- Email: [email protected]
EGFP mouse
Molecular and Cellular Endocrinology 253 (2006) 14–21
Presence of endocrine and exocrine markers in EGFP-positive cells from the developing pancreas of a nestin/EGFP mouse Andreia S. Bernardo a , John Barrow a , Colin W. Hay a , Kenneth McCreath b , Alexander J. Kind b , Angelika E. Schnieke b , Alan Colman b , Alan W. Hart b , Kevin Docherty a,∗ a
School of Medical Sciences, University of Aberdeen, Institute of Medical Sciences, Foresterhill, Aberdeen AB25 2ZD, UK b PPL Therapeutics Ltd., Roslin, Edinburgh, UK Received 20 January 2006; received in revised form 6 March 2006; accepted 10 March 2006
Abstract In order to purify and characterize nestin-positive cells in the developing pancreas a transgenic mouse was generated, in which the enhanced green fluorescent protein (EGFP) was driven by the nestin second intronic enhancer and upstream promoter. In keeping with previous studies on the distribution of nestin, EGFP was expressed in the developing embryo in neurones in the brain, eye, spinal cord, tail bud and glial cells in the small intestine. In the pancreas there was no detectable EGFP at embryonic day 11.5 (E11.5). EGFP expression appeared at E12.5 and increased in intensity through E14.5, E18.5 and post-natal day 1. Flow cytometry was used to quantify and purify the EGFP positive population in the E15.5 pancreas. The purified (96%) EGFP-expressing cells, which represent 20% of the total cell population, were shown by RT/PCR to express exocrine cell markers (amylase and P48) and endocrine cell markers (insulin 1, insulin 2, and Ngn3). They also expressed, at a lower level, PDX-1, Isl-1, and the islet hormones pancreatic polypeptide, glucagon and somatostatin as well as GLUT2, the stem cell marker ABCG2 and PECAM, a marker of endothelial cells. It was further shown by immunocytochemistry of the E15.5 pancreas that EGFP colocalised in separate subpopulations of cells that expressed nestin, insulin and amylase. These results support the conclusion that nestin expressing cells can give rise to both endocrine and exocrine cells. The ability to purify these putative progenitor cells may provide further insights into their properties and function. © 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Islets of Langerhans; Endocrine pancreas; Insulin gene; Diabetes mellitus
1. Introduction Nestin is an intermediate filament protein that is expressed in neuronal stem cells (Lendahl et al., 1990). It is also expressed in stem cells involved in the formation of skeletal and cardiac muscle (Kachinsky et al., 1995; Sejersen and Lendahl, 1993), testis (Frojdman et al., 1997), teeth (About et al., 2000) and the retina (Mayer et al., 2003; Walcott and Provis, 2003). In the central nervous system (CNS) nestin expression is down regulated upon differentiation but reappears in response to injury or after the cells have been subject to different types of cellular stress (Frisen et al., 1995; Holmin et al., 1997; Shibuya et al., 2002). Nestin expression has also been observed in a number of tumours (Florenes et al., 1994; Kobayashi et al., 1998;
∗
Corresponding author. Tel.: +44 1224 555769; fax: +44 1224 555844. E-mail address: [email protected] (K. Docherty).
0303-7207/$ – see front matter © 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2006.03.003
Yamaguchi et al., 2000a). Nestin is also expressed in the developing pancreas (Hunziker and Stein, 2000) and in adult islets of Langerhans (Abraham et al., 2004; Huang and Tang, 2003; Lechner et al., 2002; Zulewski et al., 2001). In addition, it was shown that mouse embryonic stem cells that were induced to express nestin could be further induced to express the four islet cell types (Lumelsky et al., 2001). For these reasons it was thought that nestin might act as a marker for a pancreatic or islet progenitor cell (Yashpal et al., 2004), although recent findings question the existence of such an islet stem cell in the adult pancreas (Dor et al., 2004). To understand further the role of nestin expressing cells in the developing pancreas, we generated a transgenic mouse strain in which expression of EGFP is under the control of the rat nestin second intron and upstream promoter sequences (Zimmerman et al., 1994). We purified the EGFP-positive cells from the E15.5 pancreas and show that this cell population expresses markers of both the endocrine and exocrine cell lineage.
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
2. Experimental
15
was then sorted, homogenised in 1 ml of TRIZol (Invitrogen) and stored at −70 ◦ C.
2.1. Generation and analysis of transgenic mice 2.6. RNA isolation p401ZII (∼13.8 kb), a plasmid containing the rat nestin second intronic region as well as its promoter was kindly provided by Dr. A. McMahon (University of Harvard, Cambridge, USA). Sequences corresponding to the second intron and the upstream promoter were excised as HindIII/XbaI (1.8 kb) and SalI/XbaI (5.8 kb) fragments, respectively. The EGFP fragment of the pEGFP-1 plasmid (Clontech, Germany) was excised using HindIII and SalI restriction enzymes. These three fragments were then ligated to form the plasmid pNesIntron2EGFPNesP. Transgenic mice were generated by pronuclear injection of the pNesIntron2EGFPNesP plasmid into fertilized mouse eggs. Independent transgenic lines showing indistinguishable EGFP expression patterns were established on the C57BL6 genetic background. From these, a founder line was chosen on the basis of EGFP expression levels. The data presented were obtained from experiments using heterozygous mice resulting from the mating of C57BL6 females with nestin-EGFP transgenic males.
2.2. Genotyping Tail tips/ear clips from 4-week old mice were removed from each of the offspring of the founder stock. Tail tips were subjected to Proteinase K (Sigma, Poole, Dorset) digestion overnight at 55 ◦ C. Resultant digest products were centrifuged in a microcentrifuge and the supernatant used to prepare DNA using ethanol precipitation. The subsequent DNA preparations were then used in PCR reactions using the primer sets specified in Table 1. The PCR products were separated in 1.5% agarose gel and stained with ethidium bromide.
2.3. Mouse tissue Embryos were obtained from pregnant females at different days of development. The appearance of a vaginal plug was defined as embryonic day 0.5 (E0.5). At least three litters were analyzed for each time point.
2.4. Preparation of tissue for FACS Pancreatic tissue was dissected from transgenic or wild type embryos at E15.5. The tissue was placed in Hanks balanced salt solution (HBSS) (Invitrogen, Paisley, UK), finely chopped into smaller pieces and digested in a solution containing 0.3 mg/ml crude collagenase (Sigma) for 30 min at 37 ◦ C and then in a 0.05% trypsin–EDTA solution (GIBCO) for 5 min at 37 ◦ C. Heat inactivated fetal calf serum (FCS) (10%) was added to inactivate the trypsin and the cells were then washed in HBSS. The dissociated cells were filtered through a 70 m sterile strainer.
2.5. FACS analysis and sorting The EGFP expression of the pancreatic cell suspensions was analyzed using the FACS flow cytometer (Becton Dickinson FACS DiVa) equipped with three lasers. The emitted fluorescence of EGFP was measured as a green signal in a log scale at 525 nm—FL1 (FITC band pass filter) and red fluorescence was measured as an orange signal in a log scale at 574 nm—FL2 (PE band pass filter). Analyses were performed using Zeiss software. Cells were analyzed for forward scatter, side scatter, and EGFP fluorescence. Wild type mice cell suspensions were used as negative controls. The EGFP positive population of cells
The EGFP-positive FACS sorted cells homogenised in TRIZol were thawed at room temperature for 10 min. RNA was subsequently extracted in chloroform and precipitated with isopropanol.
2.7. RT-PCR Total RNA was treated with amplification grade DNase I (Invitrogen) using standard protocols. First strand synthesis was done by reverse transcription with Superscript II reverse transcriptase (220 units/l) (Invitrogen) using the manufacturer’s protocol. For the PCR reactions, to each pre-chilled tube was added 2.5 l forward (FWD) primer (2 M), 2.5 l reverse (REV) primer (2 M), 2.5 l 10× Mg free Taq Polymerase buffer, 3.0 l MgCl2 (to give 3 mM), 0.5 l 10 mM dNTPs, 0.25 l Taq Polymerase (5 units/l) (Promega) and 12.75 l of dd-water. cDNA (1 l) was then added and the tubes placed in the thermal cycler (Thermo Hybaid PCR). Primer sets were designed on the basis of NCBI gene bank and synthesized by MWG. Primer sequences and annealing temperatures were as specified in Table 2. After PCR amplification the PCR products were separated in agarose gel (1.2 or 1.5%) and stained with ethidium bromide. Controls without reverse transcriptase (-RT controls) were done for all PCR reactions.
