Pretreatment of non-sterile, rotted silage maize straw by the microbial community MC1 increases biogas production

Bioresource Technology 216 (2016) 699–705

Contents lists available at ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Pretreatment of non-sterile, rotted silage maize straw by the microbial community MC1 increases biogas production Binbin Hua, Jiali Dai, Bin Liu, Huan Zhang, Xufeng Yuan, Xiaofen Wang ⇑, Zongjun Cui Center of Biomass Engineering, College of Agronomy and Biotechnology, China Agricultural University, No. 2 Yuanmingyuan West Road, Haidian District, Beijing 100193, PR China

h i g h l i g h t s
Effect of microbial pretreatment on biogas production of non-sterile, rotted silage maize straw was evaluated.
Microbial community maintained structure and functional stability in non-sterile condition.
Biogas production yields significantly increased after microbial pretreatment.

a r t i c l e

i n f o

Article history: Received 30 April 2016 Received in revised form 31 May 2016 Accepted 1 June 2016 Available online 2 June 2016 Keywords: Biogas Microbial community MC1 Non-sterile Pretreatment Rotted silage maize straw

a b s t r a c t Using microbial community MC1 to pretreat lignocellulosic materials increased the yield of biogas production, and the substrate did not need to be sterilized, lowering the cost. Rotted silage maize straw carries many microbes. To determine whether such contamination affects MC1, rotted silage maize straw was pretreated with MC1 prior to biogas production. The decreases in the weights of unsterilized and sterilized rotted silage maize straw were similar, as were their carboxymethyl cellulase activities. After 5 d pretreatment, denaturing gradient gel electrophoresis and quantitative polymerase chain reaction results indicated that the proportions of five key strains in MC1 were the same in the unsterilized and sterilized groups; thus, MC1 was resistant to microbial contamination. However, its resistance to contamination decreased as the degradation time increased. Following pretreatment, volatile fatty acids, especially acetic acid, were detected, and MC1 enhanced biogas yields by 74.7% compared with the untreated group. Ó 2016 Published by Elsevier Ltd.

1. Introduction Lignocellulosic biomass has many characteristics—such as lignin content, cellulose crystallinity, and particle size—that limit its digestibility during anaerobic hydrolysis and, consequently, the amount of methane production (Zheng et al., 2014). Pretreatment can be performed to improve the hydrolysis and total methane yields. Previous studies have examined different pretreatment methods for enhancing the digestibility of lignocellulosic material. Among these, biological pretreatment that uses microorganisms to digest the cell walls of plant biomass is a promising technology because it has low energy requirements and is environmentally friendly (Agbor et al., 2011; Zheng et al., 2014). Use of microbial co-cultures or complex communities has been proposed as a highly efficient approach for biotechnological applications, as it avoids the problems of feedback regulation and

⇑ Corresponding author. E-mail address: [email protected] (X. Wang). http://dx.doi.org/10.1016/j.biortech.2016.06.001 0960-8524/Ó 2016 Published by Elsevier Ltd.

metabolite repression associated with the use of isolated single strains (Haruta et al., 2002). Using a microbial composite system for pretreatment is advantageous for large-scale biomass production because, in most cases, the sterilization of lignocellulosic feedstocks is unnecessary (Bruni et al., 2010; Lu et al., 2009; Zheng et al., 2014), which could lower costs and save time. A microbial community (MC1) was constructed by a succession of enrichment cultures from compost. MC1 is capable of effectively degrading various cellulosic materials (e.g., filter paper, cotton, and rice straw) under static, aerobic conditions (Haruta et al., 2002; Kato et al., 2004a). As reported previously (Kato et al., 2005), five strains (CSK-1, FG4, M1-3, M1-5, M1-6) were found to be the dominant bacteria in MC1. MC1 was used to pretreat cellulosic materials for methane production and after pretreatment, biogas production yields and rates increased substantially (Wen et al., 2014; Yuan et al., 2014, 2016). This bacterial community degraded natural cellulosic materials without prior sterilization, and it was highly stable (cellulose-degrading efficiency and composition of

