Presence of c-kit mRNA in goat ovaries and improvement of in vitro preantral follicle survival and development with kit ligand

Molecular and Cellular Endocrinology 345 (2011) 38–47

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

Presence of c-kit mRNA in goat ovaries and improvement of in vitro preantral follicle survival and development with kit ligand I.M.T. Lima a,⇑, I.R. Brito a, G.Q. Rodrigues a, C.M.G. Silva a, D.M. Magalhães-Padilha a, L.F. Lima a, J.J.H. Celestino a, C.C. Campello a, J.R.V. Silva b, J.R. Figueiredo a, A.P.R. Rodrigues a a b

Faculty of Veterinary, Laboratory of Manipulation of Oocyte and Preantral Follicles (LAMOFOPA), State University of Ceará, Fortaleza, CE, Brazil Biotechnology Nucleus of Sobral (NUBIS), Federal University of Ceará, Sobral, CE, Brazil

a r t i c l e

i n f o

Article history: Received 6 April 2011 Received in revised form 1 July 2011 Accepted 1 July 2011 Available online 6 July 2011 Keywords: c-kit mRNA KL In vitro culture Caprine Ovary

a b s t r a c t This study evaluated the levels of c-kit mRNA in goat follicles and the effects of kit ligand (KL) on the in vitro development of cultured preantral follicles. Preantral follicles isolated from goat ovarian cortex were cultured for 18 days in a-MEM+ supplemented with KL (0, 50 or 100 ng/mL) in the absence or presence of follicle stimulating hormone (FSH). Real-time PCR showed that c-kit mRNA was higher in primordial and primary follicles than in secondary stage. Regarding the culture, KL addition in the absence of FSH improved the follicular survival, antrum formation, oocyte growth and meiotic resumption. KL-positive effects were not observed in the presence of FSH. In conclusion, c-kit mRNAs are detected in all follicular categories. KL promotes the survival and antral cavity formation of caprine preantral follicles after in vitro culture, as well as the growth and meiotic resumption of their oocytes in the absence of FSH. Ó 2011 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Several assisted reproduction technologies (ART), including in vitro embryo production, nuclear transfer and transgenic animal production, depend on the availability of mature oocytes. However, current methods of obtaining mature oocytes have low success rates, mainly because they use antral follicles, which provide a restricted number of these structures. Thus, there is considerable interest in in vitro technologies that aim to produce fully-grown, developmentally competent oocytes from preantral follicles, as these follicles represent about 90% of the follicular population in the mammalian ovary and, therefore, are able to provide thousands of oocytes that can grow and mature after in vitro culture (Muruvi et al., 2005). Progress has occurred in the ability to culture preantral follicles in different species, resulting in antrum cavity formation in hamster (Roy and Greenwald, 1989), cattle (Gutierrez et al., 2000), woman (Roy and Treacy, 1993; Telfer et al., 2008) and bitch (Serafim et al., 2010), as well as the embryo production in pig (Wu et al., 2001), buffalo (Gupta et al., 2008), sheep (Arunakumari et al., ⇑ Corresponding author. Address: Universidade Estadual do Ceará (UECE), Faculdade de Veterinária, Programa de Pós-Graduação em Ciências Veterinárias (PPGCV), Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais (LAMOFOPA), Av. Paranjana, 1700, Campus do Itaperi, CEP: 60740-930, Fortaleza – CE, Brazil. Tel.: +55 85 3101 9852; fax: +55 85 3101 9840. E-mail address: [email protected] (I.M.T. Lima). 0303-7207/$ - see front matter Ó 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2011.07.006

2010) and goats (Magalhães et al., 2011a). Nevertheless, among all species studied to date, the birth of live offspring from oocytes of cultured preantral follicles was achieved only in the mouse (Eppig and Schroeder, 1989; O’Brien et al., 2003). Therefore, a great deal of effort is still required to improve the rate of embryo production and births from preantral follicles. The in vitro culture of preantral follicles is influenced by various substances, including hormones, peptides and growth factors. Among growth factors, kit ligand (KL), also known as stem cell factor, steel factor or mast cell growth factor, has demonstrated an essential role in follicular development, acting at different follicle stages (Celestino et al., 2009). In the ovary, the KL mRNA expression has been detected in the granulosa cells of many species (human: Carlsson et al., 2006; rat: Ismail et al., 1996; goat: Silva et al., 2006; Celestino et al., 2010; sheep: Tisdall et al., 1999), and it can be expressed as either a membrane-bound (KL-1) or a soluble protein (KL-2) (Huang et al., 1992). Both KL isoforms influence target cells by binding to a tyrosine kinase receptor, c-kit. c-kit mRNA and protein are expressed in oocytes at all stages of follicular development, as well as in the interstitial and theca cells of antral follicles in mice (Motro and Bernstein, 1993), sheep (Clark et al., 1996) and goats (Silva et al., 2006). However, in goats, quantification of the levels of c-kit mRNA during different follicle stages has not been performed yet. In vivo and in vitro studies have shown that the functions of the KL/c-kit system in the ovary include the establishment of primordial germ cells (PGC), primordial follicle activation, oocyte survival

I.M.T. Lima et al. / Molecular and Cellular Endocrinology 345 (2011) 38–47

and growth, granulosa cell proliferation, theca cell recruitment and maintenance of meiotic competence (Hutt et al., 2006a; Thomas et al., 2008). In addition, some studies have reported that KL inhibits the expression of BMP-15 by the oocytes, increasing the expression of FSH receptors (Otsuka and Shimasaki, 2002; Thomas et al., 2005). FSH is known to regulate the KL expression in the granulosa cells in a biphasic manner, with a low concentration of FSH decreasing the ratio of KL-1/KL-2 mRNA and a high concentration of this hormone increasing such a ratio (Thomas et al., 2005). Another study also reported an interrelationship between KL and FSH, showing a significant increase in the oocyte diameter of rabbit preantral follicles after in vitro culture with these both substances (Hutt et al., 2006b). However, although several studies have been performed, little is known about the role of KL associated or not with FSH during the in vitro development of caprine preantral follicles. Therefore, the aims of the present study were (1) to determine the levels of c-kit mRNA during different follicular stages in goat ovaries, and (2) to investigate the effects of different KL concentrations in the absence and presence of FSH on the survival and development of isolated caprine preantral follicles after the in vitro culture, as well as on the ability of oocytes to undergo meiotic resumption. 2. Materials and methods This work was divided into three experiments: the quantification of c-kit mRNA in goat ovaries (Experiment 1) and the in vitro culture of caprine preantral follicles in medium supplemented with KL (50 ng/mL or 100 ng/mL) in the absence (Experiment 2) and presence of FSH (Experiment 3) in the basic medium. The KL and FSH concentrations used herein were chosen based on previous studies conducted in our laboratory (Celestino et al., 2010; Saraiva et al., in press). 2.1. Chemicals Recombinant human KL and recombinant bovine FSH were purchased from Cell Sciences (Canton, MA, USA) and Nanocore (São Paulo, SP, Brazil), respectively. The culture media and other chemicals used in the present study were purchased from Sigma Chemical Co. (St Louis, MO, USA) unless mentioned otherwise. 2.2. Source of ovaries A total of 106 ovaries were collected from adult cross-breed goats (Capra hircus) from a local slaughterhouse. Collections occurred on 12 different days during the non-rainy season (4 days per experiment). Some of the ovaries (n = 26) were used in Experiment 1, while the remaining (n = 80) were used in Experiments 2 and 3. Immediately after the slaughter, the ovaries were washed in 70% alcohol for 10 s, followed by two washes in Minimum Essential Medium (MEM) buffered with HEPES (MEM–HEPES) and supplemented with penicillin (100 lg/mL) and streptomycin (100 lg/ mL). Subsequently, the ovaries were transported at 4 °C to the laboratory within one hour (Chaves et al., 2008).