2.8. Fixation and tissue preparation Heads from E12.5, pancreas from E12.5 and E15.5 as well as gut from E18.5, were harvested in ice-cold PBS. Fluorescence images were captured using an Axioplan 2 Zeiss inverted microscope. The tissues were fixed in 4% (v/v) paraformaldehyde (PFA) for 1 h at room temperature. They were then transferred to a solution containing equal volumes of phosphate buffered saline (PBS) and OCT medium (Vector International, Port Talbot, UK) and incubated at 4 ◦ C overnight. The tissue was embedded in OCT medium followed by freezing using iso-pentane in liquid nitrogen and stored at −70 ◦ C. Cryosections of 5–7 m thickness were cut on a cryostat (Leica CM1900), mounted on poly-lysinecoated slides (BHD Laboratory Supplies), and stored at −70 ◦ C.
2.9. Immunohistochemistry Cryosections were thawed at room temperature for 10 min and immunohistochemistry was performed according to standard immunohistochemistry techniques. Primary antibodies were incubated with tissue sections at 4 ◦ C overnight in a humidified chamber at the following concentrations: rabbit antiGFP (Molecular Probes, Cambridge, UK) at 1:200; rabbit anti-nestin (Dr. U. Lendahl, Karolinska Institute, Sweden) at 1:100; rabbit anti-amylase (Sigma, Poole, UK) at 1:500 and mouse anti-insulin (Sigma) at 1:2000. Fluorescent labeled secondary antibodies were used to detect primary antibodies at the following concentrations: alexa fluor 350 goat anti-rabbit (Molecular Probes) at 1:300; texas red goat anti-rabbit (Molecular Probes) at 1:100 or 1:1000 and rhodamine rabbit anti-mouse (Jackson Immunoresearch, Soham, UK) at 1:7000. Fluorescence images were obtained using either a Zeiss LSM-510 laser confocal microscope or a Zeiss Axioskop 2 conventional fluorescence microscope, and processed using LSM Image browser from Zeiss or Paint Shop Pro, respectively. Images were edited using Adobe Photoshop 6.0.
Table 1 Genotyping primers Gene
Forward primer
Reverse primer
Product size (bp)
Annealing temperature
Accession number
MHPRT MGAPDH RnestinI2 EGFP
gagttccggaactgcctttggtg agtgccagcctcgtcccgtagacaaaatg cttggctttgtactttctgtga accctcgtgaccaccctgacctac
ctgtgccaccgggcgcatgg aagtgggccccggccttctccat tttaagcatcaccgtctcttc gaccatgtgatcgcgcttctcgt
332 355 361 483
66 62 62 66
M12561 M32599 AF004334 U55761
16
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
Table 2 RT-PCR primers Gene
Forward primer
Reverse primer
Product size (bp)
Annealing temperature
Accession number
Insulin 1 Insulin 2 Glucagon Somatostatin PP P48 Amylase Pdx-1 Pax4 Pax6 Isl-1 IAPP Ngn3 Nkx2.2 Nkx6.1 Glut2 GAPDH HPRT PECAM Cytokeratin 19 ABCG2 Nestin
accatcagcaagcaggtcat cagcaagcaggaagcctatc ccagatcattcccagcttca ccaccgggaaacaggaactg tagctcagcacacaggatgg atcgaggcacccgttcac gcttatcaggtcagaaattgtcg agtgggcaggaggtgcttac ccttaaggtatctaatggctgtgt gaccacttcaacaggactcatt atcaggttgtacgggatcaaat acctgtcagaagtggtagca cagctcagaaatccctctgg cctccaatactccctgcac agtcaggtcaaggtctggttc ttcggctatgacatcggtgtg aagggctcatgaccacagtc gccagactttgttggatttga ctgaggaaaactccttcaccatc cagaaccaagtttgagacagaa gtggttcaagatgacgttgtga aggcccctttagtagggtctc
cacttgtgggtcctccactt ttgtgccacttgtgggtcct tggtgctcatctcgtcagag gggccaggagttaaggaaga gcctggtcagtgtgttgatg cgatgtgagctgtctcagga cattccacttgcggataactg accctcagactgctgtcctc gtgcaagctctggtcttcct tccaacagcctgtgttgttc aagggactgagagggtctcc catcaagcacaagcacattg gaggcgccatcctagttctc gggcacgtttcatcttgtag cgccacaatttctaggttaaaa agctgaggccagcaatctgac cttactccttggaggccatgt agataagcgacaatctaccagagg accttcacctcgtactcaatcgt gtgacttcggtcttgcttatct aagatggaataccgaggctgat caggtgagccacagaagaaag
218 235 384 303 203 226 352 473 277 407 236 334 246 314 400 556 495 361 301 396 380 323
63 63 60 63 60 59 63 64 59 60 59 67 59 59 59 67 68 63 60 61 63 60
NM 008386 NM 008387 AK007911 NM 009215 NM 008918 NM 018809 NM 009669 NM 008814 XM 133023 NM 013627 NM 021459 BC027527 NM 009719 NM 010919 NM 144955 BC034675 NM 008084 XM 356404 BC008519 M28698 BC063730 NM 016701
3. Results In this study, we generated transgenic mice in which the EGFP gene was placed under the control of the second intronic region followed by the 5.8 kb upstream promoter sequence of the rat nestin gene (Fig. 1). Thirty-nine lines showed indistinguishable patterns of EGFP expression and from these lines the founder line 01/29:39 was chosen as the overall expression levels of EGFP were higher. Male nestin-EGFP mice were bred with wild type females (C57BL6) and the resulting F1 generations were genotyped. The presence of a 483 bp PCR product confirmed that the EGFP transgene was present in one out of three of the offspring (data not shown). Preliminary experiments were performed to determine whether the EGFP expression pattern was similar to the known expression pattern for nestin. In the E11.5 embryo EGFP expression was detectable throughout the CNS including the brain, spinal cord and tail bud (Fig. 2), a pattern of distribution that had previously been reported (Kawaguchi et al., 2001). At this time point we were also able to confirm EGFP expression in the
Fig. 1. Structure of the pNesIntron2-NesP-EGFP vector. Schematic depiction of the construct pNesIntron2-NesP-EGFP, showing the EGFP gene flanked by the rat nestin upstream promoter region placed downstream of the nestin second intronic region.
eye (Yang et al., 2000) and umbilical cord (Mokry et al., 2004). In the E18.5 pancreas the nestin second intron/upstream promoter was additionally active in the enteric ganglia (Fig. 2), which is also in accordance with previous reports (Vanderwinden et al., 2002). The pattern of expression of EGFP in the brain was similar to that found in a transgenic mouse using a rat nestin second intron upstream of an hsp68 minimal promoter driving EGFP (Yamaguchi et al., 2000b; Kawaguchi et al., 2001). Collectively, these results confirm that expression of EGFP colocalises with known areas of nestin expression. We next focused on the pattern of EGFP expression in the developing pancreas. No detectable EGFP expression was observed in the E11.5 pancreas (Fig. 3), although weak EGFP expression was observed in the mesenchyme around the stomach at this stage. EGFP appeared first in the pancreas at E12.5 (Fig. 4). In the E14.5 embryo EGFP expression was expressed in a broad central band with weaker expression throughout the surrounding tissue (Fig. 3). This pattern was similar to that of the endogenous nestin as determined by immunohistochemistry. At later stages (E18.5 and P2) EGFP was expressed throughout the pancreas with particularly strong expression along the routes followed by duct-like structures (Fig. 3). EGFP was also detected in the adult pancreas (data not shown). Further studies concentrated on the E15.5 pancreas, because around this period the process that leads to the differentiation of the exocrine and endocrine pancreas takes place (Edlund, 2001). If nestin was present in pancreatic stem cells, EGFP would appear at this stage in cells that contained stem cell markers as well as markers of differentiated cells. At E15.5 EGFP was present in a network of cells distributed within and around the developing acini and ducts (data not shown). To characterize further the EGFP-positive cells at E15.5, the pancreas was
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
17
Fig. 2. Pattern of EGFP expression in the mouse embryo. The top three panels show an E11.5 mouse embryo showing a light micrograph, standard fluorescence micrograph and a merged image as indicated. The middle three panels show an E12.5 brain with a confocal fluorescence micrograph (EGFP), a section stained with an anti-nestin antibody and a merged image. The third panel shows a montage of five fluorescence micrographs from the gut of an E18.5 embryo.