700

B. Hua et al. / Bioresource Technology 216 (2016) 699–705

bacteria did not change after more than 20 subcultures; Kato et al., 2004b). In full-scale anaerobic digestion plants, feedstock storage is a primary objective (Carrere et al., 2016). Ensiling is a common means of preserving crops for use in biogas production (Weiland, 2010) and is a suitable approach for ensuring that anaerobic digestion is a continuous process. Maize silage has been widely used in Germany, Austria, and the Czech Republic (Haag et al., 2015). Nevertheless, ensiling remains an uncontrolled process that depends on the epiphytic microflora (Lin et al., 1992), water soluble carbohydrates (Yang et al., 2006), and water content. Poor ensiling processes expose the silage to air upon opening the silo or after its removal from the silo. As a result, proteins and other substrates (mainly lactic acids; Danner et al., 2003) are consumed by enterobacteria, clostridia, and yeasts. In poorly managed silage, dry matter losses can easily be more than 30% after silage rots (Weinberg et al., 2011). In addition to the loss of easily degradable substrates, the relative increase of fiber fractions that are refractory to degradation in aerobically deteriorating maize silages can also be expected to negatively influence methane production (Herrmann et al., 2015). The relative increase of refractory fiber fractions that need pretreatment to increase their degradability, as well as the rapid growth of detrimental microorganisms, makes it difficult to establish efficient biological pretreatment methods. This is why a number of studies have proposed methods to avoid aerobic deterioration, while few studies have examined how to use rotted silages. Thus far, none of the pretreatment methods have been tested to treat rotted silages for biogas production. In the present study, MC1 was used to treat non-sterilized, rotted silage maize straw (RSMS) to determine whether MC1 could resist the adverse effects of microbial contamination, delignify materials and increase the biogas yield.

2. Materials and methods 2.1. Composite microbial system MC1 MC1 from frozen stock was used to inoculate 100 mL of sterile peptone cellulose solution (PCS) containing (g/L) peptone (5), yeast extract (1), CaCO3 (2), NaCl (5), and filter paper (Whatman, Maidstone, England) (5); the culture was grown statically at 50 °C for 4 d and used as the inoculation seed (Haruta et al., 2002).

2.2. RSMS and culture conditions Maize straw (collected from the Shangzhuang Experimental Station of China Agricultural University, Beijing, China) was obtained at the dough stage. After collection, samples were cut into pieces (3–5-cm long), with a moisture content of approximately 70%, for further use. The pieces were stored at ambient temperature in air-tight containers. After 1 month of fermentation, silage maize straw was removed from the containers and exposed to air at room temperature. After 7 d, the silage maize straw began to turn dark and its pH was 7. Two hundred and fifty milliliters of PCS medium containing 4.5 g of RSMS instead of filter paper was autoclaved at 121 °C for 20 min (sterilized [S] group), or was left to decay without sterilization (non-sterilized [NS] group). Then, the PCS medium was inoculated with 2% (v/v) of a 4-d-old MC1 culture in a 300-mL flask under static conditions at 50 °C for 10 d. The optical density (OD) value of 4-d-old MC1 was 0.6. Samples were taken on d 0 (immediately after inoculation), 5, and 10 for analysis. Unless otherwise specified, the data presented are the mean values of three replicates.