39

secondary follicles (150–300 lm) were microdissected from the ovarian cortex. After isolation, these follicles (30 per category, obtained in 4 replicates) were washed several times and were then placed by category into separate Eppendorf tubes in groups of 10. This procedure was completed within two hours, and all samples were stored at 80 °C until the RNA was extracted. From the second group of ovaries, COCs were aspirated from small and large antral follicles. Compact COCs were selected from the follicle content as described by van Tol and Bevers (1998). Thereafter, groups of 10 COCs were stored at 80 °C until RNA extraction. To collect mural granulosa and theca cell complexes, small (n = 10) and large antral follicles (n = 10) were isolated from ovaries and dissected free from stromal tissue using 26-G needles. The follicles were then divided in half to eliminate the follicular fluid and COC and to collect the granulosa/theca cells, which were subsequently stored at 80 °C. Isolation of total RNA was performed using the Trizol Plus purification kit (Invitrogen, São Paulo, Brazil). According to the manufacturer’s instructions, 1 mL of Trizol solution was added to each frozen sample, and the lysate was aspirated through a 20-G needle before centrifugation at 10,000 g for 3 min at room temperature. Thereafter, all lysates were diluted 1:1 with 70% ethanol and subjected to a mini-column to retain total RNA in this column. After binding of the RNA to the column, DNA digestion was performed using RNAse-free DNAse (340 Kunitz units/ml) for 15 min at room temperature. After washing the column three times, the RNA was eluted with 30 lL RNAse-free water. Prior to reverse transcription, the eluted RNA samples were incubated for 5 min at 70 °C and chilled on ice. Reverse transcription was then performed in a total volume of 20 lL, which comprised of 10 lL of sample RNA, 4 lL 5 reverse transcriptase buffer (Invitrogen), 8 U RNAse-out, 150 U Superscript III reverse transcriptase, 0.036 U random primers (Invitrogen), 10 mM DTT and 0.5 mM of each dNTP. The mixture was incubated for one hour at 42 °C, for 5 min at 80 °C, and then stored at 20 °C. Negative controls were prepared under the same conditions but without the inclusion of the reverse transcriptase. Quantification of c-kit mRNA was performed using SYBR Green. PCR reactions contained 1 lL cDNA as a template in 7.5 lL of SYBR Green Master Mix (PE Applied Biosystems, Foster City, CA), 5.5 lL of ultra-pure water and 0.5 lm of each primer. The primers were designed to perform amplification of c-kit mRNA. GAPDH and b-actin (Table 1) were used as endogenous controls for the normalization of the mRNA levels. The thermal cycling profile for the first round of PCR was as follows: initial denaturation and activation of the polymerase for 15 min at 94 °C, followed by 40 cycles of 15 s at 94 °C, 30 s at 60 °C, and 45 s at 72 °C. The final extension was for 10 min at 72 °C. All reactions were performed in a realtime PCR Mastercycler (Eppendorf, Germany). The delta–delta-CT method and the geNorm software program were used to transform CT values into the normalized relative levels of mRNA. The geNorm program uses the geometric mean of more than one reference gene in order to reduce the variations and errors in the analysis of the final expression. The normalization of data was based on two reference genes (b-actin and GAPDH), and such genes were used to determine a normalization factor, that is basically the geometric mean of the transcription levels of these reference genes (Vandesompele et al., 2002).

2.3. Experiment 1: Levels of c-kit mRNA in goat ovarian follicles 2.4. Preantral follicle isolation and selection Ten ovaries were used for the mechanical isolation of primordial, primary and secondary follicles. From the other samples (n = 16), COCs and mural cells (granulosa and theca cells) were collected from small (1–3 mm) and large (3–6 mm) antral follicles. Primordial and primary follicles were isolated using a previously described mechanical procedure (Lucci et al., 1999), while

The remaining ovaries (n = 80) were equally divided between Experiments 2 and 3. In the laboratory, fine fragments of the ovarian cortex (1–2 mm thick) were obtained with a sterile scalpel blade. Then, the ovarian cortex slices were placed in a fragmentation medium consisting of HEPES-buffered MEM. Caprine preantral

40

I.M.T. Lima et al. / Molecular and Cellular Endocrinology 345 (2011) 38–47

Table 1 Oligonucleotide primers used for PCR analysis of goat cells and tissues. Target gene

Primer sequence (50 ? 30 )

Sense

Position

GenBank accession n°

GAPDH

TGTTTGTGATGGGCGTGAACCA ATGGCGTGGACAGTGGTCATAA ACCACTGGCATTGTCATGGACTCT TCCTTGATGTCACGGACGATTTCC AGTTTCCCAGGAACAGGCTGAGTT CGTTCTGTTAAATGGGCGCTTGGT