18
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
dispersed into single cells and the EGFP-positive cells purified by flow cytometry (Fig. 5). The pool of EGFP-positive cells, which represented about 20% of the total cell population, was readily distinguishable from the background population. This is illustrated in the 2D-dot plot of green fluorescence versus red fluorescence (Fig. 5A). This subset population of EGFP-positive cells was gated and sorted in order to enhance its purity. In total we collected 4.8 × 105 cells, a population that was 96% pure (Fig. 5B). The purified cells were subsequently analyzed by RT-PCR (Fig. 6). There were two patterns of gene expression. A weak expressing set of genes that included nestin, the transcription factors PDX-1 and Isl-1, the islet hormones pancreatic polypeptide, glucagon and somatostatin, as well as GLUT2 and the duct cell marker cytokeratin 19, the stem cell marker ABCG2 and PECAM a marker of endothelial cells. A second strong expressing set of genes included insulin 1, insulin 2, amylase and the transcription factors neurogenin 3, p48 and PAX6. There was no detectable expression of PAX4 and IAPP (Fig. 6) or of Nkx6.1 and Nkx2.2 (data not shown) in the EGFP population. Dual fluorescent immunohistochemistry confirmed the colocalisation of the EGFP-positive cells with a subpopulation of nestin expressing cells in the E15.5 pancreas. Co-expression of EGFP and insulin or amylase was also confirmed at this time point (Fig. 7). 4. Discussion
Fig. 3. EGFP expression in the developing pancreas. Top panel shows a light and a standard fluorescence micrograph of a dissected pancreas and surrounding tissue from an E11.5 embryo. The dorsal (DP) and ventral (VP) lobes of the pancreas along with the stomach (ST) are indicated. The next three panels show light and fluorescent micrographs of the pancreas from E14.5, E18.5 embryos and post-natal day 2 (P2) animals. Different pancreas from these time points were analyzed and this pictures are representative of the EGFP distribution in the respective time points.
We have generated a transgenic mouse in which expression of EGFP is driven by the rat nestin second intron placed upstream of the 5.8 kb rat nestin promoter. The second intron of the rat nestin gene has previously been shown to direct reporter expression to neural precursors in the CNS while the first intron directs reporter expression to developing muscle (Lothian and Lendahl, 1997; Zimmerman et al., 1994). In keeping with these properties of the second intron the expression pattern of EGFP in the present study was in known sites of neuronal precursor expression in the developing brain, eye and gut. We also show here that the second intron regulatory sequences are active in the developing pancreas. EGFP expression was absent from the E11.5 pancreas but appeared at E12.5 where after it increased in intensity and distribution through to birth, predominantly associated with duct-like structures.
Fig. 4. EGFP expression in the E12.5 pancreas. Immunohistochemistry was performed on wax embedded sections from E12.5 pancreas. Panel A shows a light micrograph where the pancreas is encircled in a red line. Panel B shows a standard fluorescence micrograph with anti-EGFP immunostaining in blue.
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
19
Fig. 5. FACS analysis and purification of EGFP-positive cells from E15.5 pancreas. Dissected pancreases from a litter of transgenic mice were dispersed into a single cell suspension via enzyme digestion and analyzed using a FACS DiVa flow cytometer. Panel A shows a plot of the cell count in the red channel vs. the green channel. In cells from non-EGFP expressing embryos at the same stage of development there were no cells in the area marked P1. Panel B shows a second sort on the purified cell population from the area marked P1 in panel A. Several litters were analyzed and these are representative flow cytometer plots of an EGFP positive population before and after sorting.
At E15.5 the purified EGFP-expressing cells contained mRNA encoding insulin 1, insulin 2, ngn3, amylase and p48. Ngn3 is a basic helix loop helix transcription factor that marks a population of cells destined to become endocrine (Gradwohl et al., 2000; Schwitzgebel et al., 2000), while p48 is a component of the PTF1 transcription complex required for exocrine differentiation and the correct spatial organisation of the endocrine
Fig. 6. Reverse transcriptase PCR (RT/PCR) analysis of the purified EGFPpositive cells from an E15.5 pancreas. Ethidium bromide stained agarose gel of RT/PCR products from total RNA isolated from FACS purified EGFP-positive cells (F), and the total population of enzyme dispersed cells from EGFP-negative embryos from the same litter (T). The control panel shows the reaction in the absence of reverse transcriptase (-RT). RT-PCR of several of the EGFP positive populations sorted was performed and the same results were found. These data were obtained from the analysis of the population of cells which flow cytometry data is presented above.
pancreas (Krapp et al., 1998). Other transcription factors associated with islet differentiation such as PDX-1, and Isl-1 were weakly expressed, as were markers of the endocrine pancreas including PP, somatostatin, glucagon and GLUT2. These results are compatible with the view that the rat nestin second intron regulatory sequences are active in cells that give rise to both endocrine and exocrine cell lineages. There are contradictory reports on the pattern of expression and role of nestin in the developing pancreas. Some studies suggest that it is not expressed in epithelial cells (Humphrey et al., 2003), that it is present in the mesenchymal tissue (Selander and Edlund, 2002; Lardon et al., 2002) and that it contributes to the microvasculature (Treutelaar et al., 2003; Klein et al., 2003). However, there is strong evidence that nestin-positive cells contribute to the exocrine lineage (Delacour et al., 2004; Esni et al., 2004). For example, it is co-expressed with p48 but not with ngn3 in epithelial cells of the developing mouse pancreas (Esni et al., 2004). In addition, explant cultures of E10.5 pancreatic tissue, when treated with TGF␣ maintained expression of nestin at the expense of differentiated exocrine cells. This suggested a possible precursor relationship between early nestin expressing cells and later appearing exocrine cells (Leach, 2005). Further studies involving expression of the Cre recombinase under the control of the rat nestin promoter (5.8 kb) and second intron (1.8 kb), which allowed tissue specific expression of a floxed -galactosidase reporter showed that the nestin regulatory sequences were active in exocrine cells, a few duct cells, fibroblasts and vascular cells but not in endocrine cells (Delacour et al., 2004). Our study is in keeping with the view that nestin is associated with an exocrine cell lineage. However, we show here that the nestin second intron is also active in cells associated with an endocrine cell lineage. It is noteworthy that a recent study, using a previously described nestin/EGFP mouse (Yamaguchi et al., 2000b), demonstrated the presence of endocrine and exocrine markers in purified EGFP-positive cells from the adult pancreas (Ueno et al., 2005). There are several possible reasons why nestin expression was weak in the EGFP-positive sorted population. The existence of regulatory elements present in the endogenous nestin gene, but
20
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
Fig. 7. Fluorescence imaging and immunohistochemistry of sections from E15.5 pancreas. Immunohistochemistry was performed on cryosections from E15.5 pancreas. The various panels show EGFP fluorescence along with anti-EGFP (blue), anti-nestin (red), anti-insulin (red) and anti-amylase (red). Arrowheads indicate cells in which EGFP colocalises with and insulin or amylase (bottom two panels). Different cryosections from the same pancreas as well as different pancreas were studied. The results are representative of all the data collected and correspond to fields of view from cryosections of a single pancreas.
absent from the nestin-EGFP construct, might be down regulating nestin expression from the second intron. Additionally, the half-life of nestin mRNA might be shorter than EGFP. Considering that in the CNS nestin is down regulated upon differentiation (Zimmerman et al., 1994) the first explanation seems more plausible. It is of interest that the nestin second intron/promoter can distinguish different cell populations. Thus in the postnatal and adult mouse dentate gyrus two populations of neurons expressing EGFP under the control of the second intron can be differentiated on the basis of their electrophysiological properties (Fukuda et al., 2003). It is therefore possible that in the developing pancreas the second intron is active in two distinct progenitor cell populations; one destined for an endocrine fate and another for an exocrine fate.
Acknowledgements ASB was supported by a Leonardo da Vinci Scholarship and the Portuguese Foundation for Science and Technology (FCT). JB was supported by a studentship from the Aberdeen Consortium for Energy Regulation and Obesity (ACERO), and CWH was supported by a grant from the Wellcome Trust. References About, I., Laurent-Maquin, D., Lendahl, U., Mitsiadis, T.A., 2000. Nestin expression in embryonic and adult human teeth under normal and pathological conditions. Am. J. Pathol. 157, 287–295.