2.3. Reduction in RSMS weight PCS medium that was inoculated with MC1 and RSMS (as described above) was filtered and the residual straw was dried to a constant weight at 60 °C. RSMS degradation by MC1 was determined at d 5 and d 10 of the culture period and a blank control without MC1 inoculation served as a control to eliminate any effect of the medium. The treatment was repeated three times. 2.4. Crude enzyme extraction and determination of enzyme activities Cellulose degradation activity was expressed as carboxymethyl cellulase (CMCase) activity. CMCase activity was measured in a 1mL mixture. First, 200 lL of S or NS culture supernatant (the culture was centrifuged at 12,000g for 10 min) and 200 lL of a 1% (w/v) carboxymethyl cellulose (CMC) solution were mixed and incubated for 10 min at 60 °C. Six hundred microliters of a 3,5dinitrosalicylic (DNS) acid solution (1% NaOH, 20% Rochelle salt, 2% phenol, 0.005% sodium sulfite, and 1% DNS) was added to the mixture and incubated for 10 min at 100 °C. Next, the 1-mL mixtures were cooled on ice for 5 min, centrifuged at 12,000g for 1 min and the absorption at 540 nm was determined. A standard curve was made using 5 mmol/L glucose and a blank control was prepared for each sample. One unit of enzyme activity was defined as the amount of enzyme that liberated 1 mmol of reducing sugars per min under the above conditions. 2.5. High-performance liquid chromatography (HPLC) analyses of volatile fatty acids (VFAs) VFAs were measured using a Shimadzu (Kyoto, Japan) HPLC system that was equipped with an Aminex HPX-87H column (300 mm  7.8 mm), and a Shimadzu SPD-M20A HPLC detector and a finger-tight PEEK I green fitting (Bio-Rad, Hercules, CA, USA) downstream of the HPX-87H column. Samples were analyzed at 35 °C with 5 mmol/L H2SO4 as the eluent phase at a flow rate of 0.6 mL/min (Wang et al., 2011). Data analyses were performed using Shimadzu HPLC Software LCMS at a 210-nm detection wavelength. The retention times were used as qualitative criteria and peak areas served as quantitative criteria. Calibration was performed using external standards of the respective components. Liquid samples for organic acid analysis were obtained on d 0, 5, and 10 by removing 1 mL of the liquid and storing it at 20 °C for subsequent analysis. The samples were centrifuged for 10 min at 12,000g, filtered through a 0.45-lm polytetrafluoroethylene filter and injected (20 lL) directly into the HPLC system. 2.6. Analyses of microbial structure using polymerase chain reactiondenaturing gradient gel electrophoresis (PCR-DGGE) DNA extraction was conducted on d 5 and 10. 16S rDNA PCR amplification was performed using the GeneAmp PCR System (Model 9700, Applied Biosystems, Foster City, CA, USA). The primers used for DGGE were the eubacterial universal primers 357F-GC (50 –CCTACGGGAGGCAGCAG–30 ), containing a GC-clamp (50 –CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG–30 ), and 517R (50 –ATTACCGCGGCTGCTGG–30 ) that are complementary to the V3 region of the 16S rRNA gene (Muyzer et al., 1993). An initial DNA denaturation step was performed at 95 °C for 10 min, followed by 30 cycles of denaturation at 93 °C for 1 min, annealing at 48 °C for 1 min and elongation at 72 °C for 1 min 30 s, followed by a final elongation step at 72 °C for 5 min. The products were examined by electrophoresis on a 2% (w/v) agarose gel (Wang et al., 2006). DGGE analysis of the PCR products was performed with the DCode System (Bio-Rad) in the manner described by Muyzer et al. (1993) and Haruta et al. (2002).

701

B. Hua et al. / Bioresource Technology 216 (2016) 699–705

Samples were applied to 1-mm-thick, 6–12% (w/v) polyacrylamide gradient gels in 0.5  TAE electrophoresis buffer (20 mmol/L Tris-HCl pH 8.3, 10 mmol/L acetic acid, 0.5 mmol/L EDTA), with a 20–60% denaturant gradient (where 100% is defined as 7 mol/L urea and 40% formamide). Electrophoresis was performed for 5 h at a constant voltage of 200 V and 61 °C. After electrophoresis, the gels were stained with SYBR Green I (Molecular Probes, Eugene, OR, USA) and photographed, as described previously (Plumb et al., 2001). The bands on the DGGE gel were observed under 302-nm UV light using the Alpha Imager 2200 Imaging System (Alpha Innotech, San Leandro, CA, USA). 2.7. Quantitative PCR (qPCR) of five key strains in MC1 Genomic DNA was extracted using an automated nucleic acid extractor (Bioteke Biotech Co., Ltd., Beijing, China) and used as the PCR template. The DNA was eluted with 40 lL of Tris-HCl buffer (pH 8.0) and stored at 20 °C. Kato et al. (2004b, 2005) designed primers (listed in Table 1) that are complementary to the 16S rDNA sequences of the five isolates (Clostridium straminisolvens CSK1, Clostridium sp. FG4, Pseudoxanthomonas sp. M1-3, Brevibacillus sp. M1-5 and Bordetella sp. M1-6). Standards of the five strains (CSK-1, FG4, M1-3, M1-5, and M1-6) for real-time qPCR were generated as described previously (Hua et al., 2014). qPCRs were performed on an ABI 7500 system (Model 7500, Applied Biosystems). The 20-lL qPCR mixture was prepared using 10 lL of SYBR Green Super mix (Invitrogen by Life Technologies, Carlsbad, CA, USA), 7.8 lL of PCR-grade water, 0.4 lL of forward and reverse specific primers (final concentration, 10 lM), 0.4 lL of ROX reference dye and 1 lL of template DNA. The amplification protocol was as follows: 2 min at 50 °C, followed by 2 min at 95 °C, followed by 40 cycles of 5 s at 95 °C and combined annealing and extension for 45 s at 68 °C (except 61 °C was used for M1-3 and M1-6). All DNA samples were analyzed in duplicate with each primer set. 2.8. Anaerobic digestion The treated NS and untreated NS groups were respectively digested in batch anaerobic digesters. The treated NS group contained 157 mL of hydrolysates and 4.75 g of RSMS that was pretreated by MC1 for 5 d. Untreated NS in 157 mL of PCS medium was used as the control. Sterile silage was not used in the anaerobic digesters as it was only used as a control to obtain fermentation information for microbial community MC1 under uncontaminated conditions. To simplify the analysis, only the effects of MC1 treated NS and untreated NS were compared. The volume of each anaerobic digester was 600 mL and each digester was seeded with 43 mL of anaerobic sludge taken from a mesophilic anaerobic digester. The characterization of the RSMS and sludge is described in Table 2. All anaerobic digesters were purged with N2 for 5 min to remove O2 and then sealed with a rubber stopper. Each digestion was repeated three times at a mesophilic temperature (35 °C). Average

