- Email: [email protected]
Presence of erm gene classes in Gram-positive bacteria of animal and human origin in Denmark
FEMS Microbiology Letters 170 (1999) 151^158
Presence of erm gene classes in Gram-positive bacteria of animal and human origin in Denmark Lars BogÖ Jensen a; *, Niels Frimodt-MÖller b , Frank M. Aarestrup b
a
a Danish Veterinary Laboratory, Buëlowsvej 27, DK-1790 Copenhagen V, Denmark Department of Clinical Microbiology, Statens Serum Institut, Artillerivej 5, DK-2300 Copenhagen S, Denmark
Received 10 July 1998; received in revised form 1 October 1998; accepted 26 October 1998
Abstract A classification of the different erm gene classes based on published sequences was performed, and specific primers to detect some of these classes designed. The presence of ermA (Tn554), ermB (class IV) and ermC (class VI) was determined by PCR in a total of 113 enterococcal, 77 streptococcal and 68 staphylococcal erythromycin resistant isolates of animal and human origin. At least one of these genes was detected in 88% of the isolates. Four isolates contained more than one erm gene. ermB dominated among the enterococci (88%) and streptococci (90%) and ermC among staphylococci (75%) with ermA (Tn554) present in some isolates (16%). Variations in the presence of the different genes when comparing staphylococcal isolates of human and animal origin were observed. z 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Erythromycin resistance; Animal ; erm gene classi¢cation
1. Introduction The macrolide tylosin is the most commonly used antimicrobial agent in pig production in Denmark. Recent national surveys have found widespread resistance to macrolides in staphylococci, streptococci and enterococci isolated from pigs in Denmark [1,2]. Macrolides are used for treatment of humans with erythromycin as ¢rst choice also as a substitute for penicillin in cases where patients are allergic to penicillin [3]. Resistance to macrolides is based on di¡erent mechanisms: target modi¢cation by point mutation * Corresponding author. Tel.: +45 35 30 01 00; Fax: +45 35 30 01 20; E-mail: [email protected]
or methylation of 23S rRNA inhibiting binding of macrolides so protein synthesis is not interfered with [4], hydrolysis of the lactone ring in the macrolide [5] and e¥ux pumps removing the antibiotic internally from the bacteria [6^8]. Resistance to macrolides can spread from animals to human, either by spread of the resistant bacteria or by horizontal gene transfer of mobile DNA elements. To determine whether a horizontal spread of resistance has occurred, a characterization of the mechanisms for resistance is needed. According to the published literature [9^12] the most frequently found macrolide resistance genes in bacterial isolates from animals and humans are the erm genes. These genes encode a methyltranferase that has speci¢c target residues in the 23S rRNA
0378-1097 / 99 / $19.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 8 ) 0 0 5 3 9 - 4
FEMSLE 8535 23-12-98
152
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
Table 1 erm genes published in GenBank Origin Class 0 (ermE group) S. erythraea S. erythraea Class I (ermDK group) B. anthracis B. licheniformis B. licheniformis Class II (ermF group) B. fragilis B. fragilis B. fragilis Class III (ermA2 group) C. xerosis C. diphtheriae C. diphtheriae C. diphthteriae Class IV (ermB group) L. fermentum S. pyogenes Enterococcus S. pyogenes E. faecalis S. lentus S. agalactiae C. perfringens E. coli E. hirae S. sanguis E. faecalis S. pneumoniae E. faecalis E. faecalis Class V (ermG group) E. faecalis B. sphaericus Class VI (ermC group) B. subtilis S. aureus S. aureus S. chromogenes S. simulans S. epidermidis S. aureus S. aureus S. aureus S. equorum S. hominis S. haemolyticus S. hyicus S. aureus S. aureus
Position
Size
Gene
GenBanka
Chromosomal DNA Chromosomal DNA
1257 bp 1113 bp
ermE ermE2
X51891 M11200 M11304
Chromosomal DNA Chromosomal DNA Chromosomal DNA
864 bp 864 bp 864 bp
ermJ ermD ermK
L08389 M29832 M77505
Conjugal element Tn4351 Tn4551
801 bp 801 bp 801 bp
ermFU ermF ermFS
M62487 M17124 M17808
Tn5432 pNG2 pSV5(pNG2) pNG2
762 855 762 762
bp bp bp bp
ermCX ermCd ermA ermA
U21300 M36726 X57320 X51472
pLEM3 pMD101 plasmid pBT233 not determined pSES20 pIP501 Chromosomal DNA pIP1527 not determined pAM77 Tn917 (pAD2) Tn1545 pAML1 pAML1
753 750 738 738 738 738 738 738 738 738 738 738 738 283 161
bp bp bp bp bp bp bp bp bp bp bp bp bp bp bp
erm erm erm2 erm2 ermB ermB erm ermBP ermBC ermAM ermAM ermB ermB ermAM* ermAM*
U48430 X66468 X82819 X64695 U86375 U35228 X72021 U18931 M19270 X81655 K00551 M11180 M36722 X52632 M20334 M20335
Tn7853 Chromosomal DNA
735 bp 735 bp
metht. ermG
L42817 M15332
pIM13 J3356: :POX7;1 J3356: :POX7;3 pPV141 pV142 pNE131 pE194 pE5 pT48 pSES6 pSES5 pSES4a pSES21 pRJ5 pA22
735 735 759 735 735 735 735 735 735 735 735 735 735 283 226
ermC ermC ermC ermM ermM ermM ermC ermC ermC ermC ermC ermC ermC ermC* ermC*
M13761 U36911 U36912 U82607 AF019140 M12730 J0175-8 M17990 M19652 X82668 Y09001 Y09002 Y09003 L04687 X54338
bp bp bp bp bp bp bp bp bp bp bp bp bp bp bp
FEMSLE 8535 23-12-98
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
153
Table 1 (continued). Origin
Position
Unique sequences H. in£uenzae B. fragilis Arthrobacter sp. S. fradiae C. perfringens Lactobacillus S. pyogenes S. aureus
Chromosomal pBF4 Chromosomal pSK101 Chromosomal pGT633 Chromosomal Tn554
Size DNA
1173 1035 1023 960 774 735 732 732
DNA DNA DNA
bp bp bp bp bp bp bp bp
Gene
GenBanka
ermA ermF ermA ermSF ermQ ermGT ermTR ermA
L45536/42023 M14730 M11276 M19269 L22689 M64090 AF002716 K02987
*Not totally sequenced. a Accession number in GenBan.