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21 Abraham, E.J., Kodama, S., Lin, J.C., Ubeda, M., Faustman, D.L., Habener, J.F., 2004. Human pancreatic islet-derived progenitor cell engraftment in immunocompetent mice. Am. J. Pathol. 164, 817–830. Delacour, A., Nepote, V., Trumpp, A., Herrera, P.L., 2004. Nestin expression in pancreatic exocrine cell lineages. Mech. Dev. 121, 3–14. Dor, Y., Brown, J., Martinez, O.I., Melton, D.A., 2004. Adult pancreatic bcells are formed by self-duplication rather than stem-cell differentiation. Nature 429, 41–46. Edlund, H., 2001. Developmental biology of the pancreas. Diabetes 50 (Suppl. 1), S5–S9. Esni, F., Stoffers, D.A., Takeuchi, T., Leach, S.D., 2004. Origin of exocrine pancreatic cells from nestin-positive precursors in developing mouse pancreas. Mech. Dev. 121, 15–25. Florenes, V.A., Holm, R., Myklebost, O., Lendahl, U., Fodstad, O., 1994. Expression of the neuroectodermal intermediate filament nestin in human melanomas. Cancer Res. 54, 354–356. Frisen, J., Johansson, C.B., Torok, C., Risling, M., Lendahl, U., 1995. Rapid, widespread, and longlasting induction of nestin contributes to the generation of glial scar tissue after CNS injury. J. Cell Biol. 131, 453–464. Frojdman, K., Pelliniemi, L.J., Lendahl, U., Virtanen, I., Eriksson, J.E., 1997. The intermediate filament protein nestin occurs transiently in differentiating testis of rat and mouse. Differentiation 61, 243–249. Fukuda, S., Kato, F., Tozuka, Y., Yamaguchi, M., Miyamoto, Y., Hisatsune, T., 2003. Two distinct subpopulations of nestin-positive cells in adult mouse dentate gyrus. J. Neurosci. 23, 9357–9366. Gradwohl, G., Dierich, A., LeMeur, M., Guillemot, F., 2000. Neurogenin 3 is required for the development of the four endocrine cell lineages of the pancreas. Proc. Natl. Acad. Sci. USA 97, 1607–1611. Holmin, S., Almqvist, P., Lendahl, U., Mathiesen, T., 1997. Adult nestinexpressing subependymal cells differentiate to astrocytes in response to brain injury. Eur. J. Neurosci. 9, 65–75. Huang, H., Tang, X., 2003. Phenotypic determination and characterization of nestin-positive precursors derived from human fetal pancreas. Lab. Invest. 83, 539–547. Humphrey, R.K., Bucay, N., Beattie, G.M., Lopez, A., Messam, C.A., Cirulli, V., Hayek, A., 2003. Characterization and isolation of promoterdefined nestin-positive cells from the human fetal pancreas. Diabetes 52, 2519–2525. Hunziker, E., Stein, M., 2000. Nestin-expressing cells in the pancreatic islets of Langerhans. Biochem. Biophys. Res. Commun. 271, 116–119. Kachinsky, A.M., Dominov, J.A., Miller, J.B., 1995. Intermediate filaments in cardiac myogenesis: nestin in the developing mouse heart. J. Histochem. Cytochem. 43, 843–847. Kawaguchi, A., Miyata, T., Sawamoto, K., Takashita, N., Murayama, A., Akamatsu, W., Ogawa, M., Okabe, M., Tano, Y., Goldman, S.A., Okano, H., 2001. Nestin-EGFP transgenic mice: visualization of the self-renewal and multipotency of CNS stem cells. Mol. Cell Neurosci. 17, 259–273. Klein, T., Ling, Z., Heimberg, H., Madsen, O.D., Heller, R.S., Serup, P., 2003. Nestin is expressed in vascular endothelial cells in the adult human pancreas. J. Histochem. Cytochem. 51, 697–706. Kobayashi, M., Sjoberg, G., Soderhall, S., Lendahl, U., Sandstedt, B., Sejersen, T., 1998. Pediatric rhabdomyosarcomas express the intermediate filament nestin. Pediatr. Res. 43, 386–392. Krapp, A., Knofler, M., Ledermann, B., Burki, K., Berney, C., Zoerkler, N., Hagenbuchle, O., Wellauer, P.K., 1998. The bHLH protein PTF1p48 is essential for the formation of the exocrine and the correct spatial organisation of the endocrine pancreas. Genes Dev. 12, 3752–3763. Lardon, J., Rooman, I., Bouwens, L., 2002. Nestin expression in pancreatic stellate cells and angiogenic endothelial cells. Histochem. Cell Biol. 117, 535–540. Leach, S.D., 2005. Epithelial differentiation in pancreatic development and neoplasia: new niches for nestin and Notch. J. Clin. Gastroenterol. 39, S78–S82. Lechner, A., Leech, C.A., Abraham, E.J., Nolan, A.L., Habener, J.F., 2002. Nestin-positive progenitor cells derived from adult human pancreatic islets of Langerhans contain side population (SP) cells defined by expression
21
of the ABCG2 (BCRP1) ATP-binding cassette transporter. Biochem. Biophys. Res. Commun. 293, 670–674. Lendahl, U., Zimmerman, L.B., McKay, R.D., 1990. CNS stem cells express a new class of intermediate filament protein. Cell 60, 585–595. Lothian, C., Lendahl, U., 1997. An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells. Eur. J. Neurosci. 9, 452–462. Lumelsky, N., Blondel, O., Laeng, P., Velasco, I., Ravin, R., McKay, R., 2001. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 292, 1389–1394. Mayer, E.J., Hughes, E.H., Carter, D.A., Dick, A.D., 2003. Nestin-positive cells in adult human retina and in epiretinal membranes. Br. J. Ophthalmol. 87, 1154–1158. Mokry, J., Cizkova, D., Filip, S., Ehrmann, J., Osterreicher, J., Kolar, Z., English, D., 2004. Nestin expression by newly formed human blood vessels. Stem Cells Dev. 13, 658–664. Schwitzgebel, V.M., Scheel, D.W., Conners, J.R., Kalamaras, J., Lee, J.E., Anderson, D.J., Sussel, L., Johnson, J.D., German, M.S., 2000. Expression of neurogenin 3 reveals an islet cell precursor population in the pancreas. Development 127, 3533–3542. Sejersen, T., Lendahl, U., 1993. Transient expression of the intermediate filament nestin during skeletal muscle development. J. Cell Sci. 106, 1291–1300. Selander, L., Edlund, H., 2002. Nestin is expressed in mesenchymal and not epithelial cells of the developing mouse pancreas. Mech. Dev. 113, 189–192. Shibuya, S., Miyamoto, O., Auer, R.N., Itano, T., Mori, S., Norimatsu, H., 2002. Embryonic intermediate filament, nestin, expression following traumatic spinal cord injury in adult rats. Neuroscience 114, 905–916. Treutelaar, M.K., Skidmore, J.M., Dias-Leme, C.L., Hara, M., Zhang, L., Simeone, D., Martin, D.M., Burant, C.F., 2003. Nestin-lineage cells contribute to the microvasculature but not endocrine cells of the islet. Diabetes 52, 2503–2512. Ueno, H., Yamada, Y., Watanabe, R., Mukai, E., Hosokawa, M., Takahashi, A., Hamasaki, A., Fujiwara, H., Toyokuni, S., Yamaguchi, M., Takeda, J., Seino, Y., 2005. Nestin-positive cells in adult pancreas express amylase and endocrine precursor cells. Pancreas 31, 126–131. Vanderwinden, J.M., Gillard, K., De Laet, M.H., Messam, C.A., Schiffmann, S.N., 2002. Distribution of the intermediate filament nestin in the muscularis propria of the human gastrointestinal tract. Cell Tissue Res. 309, 261–268. Walcott, J.C., Provis, J.M., 2003. Muller cells express the neuronal progenitor cell marker nestin in both differentiated and undifferentiated human foetal retina. Clin. Experiment. Ophthalmol. 31, 246–249. Yamaguchi, A., Tamatani, M., Matsuzaki, H., Namikawa, K., Kiyama, H., Vitek, M.P., Mitsuda, N., Tohyama, M., 2000a. Akt activation protects hippocampal neurons from apoptosis by inhibiting transcriptional activity of p53. J. Biol. Chem. 276, 5256–5264. Yamaguchi, M., Saito, H., Suzuki, M., Mori, K., 2000b. Visualization of neurogenesis in the central nervous system using nestin promoter-GFP transgenic mice. Neuroreport 11, 1991–1996. Yang, J., Bian, W., Gao, X., Chen, L., Jing, N., 2000. Nestin expression during mouse eye and lens development. Mech. Dev. 94, 287–291. Yashpal, N.K., Li, J., Wang, R., 2004. Characterization of c-Kit and nestin expression during islet cell development in the prenatal and post-natal rat pancreas. Dev. Dynam. 229, 813–825. Zimmerman, L., Parr, B., Lendahl, U., Cunningham, M., McKay, R., Gavin, B., Mann, J., Vassileva, G., McMahon, A., 1994. Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors. Neuron 12, 11–24. Zulewski, H., Abraham, E.J., Gerlach, M.J., Daniel, P.B., Moritz, W., Muller, B., Vallejo, M., Thomas, M.K., Habener, J.F., 2001. Multipotential nestinpositive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 50, 521–533.