Table 2 Characterization of rotted silage maize straw (RSMS) and sludge.a

a

Parameters

Decayed silage maize straw

sludge

Total solids (TS) (w/w) Volatile solids (VS) (w/w) VS/TS*100 (%)

0.1662 0.1241 74.67

0.0926 0.0459 49.57

Wet weight basis.

values were used in the blank control (CK), in which biogas production only resulted from the 157 mL of PCS medium and the seeded anaerobic sludge. The purpose of the CK was to obtain the biogas and methane yield of the 157 mL of PCS medium and anaerobic sludge alone. The biogas and methane yields of the RSMS were calculated as follows (Yuan et al., 2014):

Biogas yield ml=g VS ¼

ðBiogas volumeÞtotal  ðBiogas volumeÞCK VS of substrates added

where VS is the volatile solids. 2.9. Biogas analysis The pressure in the headspace of each digester was used as an indicator for calculating the amount of biogas produced in the digester, and was measured using a 3150 WAL-BMP-Test system pressure gauge with accuracy of 0.1% (WAL Mess-und Regelsysteme GmbH, Oldenburg, Germany). The biogas in the headspace was released underwater to prevent gas exchange between the digester and the ambient air. Then, the pressure in the headspace was measured again to determine the initial conditions for the following day’s measurement. Daily pressure differences were converted into biogas volumes using the following equation (ElMashad and Zhang, 2010):

V biogas ¼

DP  V headspace  C RT

where Vbiogas is the daily biogas volume (mL), DP is the absolute pressure difference (kPa), Vheadspace is the volume of the headspace (mL), C is the molar volume (22.41 L mol1 at 273.15 K and 101.325 kPa), R is the universal gas constant (8.314 L kPa K1 mol1) and T is the absolute temperature (K). 3. Results and discussion 3.1. MC1-mediated fermentation On d 0, the NS medium was transparent, while the S medium was dark. This was because the sterilization procedure precipitated some lignin. After 5 or 10 d of pretreatment, the NS and S media were turbid and the RSMS became loose and supple. The weight losses of the NS and S groups were 33.51% and 35.70%, respectively, after 5 d of fermentation and 69.71% and

Table 1 16S rRNA gene primers used in this study. Primer

Sequence (50 –30 )

E. coli position

Targeted isolates

CSK-198f CSK-439r M3-459f M3-743r M5-225f M5-489r M6-456f M6-742r FG-199f FG-442r

ACATAACGAGGCGGCATCGCT CACTTTCTTCGTCCCCAATC GTTGGGGAAGAAATCCTGCT TGCCTCAGTGTCAGTGTTGG TGGCTTTTCGCTATCACTGG TAGCCGTGGCTTTCTCGTCA TTTGGCAGGAAAGAAATAGG GCATGAGCGTCAGTGTTATC ATCACGGGGAGGCATCTTCC CGTCACTTCCTTCGTCCCTC

181–198 463–439 440–459 762–743 207–225 508–489 437–456 761–742 183–199 442–461

Clostridium straminisolvens CSK1 Clostridium straminisolvens CSK1 Pseudoxanthomonas sp. M1-3 Pseudoxanthomonas sp. M1-3 Brevibacillus sp. M1-5 Brevibacillus sp. M1-5 Bordetella sp. M1-6 Bordetella sp. M1-6 Clostridium sp. strain FG4 Clostridium sp. strain FG4

