which are all related to the pathogenesis of gallstones (Graewin et al., 2008). Although various gallbladder morbidities have been increasingly researched in small animals, their exact pathogenesis and etiology are not yet fully understood. Gallbladder dysmotility results in hypersecretion of mucus and increased water absorption from bile, which is a main cause of various gallbladder diseases, including cholelithiasis and mucocele (Doty et al., 1983; Kesimer et al., 2015; Tsukagoshi et al., 2012). Considering the results of our study and the fact that gallbladder function is altered according to presence of leptin (Liang and Tall, 2001; Swartz-Basile et al., 2007), leptin may be the key to understand the pathophysiology of these gallbladder diseases as well as the healthy physiology of the gallbladder. Interestingly, a relationship between cholelithiasis
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002
G Model ACTHIS-51118; No. of Pages 5
ARTICLE IN PRESS S. Lee et al. / Acta Histochemica xxx (2016) xxx–xxx
and serum leptin level also has been observed in patients with this disease (Sarac et al., 2015). Although the influence of leptin on the gallbladder has been widely suspected and studied, its direct expression in the gallbladder has not yet been confirmed. This is a novel finding of the current study. Leptin has been shown to be produced in several organs of the gastrointestinal tract, including the stomach (Bado et al., 1998; Sobhani et al., 2000) and pancreas (Kieffer et al., 1996), while leptin receptors have been demonstrated in the small intestine (Lostao et al., 1998). The findings of the present study combined with these previous reports suggest that digestion and absorption of fat in the digestive organs may be regulated systemically by leptin through endocrine and paracrine/autocrine mechanisms. However, further studies are needed to rule out the possibility of leptin acting through an exocrine mechanism via bile, similar to the mechanism seen in the gastric mucosa (Cammisotto et al., 2005). One limitation of this study is that the leptin receptor antibody used in this study detected all isoforms of leptin receptor, which have different and distinct physiologic roles and signal transduction mechanisms. Further studies concerning the types of leptin receptors and their signaling mechanisms in the gallbladder are required. In conclusion, this study demonstrated presence of leptin and leptin receptor in the gallbladders of dogs. Leptin and its receptor were both localized throughout the cytoplasm of luminal and glandular epithelial cells. These results suggest that the gallbladder is not only a source of leptin, but also a target of leptin through autocrine/paracrine mechanisms. These findings could increase our understanding of the normal physiologic functions of the gallbladder as well as the pathophysiologic mechanisms of gallbladder diseases characterized by leptin system dysfunction. Conflict of interest The authors declare that they have no conflict of interest Acknowledgment The authors wish to thank M.S. Yum SY for her excellent technical assistance. References Bado, A., Levasseur, S., Attoub, S., Kermorgant, S., Laigneau, J.-P., Bortoluzzi, M.-N., Moizo, L., Lehy, T., Guerre-Millo, M., Le Marchand-Brustel, Y., 1998. The stomach is a source of leptin. Nature 394, 790–793. ˜ Barrenetxe, J., Villaro, A.C., Guembe, L., Pascual, I., Munoz-Navas, M., Barber, A., Lostao, M.P., 2002. Distribution of the long leptin receptor isoform in brush border, basolateral membrane, and cytoplasm of enterocytes. Gut 50, 797–802. Belouzard, S., Delcroix, D., Rouillé, Y., 2004. Low levels of expression of leptin receptor at the cell surface result from constitutive endocytosis and intracellular retention in the biosynthetic pathway. J. Biol. Chem. 279, 28499–28508. Bjørbæk, C., Uotani, S., da Silva, B., Flier, J.S., 1997. Divergent signaling capacities of the long and short isoforms of the leptin receptor. J. Biol. Chem. 272, 32686–32695. Bornstein, S.R., Abu-Asab, M., Glasow, A., Päth, G., Hauner, H., Tsokos, M., Chrousos, G.P., Scherbaum, W.A., 2000. Immunohistochemical and ultrastructural localization of leptin and leptin receptor in human white adipose tissue and differentiating human adipose cells in primary culture. Diabetes 49, 532–538. Cammisotto, P.G., Renaud, C., Gingras, D., Delvin, E., Levy, E., Bendayan, M., 2005. Endocrine and exocrine secretion of leptin by the gastric mucosa. J. Histochem. Cytochem. 53, 851–860. Clément, K., Vaisse, C., Lahlou, N., Cabrol, S., Pelloux, V., Cassuto, D., Gourmelen, M., Dina, C., Chambaz, J., Lacorte, J.-M., 1998. A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 392, 398–401. Couce, M.E., Burguera, B., Parisi, J.E., Jensen, M.D., Lloyd, R.V., 1997. Localization of leptin receptor in the human brain. Neuroendocrinology 66, 145–150.