Presence of endocrine and exocrine markers in EGFP-positive cells from the developing pancreas of a nestin/EGFP mouse Andreia S. Bernardo a , John Barrow a , Colin W. Hay a , Kenneth McCreath b , Alexander J. Kind b , Angelika E. Schnieke b , Alan Colman b , Alan W. Hart b , Kevin Docherty a,∗ a
School of Medical Sciences, University of Aberdeen, Institute of Medical Sciences, Foresterhill, Aberdeen AB25 2ZD, UK b PPL Therapeutics Ltd., Roslin, Edinburgh, UK Received 20 January 2006; received in revised form 6 March 2006; accepted 10 March 2006
Abstract In order to purify and characterize nestin-positive cells in the developing pancreas a transgenic mouse was generated, in which the enhanced green fluorescent protein (EGFP) was driven by the nestin second intronic enhancer and upstream promoter. In keeping with previous studies on the distribution of nestin, EGFP was expressed in the developing embryo in neurones in the brain, eye, spinal cord, tail bud and glial cells in the small intestine. In the pancreas there was no detectable EGFP at embryonic day 11.5 (E11.5). EGFP expression appeared at E12.5 and increased in intensity through E14.5, E18.5 and post-natal day 1. Flow cytometry was used to quantify and purify the EGFP positive population in the E15.5 pancreas. The purified (96%) EGFP-expressing cells, which represent 20% of the total cell population, were shown by RT/PCR to express exocrine cell markers (amylase and P48) and endocrine cell markers (insulin 1, insulin 2, and Ngn3). They also expressed, at a lower level, PDX-1, Isl-1, and the islet hormones pancreatic polypeptide, glucagon and somatostatin as well as GLUT2, the stem cell marker ABCG2 and PECAM, a marker of endothelial cells. It was further shown by immunocytochemistry of the E15.5 pancreas that EGFP colocalised in separate subpopulations of cells that expressed nestin, insulin and amylase. These results support the conclusion that nestin expressing cells can give rise to both endocrine and exocrine cells. The ability to purify these putative progenitor cells may provide further insights into their properties and function. © 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Islets of Langerhans; Endocrine pancreas; Insulin gene; Diabetes mellitus
1. Introduction Nestin is an intermediate filament protein that is expressed in neuronal stem cells (Lendahl et al., 1990). It is also expressed in stem cells involved in the formation of skeletal and cardiac muscle (Kachinsky et al., 1995; Sejersen and Lendahl, 1993), testis (Frojdman et al., 1997), teeth (About et al., 2000) and the retina (Mayer et al., 2003; Walcott and Provis, 2003). In the central nervous system (CNS) nestin expression is down regulated upon differentiation but reappears in response to injury or after the cells have been subject to different types of cellular stress (Frisen et al., 1995; Holmin et al., 1997; Shibuya et al., 2002). Nestin expression has also been observed in a number of tumours (Florenes et al., 1994; Kobayashi et al., 1998;
∗
Corresponding author. Tel.: +44 1224 555769; fax: +44 1224 555844. E-mail address: [email protected] (K. Docherty).
0303-7207/$ – see front matter © 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2006.03.003
Yamaguchi et al., 2000a). Nestin is also expressed in the developing pancreas (Hunziker and Stein, 2000) and in adult islets of Langerhans (Abraham et al., 2004; Huang and Tang, 2003; Lechner et al., 2002; Zulewski et al., 2001). In addition, it was shown that mouse embryonic stem cells that were induced to express nestin could be further induced to express the four islet cell types (Lumelsky et al., 2001). For these reasons it was thought that nestin might act as a marker for a pancreatic or islet progenitor cell (Yashpal et al., 2004), although recent findings question the existence of such an islet stem cell in the adult pancreas (Dor et al., 2004). To understand further the role of nestin expressing cells in the developing pancreas, we generated a transgenic mouse strain in which expression of EGFP is under the control of the rat nestin second intron and upstream promoter sequences (Zimmerman et al., 1994). We purified the EGFP-positive cells from the E15.5 pancreas and show that this cell population expresses markers of both the endocrine and exocrine cell lineage.
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
2. Experimental
15
was then sorted, homogenised in 1 ml of TRIZol (Invitrogen) and stored at −70 ◦ C.
2.1. Generation and analysis of transgenic mice 2.6. RNA isolation p401ZII (∼13.8 kb), a plasmid containing the rat nestin second intronic region as well as its promoter was kindly provided by Dr. A. McMahon (University of Harvard, Cambridge, USA). Sequences corresponding to the second intron and the upstream promoter were excised as HindIII/XbaI (1.8 kb) and SalI/XbaI (5.8 kb) fragments, respectively. The EGFP fragment of the pEGFP-1 plasmid (Clontech, Germany) was excised using HindIII and SalI restriction enzymes. These three fragments were then ligated to form the plasmid pNesIntron2EGFPNesP. Transgenic mice were generated by pronuclear injection of the pNesIntron2EGFPNesP plasmid into fertilized mouse eggs. Independent transgenic lines showing indistinguishable EGFP expression patterns were established on the C57BL6 genetic background. From these, a founder line was chosen on the basis of EGFP expression levels. The data presented were obtained from experiments using heterozygous mice resulting from the mating of C57BL6 females with nestin-EGFP transgenic males.
2.2. Genotyping Tail tips/ear clips from 4-week old mice were removed from each of the offspring of the founder stock. Tail tips were subjected to Proteinase K (Sigma, Poole, Dorset) digestion overnight at 55 ◦ C. Resultant digest products were centrifuged in a microcentrifuge and the supernatant used to prepare DNA using ethanol precipitation. The subsequent DNA preparations were then used in PCR reactions using the primer sets specified in Table 1. The PCR products were separated in 1.5% agarose gel and stained with ethidium bromide.
2.3. Mouse tissue Embryos were obtained from pregnant females at different days of development. The appearance of a vaginal plug was defined as embryonic day 0.5 (E0.5). At least three litters were analyzed for each time point.
2.4. Preparation of tissue for FACS Pancreatic tissue was dissected from transgenic or wild type embryos at E15.5. The tissue was placed in Hanks balanced salt solution (HBSS) (Invitrogen, Paisley, UK), finely chopped into smaller pieces and digested in a solution containing 0.3 mg/ml crude collagenase (Sigma) for 30 min at 37 ◦ C and then in a 0.05% trypsin–EDTA solution (GIBCO) for 5 min at 37 ◦ C. Heat inactivated fetal calf serum (FCS) (10%) was added to inactivate the trypsin and the cells were then washed in HBSS. The dissociated cells were filtered through a 70 m sterile strainer.
2.5. FACS analysis and sorting The EGFP expression of the pancreatic cell suspensions was analyzed using the FACS flow cytometer (Becton Dickinson FACS DiVa) equipped with three lasers. The emitted fluorescence of EGFP was measured as a green signal in a log scale at 525 nm—FL1 (FITC band pass filter) and red fluorescence was measured as an orange signal in a log scale at 574 nm—FL2 (PE band pass filter). Analyses were performed using Zeiss software. Cells were analyzed for forward scatter, side scatter, and EGFP fluorescence. Wild type mice cell suspensions were used as negative controls. The EGFP positive population of cells
The EGFP-positive FACS sorted cells homogenised in TRIZol were thawed at room temperature for 10 min. RNA was subsequently extracted in chloroform and precipitated with isopropanol.
2.7. RT-PCR Total RNA was treated with amplification grade DNase I (Invitrogen) using standard protocols. First strand synthesis was done by reverse transcription with Superscript II reverse transcriptase (220 units/l) (Invitrogen) using the manufacturer’s protocol. For the PCR reactions, to each pre-chilled tube was added 2.5 l forward (FWD) primer (2 M), 2.5 l reverse (REV) primer (2 M), 2.5 l 10× Mg free Taq Polymerase buffer, 3.0 l MgCl2 (to give 3 mM), 0.5 l 10 mM dNTPs, 0.25 l Taq Polymerase (5 units/l) (Promega) and 12.75 l of dd-water. cDNA (1 l) was then added and the tubes placed in the thermal cycler (Thermo Hybaid PCR). Primer sets were designed on the basis of NCBI gene bank and synthesized by MWG. Primer sequences and annealing temperatures were as specified in Table 2. After PCR amplification the PCR products were separated in agarose gel (1.2 or 1.5%) and stained with ethidium bromide. Controls without reverse transcriptase (-RT controls) were done for all PCR reactions.