702

B. Hua et al. / Bioresource Technology 216 (2016) 699–705

62.18%, respectively, after 10 d of fermentation. There was no significant difference between the NS and S weight losses (p > 0.05). The NS RSMS did not have an effect on degradation by the composite microbial system MC1. The key enzymes (CMCases) in the fermentation broth were detected on d 5 and 10. Their values were 0.12, 0.11, 0.10, and 0.36 U for NS-5d, NS-10d, S-5d, and S-10d, respectively. On d 5, the CMCase activity in NS was not substantially different from that in S, whereas on d 10, the CMCase activity in NS was much lower than that in S. The CMCase activity was not affected by the microorganisms that were present in the NS RSMS on d 5. The main VFAs that were produced during the pretreatment period were acetic, propionic, lactic and formic acids (Fig. 1). MC1 has been used to pretreat lignocellulose materials like rice straw (Hua et al., 2014; Liu et al., 2006) and to produce organic acids. In these studies, acetic acid exhibited the highest concentration of all of the VFAs (Hua et al., 2014). In the present study, this was also true for the NS and S groups, while the formic and lactic acid concentrations were low and stable throughout the entire fermentation process. Acetic and formic acids can be converted directly into methane during the anaerobic digestion process. Although the theoretical methane yield of lactic acid is equivalent to that of acetic acid (Buswell and Mueller, 1952), lactic acid is first converted into acetic acid, CO2, and H2, and then to methane. If the lactic acid concentration is too high, the methane yield will decrease (Pieper and Korn, 2010) and propionic acid has an inhibitory effect on the growth of methanogenic bacteria (Wang et al., 2009). In the NS group, the propionic acid concentrations ranged from 0.11 to 0.12 g/L, while in the S group, they ranged from 0.45 to 0.50 g/L. Butyric acid was only detected at a very low concentration (<0.1 g/L) in the NS group on d 5 (data not shown). Butyric acid is a characteristic product of detrimental microorganisms that are present during ensiling (Weinberg and Ashbell, 2003). In the NS group, the predominant bacteria in MC1 still drive the fermentation process and are the predominant, metabolically active bacteria. However, because of the microorganisms present in the NS RSMS, the total VFA concentration of the NS group was lower than that of the S group and the VFA concentrations were lower on d 10 than on d 5. Above all, microbial contamination in the NS group did not affect the pretreatment process.

this figure. First, bands 1–6 in the S group were also found in the NS group, which indicated that the community composition of MC1 was stable during the pretreatment and that the cellulosedegrading microbial community in MC1 was resistant to interference from contaminating microbes. Second, there were many other bands in the NS group on d 5 and 10 that did not exist in the S group at these times, which indicated that the RSMS was contaminated by other microorganisms. A previous study demonstrated that bands 1,2, 3–5, and 6 were derived from bacteria belonging to the genera Clostridium, Bordetella, Brevibacillus and Pseudoxanthomonas, respectively (Haruta et al., 2002). The five key strains of MC1 were detected and the quantitative analysis is shown in Fig. 3. The quantitative proportions of the five strains in the NS and S groups were very similar on d 5, especially the relative abundances of the cellulose-degrading strain CSK-1, which were 18% and 19% in the NS and S groups, respectively, although they differed substantially on d 10. On d 10, the percentages of CSK-1 were 1% and 30% in the NS and S groups, respectively, thereby demonstrating that the abundance of this strain declined precipitously in the NS group. In a previous study, the quantitative proportions of these five strains changed regularly during the degradation process, which reflected the growth state of the consortia (Hua et al., 2014). In the present study, after 5 d, the quantitative proportions of the five key strains in the NS group were the same as those of the control, which indicated that the community composition of MC1 was resistant to other microorganisms. The cellulosedegrading process of MC1 could be divided into two periods, including a rapid degradation period that usually occurred from d 0–9 and a post-rapid degradation period that usually occurred from d 9 onwards (Hua et al., 2014). In this study, the ability of MC1 to resist contamination declined in the post-rapid degradation period (d 10).

3.2. The MC1 community composition is resistant to microbial contamination Fig. 2 shows the microbial community composition in the S and NS groups on d 5 and 10. Two key points should be made regarding

Fig. 1. Volatile fatty acids (VFAs) in rotted silage maize straw (RSMS) pretreatment broth.

Fig. 2. DGGE profiles of amplified V3 regions of 16S rRNA gene fragments (about 200 bp). The lanes from left to right are the samples of S on d 5, S on d 10, NS on d 5 and NS on d 10, respectively.