s as s as s as

287–309 440–462 187–211 386–410 1751–1775 1904–1928

GI:27525390 (2005) Capra hircus GAPDH

b-actin c-kit

GI:28628620 (2003) Capra hircus b-actin GI:633053 (2006) Capra hircus c-kit

s, sense; as, antisense

follicles with approximately 150–300 lm in diameter were visualized under a stereomicroscope (SMZ 645 Nikon, Tokyo, Japan) and manually dissected from strips of the ovarian cortex using 26-gauge (26 G) needles. After isolation, follicles were transferred to 100 lL drops containing fresh medium under mineral oil to further evaluate follicular quality. Follicles with a visible oocyte (approximately 60 lm in diameter) that were surrounded by granulosa cells and had an intact basement membrane and no antral cavity were selected for culture in both experiments. 2.5. Experiment 2: Culture of caprine preantral follicles with KL (basic medium without FSH) After selection, the follicles were individually cultured (one per drop) in 100 lL drops of culture medium in Petri dishes (60  15 mm, Corning, USA) under mineral oil for 18 days at 39 °C and 5% CO2 in air. The basic culture medium consisted of a-MEM (pH 7.2–7.4) supplemented with 3 mg/mL bovine serum albumin (BSA), ITS (10 lg/mL insulin, 5.5 lg/mL transferrin and 5 ng/mL selenium), 2 mM glutamine, 2 mM hypoxanthine and 50 lg/mL ascorbic acid in the absence (control) or presence of KL at 50 ng/mL (KL 50) or 100 ng/mL (KL 100). Every other day, 60 lL of the culture media were replaced with fresh medium in each drop, except at days 6 and 12 of culture, in which total medium replenishment (100 lL) was performed. The culture was replicated four times and a final total of at least 40 follicles were used for each treatment (approximately 10 follicles/replicate). 2.6. Experiment 3: Culture of caprine preantral follicles with KL (basic medium containing FSH) For this experiment, we used the same basic medium as in Experiment 2, except for the sequential addition of recombinant FSH: 100 ng/mL from day 0 to day 6, 500 ng/mL from day 6 to day 12 and 1000 ng/mL from day 12 to day 18 of culture (Saraiva et al., in press). Total medium replacements (100 lL) were performed on days 6 and 12 of culture and partial replacements (60 lL) were performed every other day. The preantral follicles were randomly distributed among the treatments: control FSH (only sequential FSH) or sequential FSH supplemented with 50 or 100 ng/mL KL (KL 50 (FSH) and KL 100 (FSH), respectively), and a final total of at least 40 follicles were used for each treatment (total of four replicates: approximately 10 follicles/replicate). The follicles were individually cultured for 18 days under the same conditions as previously described for Experiment 2. 2.7. Morphological evaluation of follicular development Follicles were classified according to their morphological aspect, and only those showing intact basement membrane, bright and homogeneous granulosa cells and absence of morphological signs of degeneration, such as darkness of the oocytes and surrounding cumulus cells, or misshapen oocytes, were classified as

surviving follicles. Follicular diameter was measured only in surviving follicles every six days of culture (days 0, 6, 12 and 18) by mean of two perpendicular measures of each follicle using an ocular micrometer (100 magnification) inserted into a stereomicroscope (SMZ 645 Nikon, Tokyo, Japan). Antral cavity formation was defined as the occurrence of a visible translucent cavity within the granulosa cell layers, regardless of its dimension. This event was also considered a survival characteristic, since follicles without antrum formation after in vitro culture were classified as degenerated.

2.8. In vitro maturation (IVM) of caprine oocytes from in vitro cultured preantral follicles At the end of the culture period, the oocytes were recovered from follicles using 26-G needles. These structures were washed twice with TCM199 medium buffered with HEPES (TCM199– HEPES) and were measured to include the zona pellucida, as described for the follicles. It is important to note that only oocytes P110 lm (Crozet et al., 2000), with a homogeneous cytoplasm and surrounded by at least one compact layer of cumulus cells were selected for the maturation procedures. The recovery rate was calculated by dividing the number of oocytes P110 lm by the number of follicles cultured in each treatment and multiplying this number by 100. The selected cumulus–oocyte complexes were washed three times in maturation medium composed of TCM199 supplemented with 0.5 lg/mL FSH, 5 lg/mL LH, 1 lg/mL 17bestradiol, 10 ng/mL recombinant epidermal growth factor (EGF), 0.911 mMol/L pyruvate, 100 lMol/L cysteamine, 50 ng/mL recombinant insulin-like growth factor I (IGF-I) and 1% BSA. The oocytes were grouped into different treatments and were cultured in 100 lL drops of medium on culture dishes (30  15 mm) under mineral oil for 40 h in an incubator at 39 °C with 5% CO2 in air.

2.9. Assessment of oocyte viability and chromatin configuration Fluorescence microscopy was used to analyze the viability of oocytes isolated from caprine preantral follicles after 18 days of culture. Briefly, the oocytes were incubated in 100 lL drops of TCM199–HEPES supplemented with 4 lM calcein–AM, 2 lM ethidium homodimer-1 (Molecular Probes, Invitrogen, Karlsruhe, Germany) and 10 lM Hoechst 33342 (Sigma, Deisenhofen, Germany) at 37 °C for 15 min. After incubation, the oocytes were washed three times with TCM199–HEPES and were evaluated under a fluorescence microscope (Nikon, Eclipse 80i, Tokyo, Japan). Oocytes were considered to be alive if the cytoplasm was stained positively with calcein–AM (green) and if the chromatin was not labeled with ethidium homodimer-1 (red). Hoechst was used to analyze the oocyte chromatin configuration by observing the intact germinal vesicle (GV), meiotic resumption (including germinal vesicle breakdown – GVBD, metaphase I – MI, anaphase I – AI or telophase I – TI) and nuclear maturation (metaphase II – MII).

I.M.T. Lima et al. / Molecular and Cellular Endocrinology 345 (2011) 38–47

2.10. Statistical analysis Data referring to c-kit mRNA expression in primordial, primary and secondary follicles were analyzed using the Kruskal–Wallis test (SAS, 2002), whereas the t-test was used for paired comparisons of mRNA expression in the small and large antral follicles (P < 0.05). Data concerning follicular survival, fully grown oocytes, antrum formation and meiotic resumption after in vitro culture were analyzed as dispersion of frequency, expressed in percentages and compared using the Chi–square test. Data on follicle and oocyte diameters after culture did not show homoscedasticity, even after transformation, and were then compared using the non-parametric Kruskal–Wallis test (SAS, 2002). The results were expressed as the mean values ± standard deviation (SD), and differences were considered to be significant when P < 0.05.

3. Results 3.1. Experiment 1: Levels of c-kit mRNA in goat ovarian follicles Quantification of mRNA demonstrated a significant decrease in the level of c-kit mRNA during the transition from the primary to the secondary follicle stage (P < 0.05), but no significant difference was observed between primordial and primary follicles (P > 0.05; Fig. 1A). When the levels of c-kit mRNA were compared between cumulus–oocyte complexes (COCs) collected from small and large antral follicles, no significant difference was observed (P > 0.05; Fig. 1B). A similar level of c-kit mRNA was also observed in granulosa/theca cells from small antral follicles and large antral follicles (P > 0.05; Fig. 1C). On the other hand, real-time PCR demonstrated that COCs from small and large antral follicles exhibited higher levels of c-kit mRNA than their respective granulosa/theca cells (P < 0.05; Fig. 1D and E).

3.2. Experiment 2: Culture of caprine preantral follicles with KL (basic medium without FSH) 3.2.1. Effects of kit ligand addition on follicular survival and antrum formation Preantral follicles selected for culture had a centrally located oocyte and normal granulosa cells enclosed by an intact basal membrane (Fig. 2A). The effects of different KL concentrations (50 ng/mL and 100 ng/mL) on follicular survival and antral cavity formation were evaluated at 0, 6, 12 and 18 days of culture and are shown in Fig. 3A and B, respectively. In the control and KL 50, follicular survival was maintained up to 6 days of culture when compared to day 0. As the culture progressed from 6 to 12 days, a significant decrease in follicular survival was observed in all treatments (P < 0.05), with the percentage of normal follicles remaining constant from day 12 to day 18 of culture. When compared to the other treatments, KL 50 showed a higher percentage of surviving follicles than the control medium at the end of culture (P < 0.05). Antral follicles were observed as early as day 6 of culture in all treatments, with large antral cavities visualized at day 18 (Fig. 2B). According to Fig. 3B, no significant difference was observed in the rate of antrum formation among days of culture in all treatments from day 6 onwards (P > 0.05). Nevertheless, after comparing all treatments in the same culture period, KL 50 showed a higher percentage of antrum formation than the control and KL 100 at day 6 of culture (P < 0.05). Moreover, the rate of antrum formation was significantly higher in KL treatments (KL 50 and KL 100) than in the control from day 12 onwards (P < 0.05).