[4]. Methylation will inhibit binding of erythromycin. Several erm genes have been sequenced and named. However, the names associated with the genes have not been chosen according to homology with previously published genes, thus creating confusing names. In this study a classi¢cation of the published genes based on sequence identity in the coding regions of the erm genes is presented. This classi¢cation was used to study the prevalence of selected erm gene classes by PCR in erythromycin resistant bacteria of animal and human origin in Denmark.
2. Materials and methods 2.1. Classi¢cation of erm gene classes Several erm genes have been deposited in GenBank (Table 1). Among the published sequences names are not consistent. Using the DNASIS software the published sequences were aligned according to percent identity in the coding region and using the maximum likelihood method a phylogenetic tree was created. The minimal percentage of identity for a gene to be placed in a class was set at 95% in the sequenced area of the coding open reading frame. 2.2. Bacterial isolates A total of 258 erythromycin resistant isolates were tested. Among these 61 were of human origin and 197 from animals. All 44 human isolates of Staphylococcus aureus were collected in 1996 in Denmark
from non-hospitalized patients. Isolates of several phage types were included indicating that these isolates were representatives of common S. aureus phage types of human origin found in Denmark. All S. aureus strains were susceptible to methicillin. All 16 human Enterococcus faecium isolates were isolated from faecal samples. The animal isolates originated from the DANMAP surveillance program [1] and therefore re£ect the number of isolates obtain from this project. They include 16 E. faecium isolates from broilers, 35 E. faecium, 36 E. faecalis and 16 S. hyicus isolates from pigs and eight staphylococcal (two S. aureus and six coagulase negative staphylococci) and nine enterococcal isolates (¢ve E. faecium and four E. faecalis) from cattle. Furthermore, 77 Streptococcus suis isolates from a strain collection of diagnostic samples from pigs obtained from 1991 to 1996 were included. 2.3. PCR ampli¢cation of the erm genes DNA extractions and PCR ampli¢cation were performed according to Jensen et al. [13]. From all isolates two single colonies were picked for isolation of total DNA and PCR performed. Strains were only considered positive if both ampli¢cations were positive. If a positive and negative ampli¢cation was obtained two new single colonies were picked and a second round of ampli¢cation was performed. All PCR ampli¢cations were run with a MgCl2 concentration of 1 mM. Primers were designed according to the published sequences and the classes for the erm genes de¢ned
FEMSLE 8535 23-12-98
154
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
Table 2 Sequence, position, class and reference for PCR primers used in this study Name
Sequence (5P^3P)
Position
Tn554-2 Tn544-1 ermB-1 ermB-2 ermC-1 ermC-2
TCAAAGCCTGTCGGAATTGG AAGCGGTAAACCCCTCTGAG CATTTAACGACGAAACTGGC GGAACATCTGTGGTATGGCG ATCTTTGAAATCGGCTCAGG CAAACCCGTATTCCACGATT
4634^4653 5074^5055 836^855 1260^1241 2639^2620 2345^2364
Class
Reference
IV IV VI VI
K02987 K02987 M11180 M11180 J01755 J01755
All primers used for PCR ampli¢cation were designed inside the coding regions. All numbers indicated refer to the sequences published in GenBank. The access numbers are: K02987 for the Tn554 containing ermA, M11180 for the Tn917 containing ermB and J01755 for pE194 for ermC.
in this work (see Section 3 and Table 1). All designed primers were tested for their speci¢city on several published strains (Table 2). For the ermA (Tn554) [14] gene the sequence for Tn554 was chosen for design of primer. For ermB (class IV) the sequence from Tn917 [15] was chosen and for ermC (class VI) the sequence from pE194 was chosen. The sequences of all primers and position on selected genes from the two classes and ermA (Tn554) are listed in Table 2. The primers were veri¢ed using strains listed in Table 3. The Tm values for the individual primers were calculated using the Tm DE-
TERMINATION [16] available on INTERNET (http://alces.med.umn.edu/rawtm.html). 2.4. Sequencing The nucleotide sequence of the ampli¢cation products was determined by cycle sequencing [17] using AmplitaqFS dye terminator kit and a 373A automatic sequencer (Applied Biosystems/Perkin Elmer, Foster City, CA, USA). The DNASIS software (Hitachi Software Engineering Co., Ltd) was used for sequence analysis.
Table 3 Reference strains for erm genes Origin
Bacterium
Gene
Class
Reference
Tn554 1206 RN1389 ermE, class 0
S. aureus S. aureus : :Tn554
ermA ermA
Tn554 Tn554
[24] Dr. Courvalin, personal communication
S. lividans/pIJ702+ermE E. coli/pIJ4026
ermE ermE
0 0
[25] Dr. Vester, personal communication
E. B. E. S. E. E. B.
coli DH5K/pJIR599 subtilis/pAM77 faecalis : :Tn1545 lentus coli/pSES20 faecalis : :Tn5384 subtilus/pAM77
ermBP ermAM ermB ermB ermB ermB ermB
IV IV IV IV IV IV IV
[26] [27] [28] [11] [29] [30] [27]
B. B. S. E. L.
subtilis/pE194 subtilis/pE194 aureus : :pSES5 coli/pKH80 reuteri/pGT633
ermC ermC ermC ermC ermGT
VI VI VI VI VI
[31] Dr. Courvalin, personal communication [11] [32] [33]
ermB, class IV JIR2220 JH2-2 JM107 CH116 BR-151 ermC, class VI B.3HU104 RN4220 HB101 ermQ JIR2879
E. coli DH5K/pJIR1120
ermQ
[26]
FEMSLE 8535 23-12-98
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
155
Fig. 1. Phylogenetic tree of erm genes. The phylogenetic tree was created by the maximum likelihood method. Only fully sequenced genes are included in the tree and GenBank numbers and gene classes in parentheses are listed. For genes and organisms see Table 1.
FEMSLE 8535 23-12-98
156
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
a selected number of amplicons was sequenced to verify that the correct target had been ampli¢ed (data not shown). Four isolates, three S. aureus of human origin and one E. faecium from a pig, contained more than one gene for macrolide resistance. The ermB (class IV) was the most common class found among enterococci (88%) and streptococci (90%). No amplicons of any size was obtained for ermA (Tn554) in enterococci and streptococci and only one E. faecium of animal origin contained the ermC (class VI). Among human S. aureus both ermA (Tn554) (23%) and ermC (VI) (82%) were found. In staphylococci isolated from animals ermA (Tn554) (5%) and ermC (VI) (63%) were found. No signi¢cant difference in prevalence of these genes in staphylococci of animal (24 isolates) and human (44 isolates) origin could be detected. The ermB (class IV) was not found in staphylococci.