B. Hua et al. / Bioresource Technology 216 (2016) 699–705

703

Fig. 3. Quantity analysis of five key strains in rotted silage maize straw (RSMS) pretreatment broth.

For poorly maintained substrates like RSMS, the main challenge of biological pretreatment is to maintain the functional strains in a dominant and stable state in the presence of non-sterilized biomass (Liu et al., 2009). Some microbial composite systems have been successfully constructed and could be used without sterilization (Bruni et al., 2010; Lu et al., 2009; Zheng et al., 2014). However, such microbial consortia have not been used directly to pretreat RSMS. In this study, the DGGE and qPCR results indicated that MC1 could effectively pretreat RSMS under non-sterile conditions while maintaining a stable community structure.

3.3. MC1 pretreatment increased biogas yield The results indicated that the optimal length of time for RSMS pretreatment was 5 d. On d 5, MC1 was in the rapid degradation period, showing good resistance to contaminating microorganisms (Figs. 2 and 3) and retaining a high concentration of acetic acid. Additionally, longer treatment time would cause increased loss of organic matter that might lead to decreased biogas production (Carrere et al., 2016). Therefore, 5 d of pretreatment with MC1 was used for subsequent anaerobic digestion in batch digesters, while the untreated RSMS in PCS medium served as a control. The biogas yield was measured during anaerobic digestion. As shown in Fig. 4 (A), the maximum biogas yields of the treated and untreated RSMS both occurred on d 5 and the peak value of the treated RSMS reached 55.5 mL/g VS. Because of the addition of blank medium, the peak value (73.9 mL/g VS) of the untreated RSMS occurred on d 1. However, after the PCS medium was

consumed, the biogas yields of the untreated RSMS decreased rapidly, reaching 0 mL/g VS on d 3, and then slowly increased, reaching a second peak of 27.8 mL/g VS on d 7. MC1 could degrade lignocellulose into smaller polymers, decrease the particle size and reduce the substrate crystallinity under poor conditions with many contaminating microbes. These results showed that pretreatment with MC1 could substantially increase the feasibility of anaerobically digesting RSMS. The total biogas yield of the treated RSMS was obviously higher than that of the untreated sample. The values of the treated and untreated RSMS, as shown in Fig. 4(B), were 304 and 173 mL/g VS, respectively. Compared with the untreated sample, the treated sample yielded 130 mL/g VS more biogas after 15 d of anaerobic digestion, which was significantly higher than that of the untreated RSMS (p < 0.05). Based on this result, pretreatment with MC1 could increase biogas production from non-sterilized RSMS by 74.7%.

3.4. Summary of the characteristics of MC1 for pretreatment In the present study, MC1 was used to pretreat RSMS and the results indicated that the methane production yield was significantly increased. According to this experiment and previous studies, some characteristics of MC1 for lignocellulosic material pretreatment can be summarized as follows. Pretreating lignocellulosic materials with MC1 enhances biogas yields (Yuan et al., 2016), lowers costs and simplifies the operation procedures. No sterilization, stirring, or ventilation is needed and it has a wide pH tolerance. During pretreatment, the pH decreased

704

B. Hua et al. / Bioresource Technology 216 (2016) 699–705

thus, avoiding sterilization could save energy, making MC1 a costeffective treatment for RSMS. 4. Conclusions The composite microbial system MC1 could resist the natural microbial flora present on the RSMS substrate. MC1 remained functional and stable throughout the fermentation process and MC1 pretreatment increased biogas yields by 74.7%, thereby enhancing the utility of RSMS, which produces very little biogas without pretreatment. Acknowledgements This work was supported by the Special Fund for Agro-Scientific Research in the Public Interest, China (Nos. 201503137 and 201303080-7). And the Fundamental Research Funds for the central universities, China (Nos. 2016QC105). References

Fig. 4. Dynamics of biogas yield (A) and total cumulative biogas yields during the 15-d anaerobic digestion (B).