41

3.2.2. Follicle and oocyte growth after in vitro culture with kit ligand Values related to follicular growth during in vitro culture of isolated caprine preantral follicles are described in Table 2. A progressive and significant increase in follicular diameter was observed up to day 18 of culture regardless of the treatment used (P < 0.05). However, no significant differences in follicular diameter were observed when the treatments were compared to each other on the same day of culture (P > 0.05). Fig. 3C presents the results of oocyte growth after 18 days of follicle culture for all treatments tested (control, KL 50 and KL 100). It was observed that the KL 100 treatment resulted in a larger oocyte diameter compared to the control (142.48 ± 14.48 lm vs. 130.99 ± 8.78 lm; P < 0.05), but did not differ from KL 50 treatment (137.79 ± 10.94 lm; P > 0.05). 3.2.3. Ability of oocytes grown in vitro to undergo meiotic resumption The percentages of oocytes acceptable for IVM (fully grown oocytes P110 lm) after 18 days of culture were significantly higher in normal follicles cultured in both KL treatments (KL 50:57.14%; KL 100:61.90%) than in the control (35.71%) (P < 0.05; Table 3). Regarding oocyte viability evaluated using the fluorescent markers calcein–AM and ethidium homodimer-1 (Fig. 5A and B), no differences were observed among treatments (P > 0.05), which showed high percentages of viable oocytes stained in green fluorescence. The assessment of chromatin configuration showed that grown oocytes from follicles cultured in the control medium had a higher percentage of intact germinal vesicles (Fig. 5C) than those cultured in KL 50 and KL 100 (P < 0.05). On the other hand, both KL treatments significantly increased the percentage of meiotic resumption (KL 50:62.50%; KL 100:69.23%) in comparison to the control (33.33%; P < 0.05). It is important to note that 8.33% of oocytes grown in the KL 50 treatment reached metaphase II, which indicates the occurrence of nuclear maturation (Fig. 5D). 3.3. Experiment 3: Culture of caprine preantral follicles with KL (basic medium containing FSH) 3.3.1. Effects of kit ligand addition on follicular survival and antrum formation Preantral follicles selected for culture in this experiment had the same morphology of the follicles used in Experiment 2 (Fig. 2A). The results of follicular survival in the different days of culture (days 0, 6, 12 and 18) are depicted in Fig. 4A. Compared to day 0, the follicular survival in control FSH and KL 50 (FSH) was maintained up to 6 days of culture (P > 0.05). After the progression of culture period from 6 to 18 days, a significant decrease in follicular survival was observed in all treatments (P < 0.05). In addition, no difference was observed among treatments regarding the percentage of surviving follicles at various days of culture (P > 0.05). Similar to the observations of Experiment 2, antral follicles were observed as early as day 6 of culture in all treatments, and they formed large antral cavities at day 18 (Fig. 2B). Fig. 4B shows the percentage of antral cavity formation after the culture of preantral follicles with different KL concentrations. A significant increase was observed in the rate of antrum formation up to 6 days of culture in control FSH and KL 100 (FSH) (P < 0.05). From 6 to 12 days, only the KL 50 (FSH) showed a significant increase in the percentage of antrum formation (P < 0.05). Comparing all treatments within the same culture period, the rate of antrum formation was significantly higher in KL 50 (FSH) than in control FSH on day 12 (P < 0.05). 3.3.2. Follicle and oocyte growth after in vitro culture with kit ligand A progressive and significant increase in follicular diameter was observed up to day 18 of culture in control FSH and KL 50 (FSH)

42

I.M.T. Lima et al. / Molecular and Cellular Endocrinology 345 (2011) 38–47

Fig. 1. Levels of c-kit mRNA in goat ovarian follicles (mean ± SD). (A) Primordial, primary, and secondary follicles, (B) COCs from small and large antral follicles, (C) granulosa/ theca cells from small and large antral follicles, (D) COCs and granulosa/theca cells from small antral follicles, and (E) COCs and granulosa/theca cells from large antral follicles. A and B (P < 0.05).

Fig. 2. (A) Caprine preantral follicle at day 0, and (B) antral follicle after 18 days of in vitro culture with 50 ng/mL KL.

(P < 0.05). In KL 100 (FSH), the significant increase in follicular growth only occurred until day 12 (P < 0.05). In addition, no significant differences in follicular diameter were observed among treatments in the various days of culture (P > 0.05; Table 4). Similarly, no difference in oocyte growth was observed among all treatments (control FSH, KL 50 (FSH) and KL 100 (FSH)) after 18 days of follicular culture (P > 0.05; Fig. 4C).

3.3.3. Ability of oocytes grown in vitro to undergo meiotic resumption The percentages of oocytes acceptable for IVM (fully grown oocytes P110 lm) after 18 days of follicle culture were similar among all treatments (P > 0.05), as shown in Table 5. Similarly, oocyte viability evaluated using the fluorescent markers calcein–AM and ethidium homodimer-1 (Fig. 5A and B) indicated no differences among the treatments (P > 0.05), with 100% viable oocytes

43

I.M.T. Lima et al. / Molecular and Cellular Endocrinology 345 (2011) 38–47

Fig. 3. Caprine preantral follicles cultured in vitro for 18 days in the absence (control) or presence of different kit ligand concentrations (50 ng/mL or 100 ng/mL): Experiment 2 – culture medium without FSH. (A) Percentage of follicle survival; (B) percentage of antrum formation; (C) oocyte diameter (mean ± SD). A and B indicates significant differences among treatments in the same culture period. a and b indicates significant differences among days of culture in the same treatment.

stained in green fluorescence for all conditions. The assessment of chromatin configuration showed similar percentages of intact germinal vesicles (Fig. 5C) and meiotic resumption in grown oocytes

Table 2 Follicular diameter (mean ± SD) of caprine preantral follicles after in vitro culture for 18 days in the absence (control) or presence of different kit ligand concentrations (50 ng/mL or 100 ng/mL): Experiment 2 – culture medium without FSH. Days of culture

Follicular diameter (lm) Treatments Control (n = 42)

Day Day Day Day

0 6 12 18

d

228.98 ± 48.09 320.81 ± 92.67c 417.61 ± 77.17b 474.25 ± 78.92a

KL 50 (n = 42)

KL 100 (n = 42) d

241.13 ± 52.29 371.05 ± 96.83c 439.36 ± 87.49b 516.00 ± 89.64a

237.00 ± 42.59d 356.63 ± 105.37c 447.50 ± 98.67b 526.64 ± 80.65a

a,b,c,d: indicate significant differences among days of culture into the same treatment (P < 0.05). There was no significant difference among treatments (P > 0.05).

from follicles cultured under all three treatments (P > 0.05). The percentages of meiotic resumption obtained in control FSH, KL 50 (FSH) and KL 100 (FSH) were 39.14%, 47.06% and 31.82%, respectively.