3. Results 3.1. Classi¢cation of erm gene classes On the basis of aligning the published sequences the erm genes were grouped into seven classes and some unique genes (Table 1). Class 0 contained genes from erythromycin producing strains while the remaining classes contained acquired genes for macrolide resistance in bacteria. Using the maximum likelihood method a phylogenetic tree was created verifying the de¢ned classes (Fig. 1). The class number was assigned according to the length of the coding region and not due to the number of sequenced genes. 3.2. Prevalence of selected erm genes among bacterial isolates of human and animal origin All designed primers were tested on several reference strains (Table 2). Positive amplicons were only obtained from the reference strains containing the corresponding genes. No cross reaction towards other genes were seen. This is to our knowledge the ¢rst time so many reference strains have been used to check the speci¢city of designed primers. The results of PCR ampli¢cation for selected gene classes in the tested isolates are given in Table 4. Using PCR the presence of at least one of the three genes were found in 88% of the isolates. For all strains amplicons of correct size was obtained and
4. Discussion In this study a re-classi¢cation of the erm genes was suggested and the prevalence of selected erm gene classes in bacteria of animal and human origin was detected by use of PCR. On the basis of the reclassi¢cation the ¢rst published sequence for ermA (Tn554) does not belong to class III in which two other genes named ermA are placed. Especially for the ermA genes the published names are not consis-
Table 4 Prevalence of selected erm genes in enterococci, streptococci and staphylococci of animal and human origin in Denmark Humans
Bacteria
S. aureus
n= 44 ermA 10* ermB, IV 0 ermC, VI 36* N.D. 1
Animals
Total
Broilers
Cattle
Pigs
E. faecium
E. faecium
staphylococcia
enterococcib
S. suis
E. faecalis
E. faecium
S. hyicus
17 0 17 0 0
16 0 15 0 1
8 0 0 3 5
9 0 8 0 1
77 0 69 0 8
36 0 31 0 5
35 0 28* 1* 7
16 1 0 12 3
258 11 168 52 31
All numbers indicate a positive amplicon of correct size. n=number of isolates tested, N.D.=number of isolates where the genetic background was not determined. *Since four isolates contained more than one erythromycin resistance gene the total number of positive reactions will be greater than the number of isolates. a Two S. aureus and six coagulase negative staphylococci. b Five E. faecium and four E. faecalis.
FEMSLE 8535 23-12-98
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
tent with the classes proposed in this study. In the phylogenetic tree the ermA (Tn554) was grouped together with the ermTR from Streptococcus pyogenes. These two sequences were 82% homologous in the coding region and were for that reason not de¢ned as a class. Several genes belonging to class IV are named ermAM and in many cases almost identical genes are called ermB. We propose that the published names are kept but that additional to these the class to which the gene belongs should be de¢ned and noted after the name. As an example Tn917 contain the ermB (class IV) gene. The presence of two classes of genes as well as the ermA (Tn554) was tested among selected erythromycin resistant isolates. By limiting the detection to two classes of genes and the Tn554 at least one of these genes was found in 88% of the tested isolates. In the remaining 11 percent the genotype was not determined but genes of other erm classes or other mechanism for erythromycin resistance could be present. ermA (Tn554) was found in staphylococci predominantly isolated from humans in accordance with previously published studies [18]. ermB (class IV) dominated among enterococci and streptococci as found in previously studies [10,19,20,11,21,4,18]. ermC (VI) dominated among staphylococci of human and animal origin [10,18]. In the study di¡erences in the prevalence of erm gene classes in enterococci/streptococci and staphylococci were observed. For di¡erent staphylococci and for enterococci and streptococci identical erm gene classes were observed. S. pyogenes and S. pneumoniae of human origin have previously been found to harbor ermB (class IV) [22,20,23,8] and transfer of genes between enterococci and S. suis of animal origin to these bacteria could take place. However, in Denmark the frequency of macrolide resistance among these bacteria is low, making it di¤cult to obtain resistant isolates. Identical genes in di¡erent bacteria can be a result of horizontal transfer but could also indicate a common reservoir for resistance or evolution from the same ancestor. Proof of horizontal transfer would be the presence of identical mobile DNA elements in di¡erent bacterial species of human and animal origin. Further studies of the position and the mobility of the di¡erent erm genes are needed to deter-
157
mine whether horizontal transfer takes place. Such studies are ongoing at present.
Acknowledgments We would like to acknowledge the following persons for their technical assistance: Reneè Hendriksen, Mette Juul, Lissie Kj×r Jensen, Karina Kristensen, Inge Hansen, Dorthe Nielsen, Anne Lykkegaard Lauritsen and Christina Aaby Svendsen. Special thanks to Flemming Bager, DVL for creating lists of resistant bacteria from the DANMAP database, Thomas D. Leser for creating the phylogenetic tree and Birte Vester, Copenhagen University, Knud BÖrge Pedersen, Anders Meyling and Henrik C. Wegener, DVL, for helpful comments in the preparation of the manuscript.