rapidly to approximately 6.0 and then increased slowly to 8.0–9.0. Irrespective of the initial pH (4.0–10.0), MC1 could restore the pH and recover its degradation ability (Cui et al., 2002; Liu et al., 2006). Additionally, MC1 produces fermentation products that do not contain harmful substances that inhibit downstream anaerobic fermentation. MC1 is capable of degrading cellulose and producing organic acids. The conversion of the compounds that are present in straw into organic acids is a prerequisite for biogas production (Kaparaju et al., 2009a,b; Weiland, 2010). Moreover, MC1 is resistant to contaminating microbes. Lignocellulosic biomass generally contains a large amount of microorganisms, which usually means that under non-sterile conditions, the indigenous microflora of the substrate must be suppressed. However, MC1 can be used to pretreat non-sterilized corn straw, rice straw, and even RSMS, which indicates that MC1 is a resistant composite microbial system that is especially suitable for pretreating poorly maintained (rotted) substrates. In nature, the biodegradation of lignocellulosic materials occurs in a heterogeneous system in a manner such that the lignocellulolytic microbes coexist and compete with other nonlignocellulolytic microbes present on natural substrates (Tejirian and Xu, 2010). In the present study, an enriched microbial consortium, MC1, effectively pretreated lignocellulose under non-sterile conditions, which increased methane production. Energy consumed during sterilization is a major concern in commercial pretreatment;

Agbor, V.B., Cicek, N., Sparling, R., Berlin, A., Levin, D.B., 2011. Biomass pretreatment: fundamentals toward application. Biotechnol. Adv. 29, 675–685. Bruni, E., Jensen, A.P., Angelidaki, I., 2010. Comparative study of mechanical, hydrothermal, chemical and enzymatic treatments of digested biofibers to improve biogas production. Bioresour. Technol. 101, 8713–8717. Buswell, A.M., Mueller, H.F., 1952. Mechanism of methane fermentation. Ind. Eng. Chem. 44, 550–552. Carrere, H., Antonopoulou, G., Affes, R., Passos, F., Battimelli, A., Lyberatos, G., Ferrer, I., 2016. Review of feedstock pretreatment strategies for improved anaerobic digestion: from lab-scale research to full-scale application. Bioresour. Technol. 199, 386–397. Cui, Z., Li, M., Piao, Z., Huang, Z., Masaharu, I., Yasuo, I., 2002. Selection of a composite microbial system MC1 with efficient and stability cellulose degradation bacteria and its function. Huanjing Kexue 23, 36–39. Danner, H., Holzer, M., Mayrhuber, E., Braun, R., 2003. Acetic acid increases stability of silage under aerobic conditions. Appl. Environ. Microbiol. 69, 562–567. El-Mashad, H.M., Zhang, R., 2010. Biogas production from co-digestion of dairy manure and food waste. Bioresour. Technol. 101, 4021–4028. Haag, N.L., Naegele, H.-J., Reiss, K., Biertuempfel, A., Oechsner, H., 2015. Methane formation potential of cup plant (silphium perfoliatum). Biomass Bioenergy 75, 126–133. Haruta, S., Cui, Z., Huang, Z., Li, M., Ishii, M., Igarashi, Y., 2002. Construction of a stable microbial community with high cellulose-degradation ability. Appl. Microbiol. Biotechnol. 59, 529–534. Herrmann, C., Idler, C., Heiermann, M., 2015. Improving aerobic stability and biogas production of maize silage using silage additives. Bioresour. Technol. 197, 393– 403. Hua, B.B., Lu, Y.C., Wang, J.G., Wen, B.T., Cao, Y.Z., Wang, X.F., Cui, Z.J., 2014. Dynamic changes in the composite microbial system mc1 during and following its rapid degradation of lignocellulose. Appl. Biochem. Biotechnol. 172, 951–962. Kato, S., Haruta, S., Cui, Z.J., Ishii, M., Yokota, A., Igarashi, Y., 2004a. Clostridium straminisolvens sp. Nov., a moderately thermophilic, aerotolerant and cellulolytic bacterium isolated from a cellulose-degrading bacterial community. Int. J. Syst. Evol. Microbiol. 54, 2043–2047. Kato, S., Haruta, S., Cui, Z.J., Ishii, M., Igarashi, Y., 2004b. Effective cellulose degradation by a mixed-culture system composed of a cellulolytic clostridium and aerobic non-cellulolytic bacteria. FEMS Microbiol. Ecol. 51, 133–142. Kato, S., Haruta, S., Cui, Z.J., Ishii, M., Igarashi, Y., 2005. Stable coexistence of five bacterial strains as a cellulose-degrading community. Appl. Environ. Microbiol. 71, 7099–7106. Lin, C.J., Bolsen, K.K., Brent, B.E., Fung, D.Y.C., 1992. Epiphytic lactic-acid bacteria succession during the pre-ensiling and ensiling periods of alfalfa and maize. J. Appl. Bacteriol. 73, 375–387. Liu, J.B., Wang, W.D., Yang, H.Y., Wang, X.F., Gao, L.J., Cui, Z.J., 2006. Process of rice straw degradation and dynamic trend of ph by the microbial community MC1. J. Environ. Sci. 18, 1142–1146. Liu, L., Sun, J., Li, M., Wang, S., Pei, H., Zhang, J., 2009. Enhanced enzymatic hydrolysis and structural features of corn stover by FeCl3 pretreatment. Bioresour. Technol. 100, 5853–5858. Lu, Y., Lai, Q., Zhang, C., Zhao, H., Ma, K., Zhao, X., Chen, H., Liu, D., Xing, X.H., 2009. Characteristics of hydrogen and methane production from cornstalks by an augmented two- or three-stage anaerobic fermentation process. Bioresour. Technol. 100, 2889–2895. Muyzer, G., Dewaal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbialpopulations by denaturing gradient gel-electrophoresis analysis of polymerase chain reaction-amplified genes-coding for 16s ribosomal-RNA. Appl. Environ. Microbiol. 59, 695–700.