4. Discussion During the last decade, several gene expression studies have revealed the presence of a functional KL/c-kit system in mammalian ovaries regulating the oogenesis and folliculogenesis processes (Celestino et al., 2009; Hutt et al., 2006a). To better understand the action of the KL/c-kit system in goats, the present study performed for the first time the quantification of c-kit mRNA in caprine ovarian follicles, as well as the in vitro culture of isolated goat preantral follicles with KL in the absence and presence of FSH. Quantification of c-kit mRNA demonstrated a decrease in the levels of c-kit mRNA during the transition from the primary to secondary follicle stage. Our results are consistent with those previously

Table 3 Meiotic stages of caprine oocytes from preantral follicles cultured for 18 days in the absence (control) or presence of different kit ligand concentrations (50 ng/mL or 100 ng/mL): Experiment 2 – culture medium without FSH. Treatments

Number of cultured follicles

Number of oocytes (%) Fully grown* (%)

Control KL 50 KL 100

42 42 42

B

15/42 (35.71) 24/42 (57.14)A 26/42 (61.90)A

Viable oocytes (%) A

14/15 (93.33) 24/24 (100)A 24/26 (92.30)A

GV (%)

Meiotic resumption (%) A

10/15 (66.67) 7/24 (29.17)B 8/26 (30.77)B

B

5/15 (33.33) 15/24 (62.50)A 18/26 (69.23)A

MII (%) 0/15 (0.0) 2/24 (8.33) 0/26 (0.0)

GV: germinal vesicle; meiotic resumption: includes germinal vesicle breakdown (GVBD), metaphase I (MI), anaphase I (AI) and telophase I (TI); MII: metaphase II. A and B indicates significant differences among treatments. * Only oocytes P110 lm were selected for the in vitro maturation procedure.

44

I.M.T. Lima et al. / Molecular and Cellular Endocrinology 345 (2011) 38–47

Fig. 4. Caprine preantral follicles cultured in vitro for 18 days in the absence (control FSH) or presence of different kit ligand concentrations (50 ng/mL or 100 ng/mL): Experiment 3 – culture medium containing FSH. (A) Percentage of follicle survival; (B) percentage of antrum formation; (C) oocyte diameter (mean ± SD). A and B indicates significant differences among treatments in the same culture period. a and b indicates significant differences among days of culture in the same treatment.

Fig. 5. Fluorescence of oocytes from caprine preantral follicles cultured in vitro for 18 days. (A) Viable oocyte labeled by calcein–AM (green fluorescence) after culture with 100 ng/mL KL and (B) non-viable oocyte marked with ethidium homodimer-1 (red fluorescence) after culture in control FSH; fully grown oocyte from preantral follicle cultured with 50 ng/mL KL showing (C) the chromatin in intact germinal vesicle and (D) metaphase II after staining with Hoechst 33342 (400 magnification). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

45

I.M.T. Lima et al. / Molecular and Cellular Endocrinology 345 (2011) 38–47 Table 4 Follicular diameter (mean ± SD) of caprine preantral follicles after in vitro culture for 18 days in the absence (control FSH) or presence of different kit ligand concentrations (50 ng/mL or 100 ng/mL): Experiment 3 – culture medium containing FSH. Days of culture

Day Day Day Day

0 6 12 18

Follicular diameter (lm) Treatments Control FSH (n = 41)

KL 50 (FSH) (n = 40)

KL 100 (FSH) (n = 40)

230.21 ± 36.08d 317.37 ± 89.72c 471.57 ± 149.10b 552.09 ± 134.2a

224.49 ± 37.55d 306.66 ± 95.22c 453.55 ± 187.77b 588.01 ± 209.45a

226.02 ± 34.32c 322.93 ± 89.98b 459.18 ± 167.97a 532.47 ± 224.85a

a,b,c,d: indicate significant differences among days of the culture into the same treatment (P < 0.05). There was no significant difference among treatments (P > 0.05).

reported in caprine ovaries by Silva et al. (2006), who verified in oocytes of primordial and primary follicles an immunoreactivity for c-kit stronger than in secondary and antral stages. Emphasizing these results, researchers observed in another study utilizing immature mouse ovaries a gradual decrease of c-kit expression in oocytes as follicles developed into the secondary stage (Kang et al., 2003). In contrast, previous investigations demonstrated a high and uniform expression of c-kit protein and mRNA in primordial and later preantral follicles, which decreased only from the antral stage (mouse: Horie et al., 1991; sheep: Tisdall et al., 1999). These contradictory results suggest the existence of differences among the species or ages of the animal models. In addition, we hypothesize from both previous (Celestino et al., 2010) and present results the greatest need for KL action in goats occurs in early preantral follicles, especially during follicular activation. This hypothesis is supported by the reduction in the expression of c-kit mRNA at the secondary follicle stage that we observed in this study, which is possibly associated with high expression of other growth factors and receptors essential for this follicular phase. In this study on goat follicles, we also observed a higher level of c-kit mRNA in COCs compared to granulosa/theca cells, both from small and large antral follicles. Indeed, oocytes at all stages of development have been reported to express c-kit mRNA and protein (Doneda et al., 2002; Manova et al., 1990), which does not occur in somatic cells (mural granulosa and theca). Similarly, Kang et al. (2003) observed that the c-kit protein was expressed strongly in mouse oocytes of preantral follicles and expressed weakly in granulosa and theca cells. In our work, the identification of c-kit mRNA in both COCs (high expression) and somatic cells (low expression) of antral follicles, as well as in all categories of preantral follicles, demonstrates an important role of KL synthesized by granulosa cells in goat follicular development. This information is consistent with many previous findings demonstrating the KL action in follicles from other species (for review see Celestino et al., 2009). In the present study, follicular survival was significantly higher in the presence of 50 ng/mL KL (without FSH) compared to the control after 18 days of culture. Similar to our results, previous works showed a positive effect of 50 ng/mL KL on the viability of early