References [1] Aarestrup, F.M., Bager, F., Jensen, N.E., Madsen, M., Meyling, A. and Wegener, H.C. (1998) Surveillance of antimicrobial resistance in bacteria isolated from food animals to antimicrobial growth promoters and related therapeutic agents in Denmark. APMIS 106, 606^622. [2] Aarestrup, F.M., Jorsal, S.E. and Jensen, N.E. (1998) Serological characterization and antimicrobial susceptibility of Streptococcus suis isolates from diagnostic samples in Denmark during 1995 and 1996. Vet. Microbiol. 60, 59^66. [3] Clermont, D. and Horaud, T. (1990) Identi¢cation of chromosomal antibiotic resistance genes in Streptococcus anginosus (`S. milleri'). Antimicrob. Agents Chemother. 34, 1685^1690. [4] Weisblum, B. (1995) Erythromycin resistance by ribosome modi¢cation. Antimicrob. Agents Chemother. 39, 577^585. [5] Barthelemy, P., Autissier, D., Gerbaud, G. and Courvallin, P. (1984) Enzymic hydrolysis of erythromycin by a strain of Escherichia coli. J. Antibiot. 37, 1692^1696. [6] Clancy, J., Petitpas, J., Dib-Hajj, F., Yuan, W., Cronan, M., Kamath, A.V., Bergeron, J. and Retsema, J.A. (1996) Molecular cloning and functional analysis of a novel macrolide-resistance determinant, mefA, from Streptococcus pyogenes. Mol. Microbiol. 22(5), 867^879. [7] Sutcli¡e, J., Grebe, T., Tait-Kamradt, A. and Wondrack, L. (1996) Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40, 2562- 2566. [8] Sutcli¡e, J., Tait-Kamradt, A. and Wondrack, L. (1996) Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin : a common resistance pattern mediated by an e¥ux system. Antimicrob. Agents Chemother. 40, 1817^1824. [9] Dutta, G.N. and Devriese, L.A. (1982) Resistance to macro-
FEMSLE 8535 23-12-98
158
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158 lide-lincosamide-streptogramin antibiotics in enterococci from the intestine of animals. Res. Vet. Sci. 33, 70^72. Eady, A.E., Ross, J.I., Tipper, J.L., Walters, C.E., Cove, J.H. and Noble, W.C. (1993) Distribution of genes encoding erythromycin ribosomal methylases and an erythromycin e¥ux pump in epidemiologically distinct groups of staphylococci. J. Antimicrob. Chemother. 31, 211^217. Lodder, G., Werckenthin, C., Schwarz, S. and Dyke, K. (1997) Molecular analysis of naturally occurring ermC-encoding plasmids in staphylococci isolated from animals with and without previous contact with macrolide/lincosamide antibiotics. FEMS Immunol. Med. Microbiol. 18, 7^15. Rollins, L.D., Lee, L.N. and LeBlanc, D.J. (1985) Evidence for disseminated erythromycin resistance determinant mediated by Tn917-like sequences among group D streptococci isolates from pigs, chickens and humans. Antimicrob. Agents Chemother. 27, 439^444. Jensen, L.B., Ahrens, P., Dons, L., Jones, R.N., Hammerum, A.M. and Aarestrup, F.M. (1998) Molecular analysis of the Tn1546 in Enterococcus faecium isolated from animals and humans. J. Clin. Microbiol. 36, 437^442. Murphy, E., Huwyler, L. and do Carmo de Freire Bastos, M. (1985) Transposon Tn554: complete sequence and isolation of transposition-defective and antibiotic-sensitive mutants. EMBO J. 4, 3357^3365. Shaw, J.H. and Clewell, D.B. (1985) Complete sequence of the macrolide-lincosamide-streptogramin B-resistance transposon Tn917 in Streptococcus faecalis. Antimicrob. Agents Chemother. 164, 782^796. Breslauer, K.J., Frank, R., Bloëcket, H. and Marky, L.A. (1986) Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. USA 83, 3746^3750. Sears, L.E., Moran, L.S., Kissinger, C. and Slatko, B.E. (1992) Thermal cycle sequencing and alternative sequencing protocols using the highly thermostable Vent0 (exo) DNA polymerase. Biotechniques 13, 626^683. Westh, H., Hougaard, D.M., Vuust, J. and Rosdahl, V.T. (1995) Prevalence of erm gene classes in erythromycin-resistant Staphylococcus aureus strains isolated between 1959 and 1988. Antimicrob. Agents Chemother. 39, 369^373. Jenssen, W.D., Thakker-Varia, S., Dubin, D.T. and Weinstein, M.P. (1987) Prevalence of macrolide-lincosamide-streptogramin B resistance and erm gene classes among clinical strains of staphylococci and streptococci. Antimicrob. Agents Chemother. 31, 883^888. Leclercq, R. and Courvalin, P. (1991) Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modi¢cation. Antimicrob. Agents Chemother. 35, 1267^ 1272. Thakker-Varia, S., Jenssen, W.D., Moon-McDermott, L., Weinstein, M.P. and Dubin, D.T. (1987) Molecular epidemi-
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
ology of macrolide-lincosamide-streptogramin B resistance in Staphylococcus aureus and coagulase-negative staphylococci. Antimicrob. Agents Chemother. 31, 735^743. Cornaglia, G., Ligozzi, M., Mazzariol, A., Valentini, M., Ore¢ci, G., Italian Surveillance group for antimicrobial resistance and Fontana, R. (1996) Rapid increase of resistance to erythromycin and clindamycin in Streptococcus pyogenes in Italy 1993- 1995. Emerging Infect. Dis. 2, 339^342. Schalen, C., Gebreselassie, D. and Staîhl, S. (1995) Characterization of an erythromycin resistance (erm) plasmid in Streptococcus pyogenes. APMIS 103, 59^68. Weisblum, B. and Demohn, V. (1969) Erythromycin-inducible resistance in Staphylococcus aureus : survey of antibiotic classes involved. J. Bacteriol. 98, 447^452. Pernodet, J.-L., Fish, S., Blondelet-Rouault, M.-H. and Cundli¡e, E. (1996) The macrolide-lincosamide-streptogramin B resistance phenotypes characterized by using speci¢cally deleted, antibiotic-sensitive strains of Streptomyces lividans. Antimicrob. Agents Chemother. 40, 581^585. Berrymann, D.I., Lysristis, M. and Rood, J.I. (1994) Cloning and sequence analysis of ermQ, the predominant macrolidelincosamide-streptogramin B resistance gene in Clostridium perfringens. Antimicrobial. Agents Chemother. 38, 1041^1046. Horinouchi, S., Byeon, W.-H. and Weisblum, B. (1983) A complex attenuator regulates inducible resistance to macrolides, lincosamides, and streptogramin type B antibiotics in Streptococcus sanguis. J. Bacteriol. 154, 1252^1262. Courvalin, P. and Carlier, C. (1986) Transposable multiple antibiotic resistance in Streptococcus pneumoniae. Mol. Gen. Genet. 205, 291^297. Werckenthin, C., Schwarz, S. and Dyke, K. (1996) Macrolidelincosamide-streptogramin B resistance in Staphylococcus lentus results from the integration of part of a transposon into a small plasmid. Antimicrob. Agents Chemother. 40, 2224^2225. Rice, L.B., Carias, L.L., Marshall, S.H. and Bonafede, M.E. (1996) Sequences found on staphylococcal beta-lactamase plasmids integrated into the chromosome of Enterococcus faecalis CH116. Plasmid 35, 81^90. Gryczan T.J., Grandi, G., Hahn, J., Grandi, R. and Dubnau, D. (1980) Conformational alteration of mRNA structure and the posttranscriptional regulation of erythromycin induced drug resistance. Nucleic Acids Res. 8, 6081^6097. Hardy, K. and Haefali, C. (1982) Expression of Escherichia coli of a staphylococcal gene for resistance to macrolide, lincosamide and streptogramin type B antibiotics. J. Bacteriol. 152, 524^526. Tannock, G.W., Luchansky, J.B., Miller, L., Connell, H., Thode-Andersen, S., Mercer, A.A. and Klaenhammer, T.R. (1994) Molecular characterization of a plasmid-borne (pGT633) erythromycin resistance determinant (ermGT) from Lactobacillus reuteri 100^63. Plasmid 31, 60^71.