5
Dam, J., Jockers, R., 2013. Hunting for the functions of short leptin receptor isoforms. Mol. Metab. 2, 327–328. De Matteis, R., Cinti, S., 1998. Ultrastructural immunolocalization of leptin receptor in mouse brain. Neuroendocrinology 68, 412–419. Doty, J.E., Pitt, H.A., Kuchenbecker, S.L., Porter-Fink, V., DenBesten, L.W., 1983. Role of gallbladder mucus in the pathogenesis of cholesterol gallstones. Am. J. Surg. 145, 54–61. Fonfara, S., Hetzel, U., Tew, S., Dukes-Mcewan, J., Cripps, P., Clegg, P., 2011. Leptin expression in dogs with cardiac disease and congestive heart failure. J. Vet. Intern. Med. 25, 1017–1024. Frühbeck, G., 2006. Intracellular signalling pathways activated by leptin. Biochem. J. 393, 7–20. Goldblatt, M.I., Swartz-Basile, D.A., Svatek, C.L., Nakeeb, A., Pitt, H.A., 2002. Decreased gallbladder response in leptin-deficient obese mice. J. Gastrointest. Surg. 6, 438–444. Graewin, S.J., Kiely, J.M., Lu, D., Svatek, C.L., Al-Azzawi, H.H., Swartz-Basile, D.A., Pitt, H.A., 2008. Leptin regulates gallbladder genes related to gallstone pathogenesis in leptin-deficient mice. J. Am. Coll. Surg. 206, 503–510. Hirscbberg, A.L., 1998. Hormonal regulation of appetite and food intake. Ann. Med. 30, 7–20. Hyogo, H., Roy, S., Cohen, D.E., 2003. Restoration of gallstone susceptibility by leptin in C57BL/6J ob/ob mice. J. Lipid Res. 44, 1232–1240. Kesimer, M., Cullen, J., Cao, R., Radicioni, G., Mathews, K.G., Seiler, G., Gookin, J.L., 2015. Excess secretion of gel-forming mucins and associated innate defense proteins with defective mucin un-Packaging underpin gallbladder mucocele formation in dogs. PLoS One 10, e0138988. Kieffer, T.J., Heller, R.S., Habener, J.F., 1996. Leptin receptors expressed on pancreatic -cells. Biochem. Biophys. Res. Commun. 224, 522–527. Kierszenbaum, A.L., Tres, L., 2015. Histology and Cell Biology: an Introduction to Pathology. Elsevier Health Sciences. Leal-Cerro, A., Considine, R., Peino, R., Venegas, E., Astorga, R., Casanueva, F., Dieguez, C., 1996. Serum immunoreactive-leptin levels are increased in patients with Cushing’s syndrome. Horm. Metab. Res. 28, 711–713. Liang, C.-P., Tall, A.R., 2001. Transcriptional profiling reveals global defects in energy metabolism, lipoprotein, and bile acid synthesis and transport with reversal by leptin treatment in ob/ob mouse liver. J. Biol. Chem. 276, 49066–49076. Lostao, M.P., Urdaneta, E., Martı´ınez-Ansó, E., Barber, A., Martı´ınez, J.A., 1998. Presence of leptin receptors in rat small intestine and leptin effect on sugar absorption. FEBS Lett. 423, 302–306. Maffei, M., Fei, H., Lee, G.