caprine preantral follicles enclosed in ovarian tissue after in vitro culture in a simple medium (Celestino et al., 2010) and in a dynamic medium (Lima et al., in press). Moreover, KL has been shown to promote primordial follicle survival in cultured mouse ovaries, as well as oocyte viability by inhibiting apoptosis (Jin et al., 2005; Reynaud et al., 2000). According to Jin et al. (2005), KL inhibits apoptosis in mouse oocytes by increasing the mRNA levels of antiapoptotic proteins, Bcl-2 and Bcl-xL, and reducing the mRNA levels of the proapoptotic factor Bax. Regarding the results of antrum formation, we observed a significantly higher development rate in both KL concentrations (50 and 100 ng/mL) than in the control from day 12 onwards. Our results demonstrating the role of the KL/c-kit system in antrum formation confirms an earlier observation reported by Yoshida et al. (1997), who injected in vivo an antibody blocking the KL/c-kit interaction and observed the inhibition of both antrum formation and follicular fluid accumulation. In addition, another study verified that the blockade of the KL/c-kit system severely inhibited the antrum formation after 12 days of in vitro culture (Reynaud et al., 2000). In relation to oocyte growth, the present study found a higher oocyte diameter after utilizing KL at 100 ng/mL than when compared to the control. Similar results were observed by Klinger and De Felici (2002) working with mouse oocytes, who reported a two-fold increase in oocyte diameter compared to controls after 4 days of culture in the presence of 100 ng/mL KL. Other studies have also demonstrated the role of KL in the promotion of oocyte growth (goat: Celestino et al., 2010; Lima et al., in press; rabbit: Hutt et al., 2006b; mouse: Packer et al., 1994). Although the mechanism by which KL promotes oocyte growth is not fully understood, it has been suggested that the activation of the phos phoinositide-3 kinase (PI3K) pathway in the oocytes is involved in this process (Reddy et al., 2005; John et al., 2008). In the current work, both KL concentrations (50 and 100 ng/mL) increased the number of oocytes destined for IVM. These concentrations also increased the percentage of meiotic resumption (KL 50:62.50%; KL 100:69.23%) compared to the control group (33.33%), with the KL 50 treatment reaching 8.33% of oocytes in metaphase II. For goats, these results are interesting, since few studies in this species have achieved meiotically competent oocytes from the in vitro culture of preantral follicles (Magalhães et al., 2011a,b; Silva et al., 2010), especially with the occurrence of nuclear maturation. Meiotic resumption in goat oocytes grown in vitro with KL probably occurred due to the increased levels of c-kit mRNA in COCs from antral follicles, as verified in our study of expression (Experiment 1). In line with our results, Ye et al. (2009) recently verified that the treatment of mouse COCs with KL enhanced the first polar body extrusion with an increase in cyclin B1 synthesis, which is important for the progression of meiotic maturation after GVBD. In addition, studies in rats reported that the interaction between KL and c-kit may play a role in controlling the nuclear maturation of oocytes (Ismail et al., 1996, 1997). Based on the study from De Smedt et al. (1994), the low rate of oocytes in metaphase II found in our work may have occurred due to the short

Table 5 Meiotic stages of caprine oocytes from preantral follicles cultured for 18 days in the absence (control FSH) or presence of different kit ligand concentrations (50 ng/mL or 100 ng/ mL): Experiment 3 – culture medium containing FSH. Treatments

Control FSH KL 50 (FSH) KL 100 (FSH)

Number of cultured follicles

41 40 40

Number of oocytes (%) Fully grown* (%)

Viable oocytes (%)

GV (%)

Meiotic resumption (%)

MII (%)

23/41 (56.10) 17/40 (42.50) 22/40 (55.00)

23/23 (100) 17/17 (100) 22/22 (100)

14/23 (60.86) 9/17 (52.94) 15/22 (68.18)

9/23 (39.14) 8/17 (47.06) 7/22 (31.82)

0/23 (0.0) 0/17 (0.0) 0/22 (0.0)

GV: germinal vesicle; meiotic resumption: includes germinal vesicle breakdown (GVBD), metaphase I (MI), anaphase I (AI) and telophase I (TI); MII: metaphase II. There was no significant difference among treatments (P > 0.05). * Only oocytes P110 lm were selected for the in vitro maturation procedure.

46

I.M.T. Lima et al. / Molecular and Cellular Endocrinology 345 (2011) 38–47

culture period used. We believe that, even after 18 days of culture, follicles were still too small to produce fully competent oocytes capable of reaching a high rate of metaphase II. Thus, further investigations using a longer culture time will be necessary. Unlike the culture medium without FSH, the addition of KL to the in vitro culture of caprine preantral follicles in the presence of this gonadotropin (Experiment 3) did not demonstrate any effect on all parameters evaluated (follicular survival and growth, antrum formation, oocyte survival and growth, and meiotic resumption). In this study, FSH was added to the basic culture medium sequentially, i.e., in increasing concentrations, because as the follicles develop, the gonadotropin levels increase to meet the requirements of different follicular stages (Saraiva et al., in press). We formulated two different hypotheses to explain our results after using this basic medium. The first hypothesis is that the high levels of FSH used in the culture medium masked the possible effects of KL added in vitro throughout the 18 days of culture. Indeed, some studies have suggested that lower concentrations of FSH are more important for the appropriate regulation of paracrine factors, such as KL, that trigger cell development (Celestino et al., 2009; Thomas et al., 2005). The second hypothesis is based on the previously demonstrated role of FSH in the regulation of KL expression in vitro (Thomas et al., 2005). Considering this function of FSH, it is possible that its presence in the basic medium has been able to stimulate the synthesis of KL by follicular granulosa cells, allowing KL to reach satisfactory levels in vitro. Consequently, additional effects of the two KL concentrations were not observed in the culture containing FSH. Although FSH and KL showed no additive effect on in vitro follicle growth, i.e., a significant increase in follicle diameter, the results highlight the growth promoting role of FSH on preantral follicles as reported in previous studies (Andrade et al., 2005; Magalhães et al., 2009; Roy and Greenwald, 1988, 1989). In conclusion, this study demonstrated that c-kit mRNA is present in all investigated follicular categories and cellular types. Moreover, KL at 50 and/or 100 ng/mL promotes the survival and the antral cavity formation of isolated caprine preantral follicles after in vitro culture, as well as the growth and meiotic resumption of their oocytes in the absence of FSH. Results on the levels of c-kit mRNA and the culture system established in this work may contribute to future research investigating the mechanisms and substances involved in the regulation of follicular development. Acknowledgments This work was supported by the National Council for Scientific and Technological Development (CNPq, Brazil, Grant number: 554812/2006-1- RENORBIO), the Coordination for the Improvement of Higher Education Personnel (CAPES) and the Brazilian Innovation Agency (FINEP). Isadora Machado Teixeira Lima is a recipient of a grant from CAPES. References Arunakumari, G., Shanmugasundaram, N., Rao, V.H., 2010. Development of morulae from the oocytes of cultured sheep preantral follicles. Theriogenology 74, 884– 894. Andrade, E.R., Seneda, M.M., Alfieri, A.A., Oliveira, J.A., Federico Rodrigues Loureiro Bracarense, A.P., Figueiredo, J.R., Toniolli, R., 2005. Interactions of indole acetic acid with EGF and FSH in the culture of ovine preantral follicles. Theriogenology 64, 1104–1113. Carlsson, I.B., Laitinen, M.P.E., Scott, J.E., Louhio, H., Velentzis, L., Tuuri, T., Aaltonen, J., Ritvos, O., Winston, R.M.L., Hovatta, O., 2006. Kit ligand and c-kit are expressed during early human ovarian follicular development and their interaction is required for the survival of follicles in long-term culture. Reproduction 131, 641–649. Celestino, J.J.H., Bruno, J.B., Lima-Verde, I.B., Matos, M.H.T., Saraiva, M.V.A., Chaves, R.N., Martins, F.S., Almeida, A.P., Cunha, R.M.S., Lima, L.F., Name, K.O., Campello, C.C., Silva, J.R.V., Báo, S.N., Figueiredo, J.R., 2010. Steady-state level of kit ligand mRNA in goat ovaries and the role of kit ligand in preantral follicle survival and growth in vitro. Mol. Reprod. Dev. 77, 231–240.