FEMSLE 8535 23-12-98
Presence of erm gene classes in Gram-positive bacteria of animal and human origin in Denmark Lars BogÖ Jensen a; *, Niels Frimodt-MÖller b , Frank M. Aarestrup b
a
a Danish Veterinary Laboratory, Buëlowsvej 27, DK-1790 Copenhagen V, Denmark Department of Clinical Microbiology, Statens Serum Institut, Artillerivej 5, DK-2300 Copenhagen S, Denmark
Received 10 July 1998; received in revised form 1 October 1998; accepted 26 October 1998
Abstract A classification of the different erm gene classes based on published sequences was performed, and specific primers to detect some of these classes designed. The presence of ermA (Tn554), ermB (class IV) and ermC (class VI) was determined by PCR in a total of 113 enterococcal, 77 streptococcal and 68 staphylococcal erythromycin resistant isolates of animal and human origin. At least one of these genes was detected in 88% of the isolates. Four isolates contained more than one erm gene. ermB dominated among the enterococci (88%) and streptococci (90%) and ermC among staphylococci (75%) with ermA (Tn554) present in some isolates (16%). Variations in the presence of the different genes when comparing staphylococcal isolates of human and animal origin were observed. z 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Erythromycin resistance; Animal ; erm gene classi¢cation
1. Introduction The macrolide tylosin is the most commonly used antimicrobial agent in pig production in Denmark. Recent national surveys have found widespread resistance to macrolides in staphylococci, streptococci and enterococci isolated from pigs in Denmark [1,2]. Macrolides are used for treatment of humans with erythromycin as ¢rst choice also as a substitute for penicillin in cases where patients are allergic to penicillin [3]. Resistance to macrolides is based on di¡erent mechanisms: target modi¢cation by point mutation * Corresponding author. Tel.: +45 35 30 01 00; Fax: +45 35 30 01 20; E-mail: [email protected]
or methylation of 23S rRNA inhibiting binding of macrolides so protein synthesis is not interfered with [4], hydrolysis of the lactone ring in the macrolide [5] and e¥ux pumps removing the antibiotic internally from the bacteria [6^8]. Resistance to macrolides can spread from animals to human, either by spread of the resistant bacteria or by horizontal gene transfer of mobile DNA elements. To determine whether a horizontal spread of resistance has occurred, a characterization of the mechanisms for resistance is needed. According to the published literature [9^12] the most frequently found macrolide resistance genes in bacterial isolates from animals and humans are the erm genes. These genes encode a methyltranferase that has speci¢c target residues in the 23S rRNA
0378-1097 / 99 / $19.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 8 ) 0 0 5 3 9 - 4
FEMSLE 8535 23-12-98
152
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
Table 1 erm genes published in GenBank Origin Class 0 (ermE group) S. erythraea S. erythraea Class I (ermDK group) B. anthracis B. licheniformis B. licheniformis Class II (ermF group) B. fragilis B. fragilis B. fragilis Class III (ermA2 group) C. xerosis C. diphtheriae C. diphtheriae C. diphthteriae Class IV (ermB group) L. fermentum S. pyogenes Enterococcus S. pyogenes E. faecalis S. lentus S. agalactiae C. perfringens E. coli E. hirae S. sanguis E. faecalis S. pneumoniae E. faecalis E. faecalis Class V (ermG group) E. faecalis B. sphaericus Class VI (ermC group) B. subtilis S. aureus S. aureus S. chromogenes S. simulans S. epidermidis S. aureus S. aureus S. aureus S. equorum S. hominis S. haemolyticus S. hyicus S. aureus S. aureus
Position
Size
Gene
GenBanka
Chromosomal DNA Chromosomal DNA
1257 bp 1113 bp
ermE ermE2
X51891 M11200 M11304
Chromosomal DNA Chromosomal DNA Chromosomal DNA
864 bp 864 bp 864 bp
ermJ ermD ermK
L08389 M29832 M77505
Conjugal element Tn4351 Tn4551
801 bp 801 bp 801 bp
ermFU ermF ermFS
M62487 M17124 M17808
Tn5432 pNG2 pSV5(pNG2) pNG2
762 855 762 762
bp bp bp bp
ermCX ermCd ermA ermA
U21300 M36726 X57320 X51472
pLEM3 pMD101 plasmid pBT233 not determined pSES20 pIP501 Chromosomal DNA pIP1527 not determined pAM77 Tn917 (pAD2) Tn1545 pAML1 pAML1
753 750 738 738 738 738 738 738 738 738 738 738 738 283 161
bp bp bp bp bp bp bp bp bp bp bp bp bp bp bp
erm erm erm2 erm2 ermB ermB erm ermBP ermBC ermAM ermAM ermB ermB ermAM* ermAM*
U48430 X66468 X82819 X64695 U86375 U35228 X72021 U18931 M19270 X81655 K00551 M11180 M36722 X52632 M20334 M20335
Tn7853 Chromosomal DNA
735 bp 735 bp
metht. ermG
L42817 M15332
pIM13 J3356: :POX7;1 J3356: :POX7;3 pPV141 pV142 pNE131 pE194 pE5 pT48 pSES6 pSES5 pSES4a pSES21 pRJ5 pA22
735 735 759 735 735 735 735 735 735 735 735 735 735 283 226
ermC ermC ermC ermM ermM ermM ermC ermC ermC ermC ermC ermC ermC ermC* ermC*
M13761 U36911 U36912 U82607 AF019140 M12730 J0175-8 M17990 M19652 X82668 Y09001 Y09002 Y09003 L04687 X54338
bp bp bp bp bp bp bp bp bp bp bp bp bp bp bp
FEMSLE 8535 23-12-98
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
153
Table 1 (continued). Origin
Position
Unique sequences H. in£uenzae B. fragilis Arthrobacter sp. S. fradiae C. perfringens Lactobacillus S. pyogenes S. aureus
Chromosomal pBF4 Chromosomal pSK101 Chromosomal pGT633 Chromosomal Tn554
Size DNA
1173 1035 1023 960 774 735 732 732
DNA DNA DNA
bp bp bp bp bp bp bp bp
Gene
GenBanka
ermA ermF ermA ermSF ermQ ermGT ermTR ermA
L45536/42023 M14730 M11276 M19269 L22689 M64090 AF002716 K02987
*Not totally sequenced. a Accession number in GenBan.
[4]. Methylation will inhibit binding of erythromycin. Several erm genes have been sequenced and named. However, the names associated with the genes have not been chosen according to homology with previously published genes, thus creating confusing names. In this study a classi¢cation of the published genes based on sequence identity in the coding regions of the erm genes is presented. This classi¢cation was used to study the prevalence of selected erm gene classes by PCR in erythromycin resistant bacteria of animal and human origin in Denmark.