2.8. Fixation and tissue preparation Heads from E12.5, pancreas from E12.5 and E15.5 as well as gut from E18.5, were harvested in ice-cold PBS. Fluorescence images were captured using an Axioplan 2 Zeiss inverted microscope. The tissues were fixed in 4% (v/v) paraformaldehyde (PFA) for 1 h at room temperature. They were then transferred to a solution containing equal volumes of phosphate buffered saline (PBS) and OCT medium (Vector International, Port Talbot, UK) and incubated at 4 ◦ C overnight. The tissue was embedded in OCT medium followed by freezing using iso-pentane in liquid nitrogen and stored at −70 ◦ C. Cryosections of 5–7 m thickness were cut on a cryostat (Leica CM1900), mounted on poly-lysinecoated slides (BHD Laboratory Supplies), and stored at −70 ◦ C.
2.9. Immunohistochemistry Cryosections were thawed at room temperature for 10 min and immunohistochemistry was performed according to standard immunohistochemistry techniques. Primary antibodies were incubated with tissue sections at 4 ◦ C overnight in a humidified chamber at the following concentrations: rabbit antiGFP (Molecular Probes, Cambridge, UK) at 1:200; rabbit anti-nestin (Dr. U. Lendahl, Karolinska Institute, Sweden) at 1:100; rabbit anti-amylase (Sigma, Poole, UK) at 1:500 and mouse anti-insulin (Sigma) at 1:2000. Fluorescent labeled secondary antibodies were used to detect primary antibodies at the following concentrations: alexa fluor 350 goat anti-rabbit (Molecular Probes) at 1:300; texas red goat anti-rabbit (Molecular Probes) at 1:100 or 1:1000 and rhodamine rabbit anti-mouse (Jackson Immunoresearch, Soham, UK) at 1:7000. Fluorescence images were obtained using either a Zeiss LSM-510 laser confocal microscope or a Zeiss Axioskop 2 conventional fluorescence microscope, and processed using LSM Image browser from Zeiss or Paint Shop Pro, respectively. Images were edited using Adobe Photoshop 6.0.
Table 1 Genotyping primers Gene
Forward primer
Reverse primer
Product size (bp)
Annealing temperature
Accession number
MHPRT MGAPDH RnestinI2 EGFP
gagttccggaactgcctttggtg agtgccagcctcgtcccgtagacaaaatg cttggctttgtactttctgtga accctcgtgaccaccctgacctac
ctgtgccaccgggcgcatgg aagtgggccccggccttctccat tttaagcatcaccgtctcttc gaccatgtgatcgcgcttctcgt
332 355 361 483
66 62 62 66
M12561 M32599 AF004334 U55761
16
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
Table 2 RT-PCR primers Gene
Forward primer
Reverse primer
Product size (bp)
Annealing temperature
Accession number
Insulin 1 Insulin 2 Glucagon Somatostatin PP P48 Amylase Pdx-1 Pax4 Pax6 Isl-1 IAPP Ngn3 Nkx2.2 Nkx6.1 Glut2 GAPDH HPRT PECAM Cytokeratin 19 ABCG2 Nestin
accatcagcaagcaggtcat cagcaagcaggaagcctatc ccagatcattcccagcttca ccaccgggaaacaggaactg tagctcagcacacaggatgg atcgaggcacccgttcac gcttatcaggtcagaaattgtcg agtgggcaggaggtgcttac ccttaaggtatctaatggctgtgt gaccacttcaacaggactcatt atcaggttgtacgggatcaaat acctgtcagaagtggtagca cagctcagaaatccctctgg cctccaatactccctgcac agtcaggtcaaggtctggttc ttcggctatgacatcggtgtg aagggctcatgaccacagtc gccagactttgttggatttga ctgaggaaaactccttcaccatc cagaaccaagtttgagacagaa gtggttcaagatgacgttgtga aggcccctttagtagggtctc
cacttgtgggtcctccactt ttgtgccacttgtgggtcct tggtgctcatctcgtcagag gggccaggagttaaggaaga gcctggtcagtgtgttgatg cgatgtgagctgtctcagga cattccacttgcggataactg accctcagactgctgtcctc gtgcaagctctggtcttcct tccaacagcctgtgttgttc aagggactgagagggtctcc catcaagcacaagcacattg gaggcgccatcctagttctc gggcacgtttcatcttgtag cgccacaatttctaggttaaaa agctgaggccagcaatctgac cttactccttggaggccatgt agataagcgacaatctaccagagg accttcacctcgtactcaatcgt gtgacttcggtcttgcttatct aagatggaataccgaggctgat caggtgagccacagaagaaag
218 235 384 303 203 226 352 473 277 407 236 334 246 314 400 556 495 361 301 396 380 323
63 63 60 63 60 59 63 64 59 60 59 67 59 59 59 67 68 63 60 61 63 60
NM 008386 NM 008387 AK007911 NM 009215 NM 008918 NM 018809 NM 009669 NM 008814 XM 133023 NM 013627 NM 021459 BC027527 NM 009719 NM 010919 NM 144955 BC034675 NM 008084 XM 356404 BC008519 M28698 BC063730 NM 016701
3. Results In this study, we generated transgenic mice in which the EGFP gene was placed under the control of the second intronic region followed by the 5.8 kb upstream promoter sequence of the rat nestin gene (Fig. 1). Thirty-nine lines showed indistinguishable patterns of EGFP expression and from these lines the founder line 01/29:39 was chosen as the overall expression levels of EGFP were higher. Male nestin-EGFP mice were bred with wild type females (C57BL6) and the resulting F1 generations were genotyped. The presence of a 483 bp PCR product confirmed that the EGFP transgene was present in one out of three of the offspring (data not shown). Preliminary experiments were performed to determine whether the EGFP expression pattern was similar to the known expression pattern for nestin. In the E11.5 embryo EGFP expression was detectable throughout the CNS including the brain, spinal cord and tail bud (Fig. 2), a pattern of distribution that had previously been reported (Kawaguchi et al., 2001). At this time point we were also able to confirm EGFP expression in the
Fig. 1. Structure of the pNesIntron2-NesP-EGFP vector. Schematic depiction of the construct pNesIntron2-NesP-EGFP, showing the EGFP gene flanked by the rat nestin upstream promoter region placed downstream of the nestin second intronic region.
eye (Yang et al., 2000) and umbilical cord (Mokry et al., 2004). In the E18.5 pancreas the nestin second intron/upstream promoter was additionally active in the enteric ganglia (Fig. 2), which is also in accordance with previous reports (Vanderwinden et al., 2002). The pattern of expression of EGFP in the brain was similar to that found in a transgenic mouse using a rat nestin second intron upstream of an hsp68 minimal promoter driving EGFP (Yamaguchi et al., 2000b; Kawaguchi et al., 2001). Collectively, these results confirm that expression of EGFP colocalises with known areas of nestin expression. We next focused on the pattern of EGFP expression in the developing pancreas. No detectable EGFP expression was observed in the E11.5 pancreas (Fig. 3), although weak EGFP expression was observed in the mesenchyme around the stomach at this stage. EGFP appeared first in the pancreas at E12.5 (Fig. 4). In the E14.5 embryo EGFP expression was expressed in a broad central band with weaker expression throughout the surrounding tissue (Fig. 3). This pattern was similar to that of the endogenous nestin as determined by immunohistochemistry. At later stages (E18.5 and P2) EGFP was expressed throughout the pancreas with particularly strong expression along the routes followed by duct-like structures (Fig. 3). EGFP was also detected in the adult pancreas (data not shown). Further studies concentrated on the E15.5 pancreas, because around this period the process that leads to the differentiation of the exocrine and endocrine pancreas takes place (Edlund, 2001). If nestin was present in pancreatic stem cells, EGFP would appear at this stage in cells that contained stem cell markers as well as markers of differentiated cells. At E15.5 EGFP was present in a network of cells distributed within and around the developing acini and ducts (data not shown). To characterize further the EGFP-positive cells at E15.5, the pancreas was
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
17
Fig. 2. Pattern of EGFP expression in the mouse embryo. The top three panels show an E11.5 mouse embryo showing a light micrograph, standard fluorescence micrograph and a merged image as indicated. The middle three panels show an E12.5 brain with a confocal fluorescence micrograph (EGFP), a section stained with an anti-nestin antibody and a merged image. The third panel shows a montage of five fluorescence micrographs from the gut of an E18.5 embryo.