-H., Dani, C., Leroy, P., Zhang, Y., Proenca, R., Negrel, R., Ailhaud, G., Friedman, J.M., 1995. Increased expression in adipocytes of ob RNA in mice with lesions of the hypothalamus and with mutations at the db locus. Proc. Natl. Acad. Sci. U. S. A. 92, 6957–6960. Mercati, F., Maranesi, M., Dall’Aglio, C., Scocco, P., Pascucci, L., Boiti, C., Ceccarelli, P., 2014. Leptin receptor is expressed by epidermis and skin appendages in dog. Acta Histochem. 116, 1270–1275. Montague, C.T., Farooqi, I.S., Whitehead, J.P., Soos, M.A., Rau, H., Wareham, N.J., Sewter, C.P., Digby, J.E., Mohammed, S.N., Hurst, J.A., 1997. Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387, 903–907. Myers, M.G., 2004. Leptin receptor signaling and the regulation of mammalian physiology. Recent Prog. Horm. Res. 59, 287–304. Rose, D., Komninou, D., Stephenson, G., 2004. Obesity, adipocytokines, and insulin resistance in breast cancer. Obes. Rev. 5, 153–165. Sarac, S., Atamer, A., Atamer, Y., Can, A.S., Bilici, A., Tacyildiz, I., Kocyigit, Y., Yenice, N., 2015. Leptin levels and lipoprotein profiles in patients with cholelithiasis. J. Int. Med. Res. 43, 385–392. Schulz, L.C., Widmaier, E.P., 2006. Leptin receptors. In: Castracane, V.D., Henson, M.C. (Eds.), Leptin. Springer, US, pp. 11–31. Seufert, J., Kieffer, T.J., Leech, C.A., Holz, G.G., Moritz, W., Ricordi, C., Habener, J.F., 1999. Leptin suppression of insulin secretion and gene expression in human pancreatic islets: implications for the development of adipogenic diabetes mellitus 1. J. Clin. Endocrinol. Metab. 84, 670–676. Sobhani, I., Bado, A., Vissuzaine, C., Buyse, M., Kermorgant, S., Laigneau, J., Attoub, S., Lehy, T., Henin, D., Mignon, M., 2000. Leptin secretion and leptin receptor in the human stomach. Gut 47, 178–183. Swartz-Basile, D.A., Lu, D., Basile, D.P., Graewin, S.J., Al-Azzawi, H., Kiely, J.M., Mathur, A., Yancey, K., Pitt, H.A., 2007. Leptin regulates gallbladder genes related to absorption and secretion. Am. J. Physiol. Gastrointest. Liver Physiol. 293, G84–90. Tsukagoshi, T., Ohno, K., Tsukamoto, A., Fukushima, K., Takahashi, M., Nakashima, K., Fujino, Y., Tsujimoto, H., 2012. Decreased gallbladder emptying in dogs with biliary sludge or gallbladder mucocele. Vet. Radiol. Ultrasound 53, 84–91. Wallace, A.M., McMahon, A.D., Packard, C.J., Kelly, A., Shepherd, J., Gaw, A., Sattar, N., 2001. Plasma leptin and the risk of cardiovascular disease in the west of Scotland coronary prevention study (WOSCOPS). Circulation 104, 3052–3056. Wang, M.-Y., Yan, T.Z., Newgard, C.B., Unger, R.H., 1996. A novel leptin receptor isoform in rat. FEBS Lett. 392, 87–90. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J.M., 1994. Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425–432.
Please cite this article in press as: Lee, S., et al., Presence and distribution of leptin and leptin receptor in the canine gallbladder. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.09.002