2. Materials and methods 2.1. Classi¢cation of erm gene classes Several erm genes have been deposited in GenBank (Table 1). Among the published sequences names are not consistent. Using the DNASIS software the published sequences were aligned according to percent identity in the coding region and using the maximum likelihood method a phylogenetic tree was created. The minimal percentage of identity for a gene to be placed in a class was set at 95% in the sequenced area of the coding open reading frame. 2.2. Bacterial isolates A total of 258 erythromycin resistant isolates were tested. Among these 61 were of human origin and 197 from animals. All 44 human isolates of Staphylococcus aureus were collected in 1996 in Denmark
from non-hospitalized patients. Isolates of several phage types were included indicating that these isolates were representatives of common S. aureus phage types of human origin found in Denmark. All S. aureus strains were susceptible to methicillin. All 16 human Enterococcus faecium isolates were isolated from faecal samples. The animal isolates originated from the DANMAP surveillance program [1] and therefore re£ect the number of isolates obtain from this project. They include 16 E. faecium isolates from broilers, 35 E. faecium, 36 E. faecalis and 16 S. hyicus isolates from pigs and eight staphylococcal (two S. aureus and six coagulase negative staphylococci) and nine enterococcal isolates (¢ve E. faecium and four E. faecalis) from cattle. Furthermore, 77 Streptococcus suis isolates from a strain collection of diagnostic samples from pigs obtained from 1991 to 1996 were included. 2.3. PCR ampli¢cation of the erm genes DNA extractions and PCR ampli¢cation were performed according to Jensen et al. [13]. From all isolates two single colonies were picked for isolation of total DNA and PCR performed. Strains were only considered positive if both ampli¢cations were positive. If a positive and negative ampli¢cation was obtained two new single colonies were picked and a second round of ampli¢cation was performed. All PCR ampli¢cations were run with a MgCl2 concentration of 1 mM. Primers were designed according to the published sequences and the classes for the erm genes de¢ned
FEMSLE 8535 23-12-98
154
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
Table 2 Sequence, position, class and reference for PCR primers used in this study Name
Sequence (5P^3P)
Position
Tn554-2 Tn544-1 ermB-1 ermB-2 ermC-1 ermC-2
TCAAAGCCTGTCGGAATTGG AAGCGGTAAACCCCTCTGAG CATTTAACGACGAAACTGGC GGAACATCTGTGGTATGGCG ATCTTTGAAATCGGCTCAGG CAAACCCGTATTCCACGATT
4634^4653 5074^5055 836^855 1260^1241 2639^2620 2345^2364
Class
Reference
IV IV VI VI
K02987 K02987 M11180 M11180 J01755 J01755
All primers used for PCR ampli¢cation were designed inside the coding regions. All numbers indicated refer to the sequences published in GenBank. The access numbers are: K02987 for the Tn554 containing ermA, M11180 for the Tn917 containing ermB and J01755 for pE194 for ermC.
in this work (see Section 3 and Table 1). All designed primers were tested for their speci¢city on several published strains (Table 2). For the ermA (Tn554) [14] gene the sequence for Tn554 was chosen for design of primer. For ermB (class IV) the sequence from Tn917 [15] was chosen and for ermC (class VI) the sequence from pE194 was chosen. The sequences of all primers and position on selected genes from the two classes and ermA (Tn554) are listed in Table 2. The primers were veri¢ed using strains listed in Table 3. The Tm values for the individual primers were calculated using the Tm DE-
TERMINATION [16] available on INTERNET (http://alces.med.umn.edu/rawtm.html). 2.4. Sequencing The nucleotide sequence of the ampli¢cation products was determined by cycle sequencing [17] using AmplitaqFS dye terminator kit and a 373A automatic sequencer (Applied Biosystems/Perkin Elmer, Foster City, CA, USA). The DNASIS software (Hitachi Software Engineering Co., Ltd) was used for sequence analysis.
Table 3 Reference strains for erm genes Origin
Bacterium
Gene
Class
Reference
Tn554 1206 RN1389 ermE, class 0
S. aureus S. aureus : :Tn554
ermA ermA
Tn554 Tn554
[24] Dr. Courvalin, personal communication
S. lividans/pIJ702+ermE E. coli/pIJ4026
ermE ermE
0 0
[25] Dr. Vester, personal communication
E. B. E. S. E. E. B.
coli DH5K/pJIR599 subtilis/pAM77 faecalis : :Tn1545 lentus coli/pSES20 faecalis : :Tn5384 subtilus/pAM77
ermBP ermAM ermB ermB ermB ermB ermB
IV IV IV IV IV IV IV
[26] [27] [28] [11] [29] [30] [27]
B. B. S. E. L.
subtilis/pE194 subtilis/pE194 aureus : :pSES5 coli/pKH80 reuteri/pGT633
ermC ermC ermC ermC ermGT
VI VI VI VI VI
[31] Dr. Courvalin, personal communication [11] [32] [33]
ermB, class IV JIR2220 JH2-2 JM107 CH116 BR-151 ermC, class VI B.3HU104 RN4220 HB101 ermQ JIR2879
E. coli DH5K/pJIR1120
ermQ
[26]
FEMSLE 8535 23-12-98
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
155
Fig. 1. Phylogenetic tree of erm genes. The phylogenetic tree was created by the maximum likelihood method. Only fully sequenced genes are included in the tree and GenBank numbers and gene classes in parentheses are listed. For genes and organisms see Table 1.
FEMSLE 8535 23-12-98
156
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
a selected number of amplicons was sequenced to verify that the correct target had been ampli¢ed (data not shown). Four isolates, three S. aureus of human origin and one E. faecium from a pig, contained more than one gene for macrolide resistance. The ermB (class IV) was the most common class found among enterococci (88%) and streptococci (90%). No amplicons of any size was obtained for ermA (Tn554) in enterococci and streptococci and only one E. faecium of animal origin contained the ermC (class VI). Among human S. aureus both ermA (Tn554) (23%) and ermC (VI) (82%) were found. In staphylococci isolated from animals ermA (Tn554) (5%) and ermC (VI) (63%) were found. No signi¢cant difference in prevalence of these genes in staphylococci of animal (24 isolates) and human (44 isolates) origin could be detected. The ermB (class IV) was not found in staphylococci.