B. Hua et al. / Bioresource Technology 216 (2016) 699–705 Pieper, B., Korn, U., 2010. Influence of lactic and acetic acid in corn silage on biogas production and conclusions for the application of silage additives. In: Jambor, V., Jamborova, S., Vosynkova, P., Prochazka, P., Vosynkova, D., Kumprechtova, D. (Eds.), Conference Proceeding, 14th International Symposium Forage Conservation, Czech Republic, Brno, pp. 117–118. Plumb, J.J., Bell, J., Stuckey, D.C., 2001. Microbial populations associated with treatment of an industrial dye effluent in an anaerobic baffled reactor. Appl. Environ. Microbiol. 67, 3226–3235. Tejirian, A., Xu, F., 2010. Inhibition of cellulase-catalyzed lignocellulosic hydrolysis by iron and oxidative metal ions and complexes. Appl. Environ. Microbiol. 76, 7673–7682. Wang, X.F., Haruta, S., Wang, P., Ishii, M., Igarashi, Y., Cui, Z.J., 2006. Diversity of a stable enrichment culture which is useful for silage inoculant and its succession in alfalfa silage. FEMS Microbiol. Ecol. 57, 106–115. Wang, Y.Y., Zhang, Y.L., Wang, J.B., Meng, L., 2009. Effects of volatile fatty acid concentrations on methane yield and methanogenic bacteria. Biomass Bioenergy 33, 848–853. Wang, A., Li, Y.-Y., Estrada, A.L., 2011. Mineralization of antibiotic sulfamethoxazole by photoelectro-fenton treatment using activated carbon fiber cathode and under UVA irradiation. Appl. Catal. B 102, 378–386. Weiland, P., 2010. Biogas production: current state and perspectives. Appl. Microbiol. Biotechnol. 85, 849–860.

705

Weinberg, Z.G., Ashbell, G., 2003. Engineering aspects of ensiling. Biochem. Eng. J. 13, 181–188. Weinberg, Z.G., Khanal, P., Yildiz, C., Chen, Y., Arieli, A., 2011. Ensiling fermentation products and aerobic stability of corn and sorghum silages. Grassland Sci. 57, 46–50. Wen, B., Yuan, X., Li, Q., Liu, J., Ren, J., Wang, X., Cui, Z., 2014. Comparison and evaluation of concurrent saccharification and anaerobic digestion of napier grass after pretreatment by three microbial consortia. Bioresour. Technol. 175C, 102–111. Yang, H.Y., Wang, X.F., Liu, H.B., Gao, L.J., Ishii, M., Igarashi, Y., Cui, Z.J., 2006. Effects of water-soluble carbohydrate content on silage fermentation of wheat straw. J. Biosci. Bioeng. 101, 232–237. Yuan, X., Wen, B., Ma, X., Zhu, W., Wang, X., Chen, S., Cui, Z., 2014. Enhancing the anaerobic digestion of lignocellulose of municipal solid waste using a microbial pretreatment method. Bioresour. Technol. 154, 1–9. Yuan, X., Ma, L., Wen, B., Zhou, D., Kuang, M., Yang, W., Cui, Z., 2016. Enhancing anaerobic digestion of cotton stalk by pretreatment with a microbial consortium (MC1). Bioresour. Technol. 207, 293–301. Zheng, Y., Zhao, J., Xu, F., Li, Y., 2014. Pretreatment of lignocellulosic biomass for enhanced biogas production. Prog. Energy Combust. Sci. 42, 35–53.