18
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
dispersed into single cells and the EGFP-positive cells purified by flow cytometry (Fig. 5). The pool of EGFP-positive cells, which represented about 20% of the total cell population, was readily distinguishable from the background population. This is illustrated in the 2D-dot plot of green fluorescence versus red fluorescence (Fig. 5A). This subset population of EGFP-positive cells was gated and sorted in order to enhance its purity. In total we collected 4.8 × 105 cells, a population that was 96% pure (Fig. 5B). The purified cells were subsequently analyzed by RT-PCR (Fig. 6). There were two patterns of gene expression. A weak expressing set of genes that included nestin, the transcription factors PDX-1 and Isl-1, the islet hormones pancreatic polypeptide, glucagon and somatostatin, as well as GLUT2 and the duct cell marker cytokeratin 19, the stem cell marker ABCG2 and PECAM a marker of endothelial cells. A second strong expressing set of genes included insulin 1, insulin 2, amylase and the transcription factors neurogenin 3, p48 and PAX6. There was no detectable expression of PAX4 and IAPP (Fig. 6) or of Nkx6.1 and Nkx2.2 (data not shown) in the EGFP population. Dual fluorescent immunohistochemistry confirmed the colocalisation of the EGFP-positive cells with a subpopulation of nestin expressing cells in the E15.5 pancreas. Co-expression of EGFP and insulin or amylase was also confirmed at this time point (Fig. 7). 4. Discussion
Fig. 3. EGFP expression in the developing pancreas. Top panel shows a light and a standard fluorescence micrograph of a dissected pancreas and surrounding tissue from an E11.5 embryo. The dorsal (DP) and ventral (VP) lobes of the pancreas along with the stomach (ST) are indicated. The next three panels show light and fluorescent micrographs of the pancreas from E14.5, E18.5 embryos and post-natal day 2 (P2) animals. Different pancreas from these time points were analyzed and this pictures are representative of the EGFP distribution in the respective time points.
We have generated a transgenic mouse in which expression of EGFP is driven by the rat nestin second intron placed upstream of the 5.8 kb rat nestin promoter. The second intron of the rat nestin gene has previously been shown to direct reporter expression to neural precursors in the CNS while the first intron directs reporter expression to developing muscle (Lothian and Lendahl, 1997; Zimmerman et al., 1994). In keeping with these properties of the second intron the expression pattern of EGFP in the present study was in known sites of neuronal precursor expression in the developing brain, eye and gut. We also show here that the second intron regulatory sequences are active in the developing pancreas. EGFP expression was absent from the E11.5 pancreas but appeared at E12.5 where after it increased in intensity and distribution through to birth, predominantly associated with duct-like structures.
Fig. 4. EGFP expression in the E12.5 pancreas. Immunohistochemistry was performed on wax embedded sections from E12.5 pancreas. Panel A shows a light micrograph where the pancreas is encircled in a red line. Panel B shows a standard fluorescence micrograph with anti-EGFP immunostaining in blue.
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
19
Fig. 5. FACS analysis and purification of EGFP-positive cells from E15.5 pancreas. Dissected pancreases from a litter of transgenic mice were dispersed into a single cell suspension via enzyme digestion and analyzed using a FACS DiVa flow cytometer. Panel A shows a plot of the cell count in the red channel vs. the green channel. In cells from non-EGFP expressing embryos at the same stage of development there were no cells in the area marked P1. Panel B shows a second sort on the purified cell population from the area marked P1 in panel A. Several litters were analyzed and these are representative flow cytometer plots of an EGFP positive population before and after sorting.
At E15.5 the purified EGFP-expressing cells contained mRNA encoding insulin 1, insulin 2, ngn3, amylase and p48. Ngn3 is a basic helix loop helix transcription factor that marks a population of cells destined to become endocrine (Gradwohl et al., 2000; Schwitzgebel et al., 2000), while p48 is a component of the PTF1 transcription complex required for exocrine differentiation and the correct spatial organisation of the endocrine
Fig. 6. Reverse transcriptase PCR (RT/PCR) analysis of the purified EGFPpositive cells from an E15.5 pancreas. Ethidium bromide stained agarose gel of RT/PCR products from total RNA isolated from FACS purified EGFP-positive cells (F), and the total population of enzyme dispersed cells from EGFP-negative embryos from the same litter (T). The control panel shows the reaction in the absence of reverse transcriptase (-RT). RT-PCR of several of the EGFP positive populations sorted was performed and the same results were found. These data were obtained from the analysis of the population of cells which flow cytometry data is presented above.
pancreas (Krapp et al., 1998). Other transcription factors associated with islet differentiation such as PDX-1, and Isl-1 were weakly expressed, as were markers of the endocrine pancreas including PP, somatostatin, glucagon and GLUT2. These results are compatible with the view that the rat nestin second intron regulatory sequences are active in cells that give rise to both endocrine and exocrine cell lineages. There are contradictory reports on the pattern of expression and role of nestin in the developing pancreas. Some studies suggest that it is not expressed in epithelial cells (Humphrey et al., 2003), that it is present in the mesenchymal tissue (Selander and Edlund, 2002; Lardon et al., 2002) and that it contributes to the microvasculature (Treutelaar et al., 2003; Klein et al., 2003). However, there is strong evidence that nestin-positive cells contribute to the exocrine lineage (Delacour et al., 2004; Esni et al., 2004). For example, it is co-expressed with p48 but not with ngn3 in epithelial cells of the developing mouse pancreas (Esni et al., 2004). In addition, explant cultures of E10.5 pancreatic tissue, when treated with TGF␣ maintained expression of nestin at the expense of differentiated exocrine cells. This suggested a possible precursor relationship between early nestin expressing cells and later appearing exocrine cells (Leach, 2005). Further studies involving expression of the Cre recombinase under the control of the rat nestin promoter (5.8 kb) and second intron (1.8 kb), which allowed tissue specific expression of a floxed -galactosidase reporter showed that the nestin regulatory sequences were active in exocrine cells, a few duct cells, fibroblasts and vascular cells but not in endocrine cells (Delacour et al., 2004). Our study is in keeping with the view that nestin is associated with an exocrine cell lineage. However, we show here that the nestin second intron is also active in cells associated with an endocrine cell lineage. It is noteworthy that a recent study, using a previously described nestin/EGFP mouse (Yamaguchi et al., 2000b), demonstrated the presence of endocrine and exocrine markers in purified EGFP-positive cells from the adult pancreas (Ueno et al., 2005). There are several possible reasons why nestin expression was weak in the EGFP-positive sorted population. The existence of regulatory elements present in the endogenous nestin gene, but
20
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21
Fig. 7. Fluorescence imaging and immunohistochemistry of sections from E15.5 pancreas. Immunohistochemistry was performed on cryosections from E15.5 pancreas. The various panels show EGFP fluorescence along with anti-EGFP (blue), anti-nestin (red), anti-insulin (red) and anti-amylase (red). Arrowheads indicate cells in which EGFP colocalises with and insulin or amylase (bottom two panels). Different cryosections from the same pancreas as well as different pancreas were studied. The results are representative of all the data collected and correspond to fields of view from cryosections of a single pancreas.
absent from the nestin-EGFP construct, might be down regulating nestin expression from the second intron. Additionally, the half-life of nestin mRNA might be shorter than EGFP. Considering that in the CNS nestin is down regulated upon differentiation (Zimmerman et al., 1994) the first explanation seems more plausible. It is of interest that the nestin second intron/promoter can distinguish different cell populations. Thus in the postnatal and adult mouse dentate gyrus two populations of neurons expressing EGFP under the control of the second intron can be differentiated on the basis of their electrophysiological properties (Fukuda et al., 2003). It is therefore possible that in the developing pancreas the second intron is active in two distinct progenitor cell populations; one destined for an endocrine fate and another for an exocrine fate.
Acknowledgements ASB was supported by a Leonardo da Vinci Scholarship and the Portuguese Foundation for Science and Technology (FCT). JB was supported by a studentship from the Aberdeen Consortium for Energy Regulation and Obesity (ACERO), and CWH was supported by a grant from the Wellcome Trust. References About, I., Laurent-Maquin, D., Lendahl, U., Mitsiadis, T.A., 2000. Nestin expression in embryonic and adult human teeth under normal and pathological conditions. Am. J. Pathol. 157, 287–295.