3. Results 3.1. Classi¢cation of erm gene classes On the basis of aligning the published sequences the erm genes were grouped into seven classes and some unique genes (Table 1). Class 0 contained genes from erythromycin producing strains while the remaining classes contained acquired genes for macrolide resistance in bacteria. Using the maximum likelihood method a phylogenetic tree was created verifying the de¢ned classes (Fig. 1). The class number was assigned according to the length of the coding region and not due to the number of sequenced genes. 3.2. Prevalence of selected erm genes among bacterial isolates of human and animal origin All designed primers were tested on several reference strains (Table 2). Positive amplicons were only obtained from the reference strains containing the corresponding genes. No cross reaction towards other genes were seen. This is to our knowledge the ¢rst time so many reference strains have been used to check the speci¢city of designed primers. The results of PCR ampli¢cation for selected gene classes in the tested isolates are given in Table 4. Using PCR the presence of at least one of the three genes were found in 88% of the isolates. For all strains amplicons of correct size was obtained and
4. Discussion In this study a re-classi¢cation of the erm genes was suggested and the prevalence of selected erm gene classes in bacteria of animal and human origin was detected by use of PCR. On the basis of the reclassi¢cation the ¢rst published sequence for ermA (Tn554) does not belong to class III in which two other genes named ermA are placed. Especially for the ermA genes the published names are not consis-
Table 4 Prevalence of selected erm genes in enterococci, streptococci and staphylococci of animal and human origin in Denmark Humans
Bacteria
S. aureus
n= 44 ermA 10* ermB, IV 0 ermC, VI 36* N.D. 1
Animals
Total
Broilers
Cattle
Pigs
E. faecium
E. faecium
staphylococcia
enterococcib
S. suis
E. faecalis
E. faecium
S. hyicus
17 0 17 0 0
16 0 15 0 1
8 0 0 3 5
9 0 8 0 1
77 0 69 0 8
36 0 31 0 5
35 0 28* 1* 7
16 1 0 12 3
258 11 168 52 31
All numbers indicate a positive amplicon of correct size. n=number of isolates tested, N.D.=number of isolates where the genetic background was not determined. *Since four isolates contained more than one erythromycin resistance gene the total number of positive reactions will be greater than the number of isolates. a Two S. aureus and six coagulase negative staphylococci. b Five E. faecium and four E. faecalis.
FEMSLE 8535 23-12-98
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158
tent with the classes proposed in this study. In the phylogenetic tree the ermA (Tn554) was grouped together with the ermTR from Streptococcus pyogenes. These two sequences were 82% homologous in the coding region and were for that reason not de¢ned as a class. Several genes belonging to class IV are named ermAM and in many cases almost identical genes are called ermB. We propose that the published names are kept but that additional to these the class to which the gene belongs should be de¢ned and noted after the name. As an example Tn917 contain the ermB (class IV) gene. The presence of two classes of genes as well as the ermA (Tn554) was tested among selected erythromycin resistant isolates. By limiting the detection to two classes of genes and the Tn554 at least one of these genes was found in 88% of the tested isolates. In the remaining 11 percent the genotype was not determined but genes of other erm classes or other mechanism for erythromycin resistance could be present. ermA (Tn554) was found in staphylococci predominantly isolated from humans in accordance with previously published studies [18]. ermB (class IV) dominated among enterococci and streptococci as found in previously studies [10,19,20,11,21,4,18]. ermC (VI) dominated among staphylococci of human and animal origin [10,18]. In the study di¡erences in the prevalence of erm gene classes in enterococci/streptococci and staphylococci were observed. For di¡erent staphylococci and for enterococci and streptococci identical erm gene classes were observed. S. pyogenes and S. pneumoniae of human origin have previously been found to harbor ermB (class IV) [22,20,23,8] and transfer of genes between enterococci and S. suis of animal origin to these bacteria could take place. However, in Denmark the frequency of macrolide resistance among these bacteria is low, making it di¤cult to obtain resistant isolates. Identical genes in di¡erent bacteria can be a result of horizontal transfer but could also indicate a common reservoir for resistance or evolution from the same ancestor. Proof of horizontal transfer would be the presence of identical mobile DNA elements in di¡erent bacterial species of human and animal origin. Further studies of the position and the mobility of the di¡erent erm genes are needed to deter-
157
mine whether horizontal transfer takes place. Such studies are ongoing at present.
Acknowledgments We would like to acknowledge the following persons for their technical assistance: Reneè Hendriksen, Mette Juul, Lissie Kj×r Jensen, Karina Kristensen, Inge Hansen, Dorthe Nielsen, Anne Lykkegaard Lauritsen and Christina Aaby Svendsen. Special thanks to Flemming Bager, DVL for creating lists of resistant bacteria from the DANMAP database, Thomas D. Leser for creating the phylogenetic tree and Birte Vester, Copenhagen University, Knud BÖrge Pedersen, Anders Meyling and Henrik C. Wegener, DVL, for helpful comments in the preparation of the manuscript.