Celestino, J.J.H., Matos, M.H.T., Saraiva, M.V.A., Figueiredo, J.R., 2009. Regulation of ovarian folliculogenesis by kit ligand and the c-kit system in mammals. Anim. Reprod. 6, 431–439. Chaves, R.N., Martins, F.S., Saraiva, M.V., Celestino, J.J., Lopes, C.A., Correia, J.C., Verde, I.B., Matos, M.H., Báo, S.N., Name, K.P., Campello, C.C., Silva, J.R.V., Figueiredo, J.R., 2008. Chilling ovarian fragments during transportation improves viability and growth of goat preantral follicles cultured in vitro. Reprod. Fertil. Dev. 20, 640–647. Clark, D.E., Tisdall, D.J., Fidler, A.E., McNatty, K.P., 1996. Localization of mRNA encoding c-kit during the initiation of folliculogenesis in ovine fetal ovaries. J. Reprod. Fertil. 106, 329–335. Crozet, N., Dahirel, M., Gall, L., 2000. Meiotic competence of in vitro grown goat oocytes. J. Reprod. Fertil. 118, 367–373. De Smedt, V., Crozet, N., Gall, L., 1994. Morphological and functional changes accompanying the acquisition of meiotic competence in ovarian goat oocyte. J. Exp. Zoolog. 269, 128–139. Doneda, L., Klinger, F.G., Larizza, L., De Felici, M., 2002. KL/KIT coexpression in mouse fetal oocytes. Int. J. Dev. Biol. 46, 1015–1021. Eppig, J.J., Schroeder, A.C., 1989. Capacity of mouse oocytes from preantral follicles to undergo embryogenesis and development to live young after growth, maturation and fertilization in vitro. Biol. Reprod. 41, 268–276. Gupta, P.S.P., Ramesh, H.S., Manjunatha, B.M., Nand, S., Ravindra, J.P., 2008. Production of buffalo embryos using oocytes from in vitro grown preantral follicles. Zygote 16, 57–63. Gutierrez, C.G., Ralph, J.H., Telfer, E.E., Wilmut, I., Webb, R., 2000. Growth and antrum formation of bovine preantral follicles in long-term culture in vitro. Biol. Reprod. 62, 1322–1328. Horie, K., Takakura, K., Taii, S., Narimoto, K., Noda, Y., Nishikawa, S., Nakayama, H., Fujita, J., Mori, T., 1991. The expression of c-kit protein during oogenesis and early development. Biol. Reprod. 45, 547–552. Huang, E.J., Nocka, K.H., Buck, J., Besmer, P., 1992. Differential expression and processing of two cell associated forms of the kit-ligand: KL-1 and KL-2. Mol. Biol. Cell. 3, 349–362. Hutt, K., McLaughlin, E.A., Holland, M.K., 2006a. KL and KIT have diverse roles during mammalian oogenesis. Mol. Hum. Reprod. 12, 61–69. Hutt, K.J., Mclaughlin, E.A., Holland, M.K., 2006b. KIT/KIT ligand in mammalian oogenesis and folliculogenesis: roles in rabbit and murine ovarian follicle activation and oocyte growth. Biol. Reprod. 75, 421–433. Ismail, R.S., Dube, M., Vanderhyden, B.C., 1997. Hormonally regulated expression and alternative splicing of kit ligand may regulate kit induced inhibition of meiosis in rat oocytes. Dev. Biol. 184, 333–342. Ismail, R.S., Okawara, Y., Fryer, J.N., Vanderhyden, B.C., 1996. Hormonal regulation of the ligand for c-kit in the rat ovary and its effects on spontaneous oocyte meiotic maturation. Mol. Reprod. Dev. 43, 458–469. Jin, X., Han, C.S., Yu, F.Q., Wei, P., Hu, Z.Y., Liu, Y.X., 2005. Anti-apoptotic action of stem cell factor on oocytes in primordial follicles and its signal transduction. Mol. Reprod. Dev. 70, 82–90. John, G.B., Gallardo, T.D., Shirley, L.J., Castrillon, D.H., 2008. Foxo3 is a PI3Kdependent molecular switch controlling the initiation of oocyte growth. Dev. Biol. 321, 197–204. Kang, J.S., Lee, C.J., Lee, J.M., Rha, J.Y., Song, K.W., Park, M.H., 2003. Follicular expression of c-kit/SCF and inhibin-a in mouse ovary during development. J. Histochem. Cytochem. 51, 1447–1458. Klinger, F.G., De Felici, M., 2002. In vitro development of growing oocytes from fetal mouse oocytes: stage-specific regulation by stem cell factor and granulose cells. Dev. Biol. 244, 85–95. Lima, I.M.T., Celestino, J.J., Faustino, L.R., Magalhães-Padilha, D.M., Rossetto, R., Brito, I.R., Donato, M.A., Lopes, C.A., Campello, C.C., Peixoto, C.A., Figueiredo, J.R., Rodrigues, A.P.R. Dynamic medium containing kit ligand and folliclestimulating hormone promotes follicular survival, activation, and growth during long-term in vitro culture of caprine preantral follicles. Cells Tissues Organs. doi: 10.1159/000325150. Lucci, C.M., Amorim, C.A., Bao, S.N., Figueiredo, J.R., Rodrigues, A.P.R., Silva, J.R.V., Gonçalves, P.B.D., 1999. Effect of the interval of serial sections of ovarian in the tissue chopper on the number of isolated caprine preantral follicles. Anim. Reprod. Sci. 56, 39–49. Magalhães, D.M., Araújo, V.R., Lima-Verde, I.B., Matos, M.H.T., Silva, R.C., Lucci, C.M., Báo, S.N., Campello, C.C., Figueiredo, J.R., 2009. Different follicle-stimulating hormone (FSH) sources influence caprine preantral follicle viability and development in vitro. Braz. J. Vet. Res. Anim. Sci. 46, 378–386. Magalhães, D.M., Duarte, A.B.G., Araújo, V.R., Brito, I.R., Soares, T.G., Lima, I.M.T., Lopes, C.A.P., Campello, C.C., Rodrigues, A.P.R., Figueiredo, J.R., 2011a. In vitro production of a caprine embryo from a preantral follicle cultured in media supplemented with growth hormone. Theriogenology 75, 182–188. Magalhães, D.M., Fernandes, D.D., Mororó, M.B.S., Silva, C.M.G., Rodrigues, G.Q., Bruno, J.B., Matos, M.H.T., Campello, C.C., Figueiredo, J.R., 2011b. Effect of the medium replacement interval on the viability, growth and in vitro maturation of isolated caprine and ovine pre-antral follicles. Reprod. Domest. Anim. 46, 134–140. Manova, K., Nocka, K., Besmer, P., Bachvarova, R.F., 1990. Gonadal expression of c-kit encoded at the W locus of the mouse. Development 110, 1057–1069. Motro, B., Bernstein, A., 1993. Dynamic changes in ovarian c-kit and syeel expression during the estrous reproductive cycle. Dev. Dyn. 197, 69–79. Muruvi, W., Picton, H.M., Rodway, R.G., Joyce, I.M., 2005. In vitro growth of oocytes from primordial follicles isolated from frozen–thawed lamb ovaries. Theriogenology 64, 1357–1370.