A.S. Bernardo et al. / Molecular and Cellular Endocrinology 253 (2006) 14–21 Abraham, E.J., Kodama, S., Lin, J.C., Ubeda, M., Faustman, D.L., Habener, J.F., 2004. Human pancreatic islet-derived progenitor cell engraftment in immunocompetent mice. Am. J. Pathol. 164, 817–830. Delacour, A., Nepote, V., Trumpp, A., Herrera, P.L., 2004. Nestin expression in pancreatic exocrine cell lineages. Mech. Dev. 121, 3–14. Dor, Y., Brown, J., Martinez, O.I., Melton, D.A., 2004. Adult pancreatic bcells are formed by self-duplication rather than stem-cell differentiation. Nature 429, 41–46. Edlund, H., 2001. Developmental biology of the pancreas. Diabetes 50 (Suppl. 1), S5–S9. Esni, F., Stoffers, D.A., Takeuchi, T., Leach, S.D., 2004. Origin of exocrine pancreatic cells from nestin-positive precursors in developing mouse pancreas. Mech. Dev. 121, 15–25. Florenes, V.A., Holm, R., Myklebost, O., Lendahl, U., Fodstad, O., 1994. Expression of the neuroectodermal intermediate filament nestin in human melanomas. Cancer Res. 54, 354–356. Frisen, J., Johansson, C.B., Torok, C., Risling, M., Lendahl, U., 1995. Rapid, widespread, and longlasting induction of nestin contributes to the generation of glial scar tissue after CNS injury. J. Cell Biol. 131, 453–464. Frojdman, K., Pelliniemi, L.J., Lendahl, U., Virtanen, I., Eriksson, J.E., 1997. The intermediate filament protein nestin occurs transiently in differentiating testis of rat and mouse. Differentiation 61, 243–249. Fukuda, S., Kato, F., Tozuka, Y., Yamaguchi, M., Miyamoto, Y., Hisatsune, T., 2003. Two distinct subpopulations of nestin-positive cells in adult mouse dentate gyrus. J. Neurosci. 23, 9357–9366. Gradwohl, G., Dierich, A., LeMeur, M., Guillemot, F., 2000. Neurogenin 3 is required for the development of the four endocrine cell lineages of the pancreas. Proc. Natl. Acad. Sci. USA 97, 1607–1611. Holmin, S., Almqvist, P., Lendahl, U., Mathiesen, T., 1997. Adult nestinexpressing subependymal cells differentiate to astrocytes in response to brain injury. Eur. J. Neurosci. 9, 65–75. Huang, H., Tang, X., 2003. Phenotypic determination and characterization of nestin-positive precursors derived from human fetal pancreas. Lab. Invest. 83, 539–547. Humphrey, R.K., Bucay, N., Beattie, G.M., Lopez, A., Messam, C.A., Cirulli, V., Hayek, A., 2003. Characterization and isolation of promoterdefined nestin-positive cells from the human fetal pancreas. Diabetes 52, 2519–2525. Hunziker, E., Stein, M., 2000. Nestin-expressing cells in the pancreatic islets of Langerhans. Biochem. Biophys. Res. Commun. 271, 116–119. Kachinsky, A.M., Dominov, J.A., Miller, J.B., 1995. Intermediate filaments in cardiac myogenesis: nestin in the developing mouse heart. J. Histochem. Cytochem. 43, 843–847. Kawaguchi, A., Miyata, T., Sawamoto, K., Takashita, N., Murayama, A., Akamatsu, W., Ogawa, M., Okabe, M., Tano, Y., Goldman, S.A., Okano, H., 2001. Nestin-EGFP transgenic mice: visualization of the self-renewal and multipotency of CNS stem cells. Mol. Cell Neurosci. 17, 259–273. Klein, T., Ling, Z., Heimberg, H., Madsen, O.D., Heller, R.S., Serup, P., 2003. Nestin is expressed in vascular endothelial cells in the adult human pancreas. J. Histochem. Cytochem. 51, 697–706. Kobayashi, M., Sjoberg, G., Soderhall, S., Lendahl, U., Sandstedt, B., Sejersen, T., 1998. Pediatric rhabdomyosarcomas express the intermediate filament nestin. Pediatr. Res. 43, 386–392. Krapp, A., Knofler, M., Ledermann, B., Burki, K., Berney, C., Zoerkler, N., Hagenbuchle, O., Wellauer, P.K., 1998. The bHLH protein PTF1p48 is essential for the formation of the exocrine and the correct spatial organisation of the endocrine pancreas. Genes Dev. 12, 3752–3763. Lardon, J., Rooman, I., Bouwens, L., 2002. Nestin expression in pancreatic stellate cells and angiogenic endothelial cells. Histochem. Cell Biol. 117, 535–540. Leach, S.D., 2005. Epithelial differentiation in pancreatic development and neoplasia: new niches for nestin and Notch. J. Clin. Gastroenterol. 39, S78–S82. Lechner, A., Leech, C.A., Abraham, E.J., Nolan, A.L., Habener, J.F., 2002. Nestin-positive progenitor cells derived from adult human pancreatic islets of Langerhans contain side population (SP) cells defined by expression
21
of the ABCG2 (BCRP1) ATP-binding cassette transporter. Biochem. Biophys. Res. Commun. 293, 670–674. Lendahl, U., Zimmerman, L.B., McKay, R.D., 1990. CNS stem cells express a new class of intermediate filament protein. Cell 60, 585–595. Lothian, C., Lendahl, U., 1997. An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells. Eur. J. Neurosci. 9, 452–462. Lumelsky, N., Blondel, O., Laeng, P., Velasco, I., Ravin, R., McKay, R., 2001. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 292, 1389–1394. Mayer, E.J., Hughes, E.H., Carter, D.A., Dick, A.D., 2003. Nestin-positive cells in adult human retina and in epiretinal membranes. Br. J. Ophthalmol. 87, 1154–1158. Mokry, J., Cizkova, D., Filip, S., Ehrmann, J., Osterreicher, J., Kolar, Z., English, D., 2004. Nestin expression by newly formed human blood vessels. Stem Cells Dev. 13, 658–664. Schwitzgebel, V.M., Scheel, D.W., Conners, J.R., Kalamaras, J., Lee, J.E., Anderson, D.J., Sussel, L., Johnson, J.D., German, M.S., 2000. Expression of neurogenin 3 reveals an islet cell precursor population in the pancreas. Development 127, 3533–3542. Sejersen, T., Lendahl, U., 1993. Transient expression of the intermediate filament nestin during skeletal muscle development. J. Cell Sci. 106, 1291–1300. Selander, L., Edlund, H., 2002. Nestin is expressed in mesenchymal and not epithelial cells of the developing mouse pancreas. Mech. Dev. 113, 189–192. Shibuya, S., Miyamoto, O., Auer, R.N., Itano, T., Mori, S., Norimatsu, H., 2002. Embryonic intermediate filament, nestin, expression following traumatic spinal cord injury in adult rats. Neuroscience 114, 905–916. Treutelaar, M.K., Skidmore, J.M., Dias-Leme, C.L., Hara, M., Zhang, L., Simeone, D., Martin, D.M., Burant, C.F., 2003. Nestin-lineage cells contribute to the microvasculature but not endocrine cells of the islet. Diabetes 52, 2503–2512. Ueno, H., Yamada, Y., Watanabe, R., Mukai, E., Hosokawa, M., Takahashi, A., Hamasaki, A., Fujiwara, H., Toyokuni, S., Yamaguchi, M., Takeda, J., Seino, Y., 2005. Nestin-positive cells in adult pancreas express amylase and endocrine precursor cells. Pancreas 31, 126–131. Vanderwinden, J.M., Gillard, K., De Laet, M.H., Messam, C.A., Schiffmann, S.N., 2002. Distribution of the intermediate filament nestin in the muscularis propria of the human gastrointestinal tract. Cell Tissue Res. 309, 261–268. Walcott, J.C., Provis, J.M., 2003. Muller cells express the neuronal progenitor cell marker nestin in both differentiated and undifferentiated human foetal retina. Clin. Experiment. Ophthalmol. 31, 246–249. Yamaguchi, A., Tamatani, M., Matsuzaki, H., Namikawa, K., Kiyama, H., Vitek, M.P., Mitsuda, N., Tohyama, M., 2000a. Akt activation protects hippocampal neurons from apoptosis by inhibiting transcriptional activity of p53. J. Biol. Chem. 276, 5256–5264. Yamaguchi, M., Saito, H., Suzuki, M., Mori, K., 2000b. Visualization of neurogenesis in the central nervous system using nestin promoter-GFP transgenic mice. Neuroreport 11, 1991–1996. Yang, J., Bian, W., Gao, X., Chen, L., Jing, N., 2000. Nestin expression during mouse eye and lens development. Mech. Dev. 94, 287–291. Yashpal, N.K., Li, J., Wang, R., 2004. Characterization of c-Kit and nestin expression during islet cell development in the prenatal and post-natal rat pancreas. Dev. Dynam. 229, 813–825. Zimmerman, L., Parr, B., Lendahl, U., Cunningham, M., McKay, R., Gavin, B., Mann, J., Vassileva, G., McMahon, A., 1994. Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors. Neuron 12, 11–24. Zulewski, H., Abraham, E.J., Gerlach, M.J., Daniel, P.B., Moritz, W., Muller, B., Vallejo, M., Thomas, M.K., Habener, J.F., 2001. Multipotential nestinpositive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 50, 521–533.