References [1] Aarestrup, F.M., Bager, F., Jensen, N.E., Madsen, M., Meyling, A. and Wegener, H.C. (1998) Surveillance of antimicrobial resistance in bacteria isolated from food animals to antimicrobial growth promoters and related therapeutic agents in Denmark. APMIS 106, 606^622. [2] Aarestrup, F.M., Jorsal, S.E. and Jensen, N.E. (1998) Serological characterization and antimicrobial susceptibility of Streptococcus suis isolates from diagnostic samples in Denmark during 1995 and 1996. Vet. Microbiol. 60, 59^66. [3] Clermont, D. and Horaud, T. (1990) Identi¢cation of chromosomal antibiotic resistance genes in Streptococcus anginosus (`S. milleri'). Antimicrob. Agents Chemother. 34, 1685^1690. [4] Weisblum, B. (1995) Erythromycin resistance by ribosome modi¢cation. Antimicrob. Agents Chemother. 39, 577^585. [5] Barthelemy, P., Autissier, D., Gerbaud, G. and Courvallin, P. (1984) Enzymic hydrolysis of erythromycin by a strain of Escherichia coli. J. Antibiot. 37, 1692^1696. [6] Clancy, J., Petitpas, J., Dib-Hajj, F., Yuan, W., Cronan, M., Kamath, A.V., Bergeron, J. and Retsema, J.A. (1996) Molecular cloning and functional analysis of a novel macrolide-resistance determinant, mefA, from Streptococcus pyogenes. Mol. Microbiol. 22(5), 867^879. [7] Sutcli¡e, J., Grebe, T., Tait-Kamradt, A. and Wondrack, L. (1996) Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40, 2562- 2566. [8] Sutcli¡e, J., Tait-Kamradt, A. and Wondrack, L. (1996) Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin : a common resistance pattern mediated by an e¥ux system. Antimicrob. Agents Chemother. 40, 1817^1824. [9] Dutta, G.N. and Devriese, L.A. (1982) Resistance to macro-
FEMSLE 8535 23-12-98
158
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
L.B. Jensen et al. / FEMS Microbiology Letters 170 (1999) 151^158 lide-lincosamide-streptogramin antibiotics in enterococci from the intestine of animals. Res. Vet. Sci. 33, 70^72. Eady, A.E., Ross, J.I., Tipper, J.L., Walters, C.E., Cove, J.H. and Noble, W.C. (1993) Distribution of genes encoding erythromycin ribosomal methylases and an erythromycin e¥ux pump in epidemiologically distinct groups of staphylococci. J. Antimicrob. Chemother. 31, 211^217. Lodder, G., Werckenthin, C., Schwarz, S. and Dyke, K. (1997) Molecular analysis of naturally occurring ermC-encoding plasmids in staphylococci isolated from animals with and without previous contact with macrolide/lincosamide antibiotics. FEMS Immunol. Med. Microbiol. 18, 7^15. Rollins, L.D., Lee, L.N. and LeBlanc, D.J. (1985) Evidence for disseminated erythromycin resistance determinant mediated by Tn917-like sequences among group D streptococci isolates from pigs, chickens and humans. Antimicrob. Agents Chemother. 27, 439^444. Jensen, L.B., Ahrens, P., Dons, L., Jones, R.N., Hammerum, A.M. and Aarestrup, F.M. (1998) Molecular analysis of the Tn1546 in Enterococcus faecium isolated from animals and humans. J. Clin. Microbiol. 36, 437^442. Murphy, E., Huwyler, L. and do Carmo de Freire Bastos, M. (1985) Transposon Tn554: complete sequence and isolation of transposition-defective and antibiotic-sensitive mutants. EMBO J. 4, 3357^3365. Shaw, J.H. and Clewell, D.B. (1985) Complete sequence of the macrolide-lincosamide-streptogramin B-resistance transposon Tn917 in Streptococcus faecalis. Antimicrob. Agents Chemother. 164, 782^796. Breslauer, K.J., Frank, R., Bloëcket, H. and Marky, L.A. (1986) Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. USA 83, 3746^3750. Sears, L.E., Moran, L.S., Kissinger, C. and Slatko, B.E. (1992) Thermal cycle sequencing and alternative sequencing protocols using the highly thermostable Vent0 (exo) DNA polymerase. Biotechniques 13, 626^683. Westh, H., Hougaard, D.M., Vuust, J. and Rosdahl, V.T. (1995) Prevalence of erm gene classes in erythromycin-resistant Staphylococcus aureus strains isolated between 1959 and 1988. Antimicrob. Agents Chemother. 39, 369^373. Jenssen, W.D., Thakker-Varia, S., Dubin, D.T. and Weinstein, M.P. (1987) Prevalence of macrolide-lincosamide-streptogramin B resistance and erm gene classes among clinical strains of staphylococci and streptococci. Antimicrob. Agents Chemother. 31, 883^888. Leclercq, R. and Courvalin, P. (1991) Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modi¢cation. Antimicrob. Agents Chemother. 35, 1267^ 1272. Thakker-Varia, S., Jenssen, W.D., Moon-McDermott, L., Weinstein, M.P. and Dubin, D.T. (1987) Molecular epidemi-
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
ology of macrolide-lincosamide-streptogramin B resistance in Staphylococcus aureus and coagulase-negative staphylococci. Antimicrob. Agents Chemother. 31, 735^743. Cornaglia, G., Ligozzi, M., Mazzariol, A., Valentini, M., Ore¢ci, G., Italian Surveillance group for antimicrobial resistance and Fontana, R. (1996) Rapid increase of resistance to erythromycin and clindamycin in Streptococcus pyogenes in Italy 1993- 1995. Emerging Infect. Dis. 2, 339^342. Schalen, C., Gebreselassie, D. and Staîhl, S. (1995) Characterization of an erythromycin resistance (erm) plasmid in Streptococcus pyogenes. APMIS 103, 59^68. Weisblum, B. and Demohn, V. (1969) Erythromycin-inducible resistance in Staphylococcus aureus : survey of antibiotic classes involved. J. Bacteriol. 98, 447^452. Pernodet, J.-L., Fish, S., Blondelet-Rouault, M.-H. and Cundli¡e, E. (1996) The macrolide-lincosamide-streptogramin B resistance phenotypes characterized by using speci¢cally deleted, antibiotic-sensitive strains of Streptomyces lividans. Antimicrob. Agents Chemother. 40, 581^585. Berrymann, D.I., Lysristis, M. and Rood, J.I. (1994) Cloning and sequence analysis of ermQ, the predominant macrolidelincosamide-streptogramin B resistance gene in Clostridium perfringens. Antimicrobial. Agents Chemother. 38, 1041^1046. Horinouchi, S., Byeon, W.-H. and Weisblum, B. (1983) A complex attenuator regulates inducible resistance to macrolides, lincosamides, and streptogramin type B antibiotics in Streptococcus sanguis. J. Bacteriol. 154, 1252^1262. Courvalin, P. and Carlier, C. (1986) Transposable multiple antibiotic resistance in Streptococcus pneumoniae. Mol. Gen. Genet. 205, 291^297. Werckenthin, C., Schwarz, S. and Dyke, K. (1996) Macrolidelincosamide-streptogramin B resistance in Staphylococcus lentus results from the integration of part of a transposon into a small plasmid. Antimicrob. Agents Chemother. 40, 2224^2225. Rice, L.B., Carias, L.L., Marshall, S.H. and Bonafede, M.E. (1996) Sequences found on staphylococcal beta-lactamase plasmids integrated into the chromosome of Enterococcus faecalis CH116. Plasmid 35, 81^90. Gryczan T.J., Grandi, G., Hahn, J., Grandi, R. and Dubnau, D. (1980) Conformational alteration of mRNA structure and the posttranscriptional regulation of erythromycin induced drug resistance. Nucleic Acids Res. 8, 6081^6097. Hardy, K. and Haefali, C. (1982) Expression of Escherichia coli of a staphylococcal gene for resistance to macrolide, lincosamide and streptogramin type B antibiotics. J. Bacteriol. 152, 524^526. Tannock, G.W., Luchansky, J.B., Miller, L., Connell, H., Thode-Andersen, S., Mercer, A.A. and Klaenhammer, T.R. (1994) Molecular characterization of a plasmid-borne (pGT633) erythromycin resistance determinant (ermGT) from Lactobacillus reuteri 100^63. Plasmid 31, 60^71.
FEMSLE 8535 23-12-98