I.M.T. Lima et al. / Molecular and Cellular Endocrinology 345 (2011) 38–47 O’Brien, M.J., Pendola, J.K., Eppig, J.J., 2003. A revised protocol for in vitro development of mouse oocytes from primordial follicles dramatically improves their developmental competence. Biol. Reprod. 68, 1682–1686. Otsuka, F., Shimasaki, S., 2002. A negative feedback system between oocyte bone morphogenetic protein 15 and granulosa cell kit ligand: Its role in regulating granulosa cell mitosis. Proc. Natl. Acad. Sci. USA 99, 8060–8065. Packer, A.I., Hsu, Y.C., Besmer, P., Bachvarova, R.F., 1994. The ligand of the c-kit receptor promotes oocyte growth. Dev. Biol. 161, 194–205. Reddy, P., Shen, L., Ren, C., Boman, K., Lundin, E., Ottander, U., Lindgren, P., Liu, Y.-x., Sun, Q.-y., Liu, K., 2005. Activation of Akt (PKB) and suppression of FKHRL1 in mouse and rat oocytes by stem cell factor during follicular activation and development. Dev. Biol. 281, 160–170. Reynaud, K., Cortvrindt, R., Smitz, J., Driancourt, M.A., 2000. Effects of kit ligand and anti-kit antibody on growth of cultured mouse preantral follicles. Mol. Reprod. Dev. 56, 483–494. Roy, S.K., Greenwald, G.S., 1989. Hormonal requirements for the growth and differentiation of hamster preantral follicles in long-term culture. J. Reprod. Fertil. 87, 103–114. Roy, S.K., Greenwald, G.S., 1988. In vitro effects of follicle-stimulating hormone, luteinizing hormone and prolactin on follicular deoxyribonucleic acid synthesis in the hamster. Endocrinology 122, 952–958. Roy, S.K., Treacy, B.J., 1993. Isolation and long term culture of human preantral follicles. Fertil. Steril. 59, 783–790. Saraiva, M.V.A., Celestino, J.J.H., Araújo, V.R., Chaves, R.N., Almeida, A.P., Lima-Verde, I.B., Duarte, A.B.G., Silva, G.M., Martins, F.S., Bruno, J.B., Matos, M.H.T., Campello, C.C., Silva, J.R.V., Figueiredo, J.R. Expression of follicle-stimulating hormone receptor (FSHR) in goat ovarian follicles and the impact of sequential culture medium on in vitro development of caprine preantral follicles. Zygote, Available on CJO doi: 10.1017/S0967199410000511. SAS Ver. 9.0. SAS Institute Inc., Cary, NC, USA, 2002. Serafim, M.K.B., Araújo, V.R., Silva, G.M., Duarte, A.B.G., Almeida, A.P., Chaves, R.N., Campello, C.C., Lopes, C.A.P., Figueiredo, J.R., Silva, L.D.M., 2010. Canine preantral follicles cultured with various concentrations of follicle-stimulating hormone (FSH). Theriogenology 74, 749–755.

47

Silva, C.M.G., Matos, M.H.T., Rodrigues, G.Q., Faustino, L.R., Pinto, L.C., Chaves, R.N., Araújo, V.R., Campello, C.C., Figueiredo, J.R., 2010. In vitro survival and development of goat preantral follicles in two different oxygen tensions. Anim. Reprod. Sci. 117, 83–89. Silva, J.R.V., van den Hurk, R., Van Tol, H.T.A., Roelen, B.A.J., Figueiredo, J.R., 2006. The kit ligand/c-Kit receptor system in goat ovaries: gene expression and protein localization. Zygote 14, 317–328. Telfer, E.E., McLaughlin, M., Ding, C., Thong, K.J., 2008. A two step serum free culture system supports development of human oocytes from primordial follicles in the presence of activin. Hum. Reprod. 23, 1151–1158. Thomas, F.H., Ethier, J.F., Shimasaki, S., Vanderhyden, B.C., 2005. Follicle stimulating hormone regulates oocyte growth by modulation of expression of oocyte and granulosa cell factors. Endocrinology 146, 941–949. Thomas, F.H., Ismail, R.S., Jiang, J., Vanderhyden, B.C., 2008. Kit ligand 2 promotes murine oocyte growth in vitro. Biol. Reprod. 78, 167–175. Tisdall, D.J., Fidler, A.E., Smith, P., Quirke, L.D., Stent, V.C., Heath, D.A., Mcnatty, K.P., 1999. Stem cell factor and c-kit gene expression and protein localization in the sheep ovary during fetal development. J. Reprod. Fertil. 116, 277–291. van Tol, H.T., Bevers, M.M., 1998. Theca cells and theca-cell conditioned medium inhibit the progression of FSH-induced meiosis of bovine oocytes surrounded by cumulus cells connected to membrane granulosa. Mol. Reprod. Dev. 51, 315– 321. Vandesompele, J., De Paepe, A., Speleman, F., 2002. Elimination of primer-dimer artifacts and genomic coamplification using a two-step SYBR Green I real-time RT-PCR. Anal. Biochem. 303, 95–98. Wu, J., Emery, B.R., Carrel, D.T., 2001. In vitro growth, maturation, fertilization and embryonic development of oocytes from porcine preantral follicles. Biol. Reprod. 64, 375–381. Ye, Y., Kawamura, K., Sasaki, M., Kawamura, N., Groenen, P., Gelpke, M.D.S., Rauch, R., Hsueh, A.J.W., Tanaka, T., 2009. Kit ligand promotes first polar body extrusion of mouse preovulatory oocytes. Reprod. Biol. Endocrinol. 7, 26–35. Yoshida, H., Takakura, N., Nataoka, H., Kunisada, T., Okamura, H., Nishikawa, S.I., 1997. Stepwise requirement of c-kit tyrosine kinase in mouse ovarian follicle development. Dev. Biol. 184, 122–137.