Prevalence and characterization of Staphylococcus aureus isolated from goat milk powder processing plants

Food Control 59 (2016) 644e650

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Prevalence and characterization of Staphylococcus aureus isolated from goat milk powder processing plants Xiaonan Xing a, Yang Zhang a, Qian Wu a, Xin Wang a, *, Wupeng Ge a, Congming Wu b a b

College of Food Science and Engineering, Northwest A&F University, Yangling, Shaanxi 712100, China College of Veterinary Medicine, China Agricultural University, Beijing 100193, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 3 March 2015 Received in revised form 15 June 2015 Accepted 18 June 2015 Available online 24 June 2015

Staphylococcus aureus is a major concern for the food processing industry because of its virulence factors. The aim of this study was to determine the prevalence of S. aureus strains in goat milk powder processing plants, and to characterize these strains by antimicrobial susceptibility testing, pulsed-field gel electrophoresis (PFGE) and PCR. PCR detected genes encoding staphylococcal enterotoxin (sea to set), staphylococcal enterotoxin-like (selj to selv), toxic-shock syndrome toxin-1 (tst), exfoliative toxin (eta and etb), Paton-Valentine Leukocidin (pvl), and methicillin resistance (mecA). A total of 910 samples including 62 raw goat milk samples from a milking station and 848 samples from seven different sampling sites in four goat milk powder plants were collected. Out of 910 samples, 95 (10.4%) samples, including 34 (54.8%) of 62 milking station samples and 61 (7.2%) of 848 milk powder processing plant samples, were positive for S. aureus. 63.2% of 95 isolates contained one or more virulence genes. The five most predominant virulence genes were pvl (29.5%), sec (23.2%), ser (16.8%), tst (14.7%), and seb (12.6%). 90.5% of strains were resistant to at least one antibiotic. Resistance was most frequently observed to trimethoprim/sulfamethoxazole (89.5%), erythromycin (30.5%), tetracycline (22.1%), ampicillin (16.8%), chloramphenicol (15.8%), and rifampicin (9.5%). A total of 44 PFGE patterns were generated among all the isolates. PFGE demonstrated that some isolates with the same PFGE patterns came from different goat milk powder processing stages. Our findings indicate that S. aureus has spread among different goat milk powder producing locations. In addition, cross-contamination of S. aureus exists in goat milk powder processing stages. The presence of S. aureus strains in goat milk powder processing stages poses a potential threat to public health. © 2015 Published by Elsevier Ltd.

Keywords: Staphylococcus aureus Goat milk powder processing plants Virulence genes Antimicrobial resistance Pulsed-field gel electrophoresis

1. Introduction Staphylococcus aureus is a notorious pathogenic microorganism that causes foodborne poisoning and infections both in humans and animals (Wang et al., 2012). Some S. aureus strains can express a large number of virulence factors including staphylococcal enterotoxins (SEs), staphylococcal enterotoxin-like (SEls), exfoliative toxin A and B (eta and etb) and toxic shock syndrome toxin-1 (tst) genes. SEs or SEls are well known as a major cause of food poisoning (Argudin, Mendoza, & Rodicio, 2010). Due to its ubiquitous nature, S. aureus commonly exists in food processing environments, including dairy production plants (Jorgensen, Mork,

* Corresponding author. College of Food Science and Engineering, Northwest A&F University, Yangling, Shaanxi 712100, China. E-mail address: [email protected] (X. Wang). http://dx.doi.org/10.1016/j.foodcont.2015.06.042 0956-7135/© 2015 Published by Elsevier Ltd.

Hogasen, & Rorvik, 2005). Previous studies have also reported that raw milk is a potential reservoir for S. aureus (Fusco & Quero, 2014), and this bacterium has also been isolated from the environments and workers of dairy farms (Lim et al., 2013). Due to its low sensitization and nutrition, goat milk is mostly being used as a raw material for infant formula. However, milk powder is easily contaminated with S. aureus (Wang et al., 2012). Although pasteurization can kill S. aureus cells, enterotoxins produced by S. aureus can still cause foodborne diseases in humans (Yamashita et al., 2003). In addition, studies have reported that some S. aureus strains persist in powdered infant formula (Wang et al., 2012). These may increase the risk of food poisoning for consumers. Previous studies on foodborne pathogens in dairy processing focused on Listeria monocytogenes and Escherichia coli O157:H7 (Almeida et al., 2013; Barancelli et al., 2014; Cagri-Mehmetoglu et al., 2011). However, reports on S. aureus in goat milk powder

X. Xing et al. / Food Control 59 (2016) 644e650

processing plants are relatively scanty. Therefore, the objective of this work was to determine the prevalence of S. aureus strains in raw goat milk and goat milk powder processing plants, and to characterize these strains by determining antimicrobial susceptibility, virulence genes, and pulsed-field gel electrophoresis (PFGE) profiles. 2. Material and methods 2.1. Sample collection and isolation of S. aureus From September 2012 to March 2013, a total of 848 samples from seven different sampling sites in four goat milk powder plants were collected. There were 195 samples from plant A, 240 samples from plant B, 241 samples from plant C, and 172 samples from plant D. Seven different sampling sites including tank milk, pre-spray drying areas, spray drying areas, powder-packaging room, ground and wall, workers, and final products were considered. Pre-spray drying areas included air filter, stabilization tank, milk clarifier and balance tank. Spray drying areas included spray dryer, spray drying tower, fluidized bed, cooling bed and vibrating sieve. The goat milk powder samples analyzed in this study included semi finished (100 g or 100 mL/sample) and finished (100 g/sample) products in four goat milk powder processing plants. The swab samples were collected from equipment, ground, wall, and workers during processing and packaging in four goat milk powder processing plants. In addition, a part of raw milk in four goat milk powder plants were collected from one goat milking station, there were 62 raw milk samples from the goat milking station. Isolation and identification of S. aureus were performed as described previously by Wang et al. (2012). Briefly, 25 g of milk powder or 25 mL of milk sample was placed into a sterile triangle glass bottle containing 225 mL of buffered peptone water (BPW, Beijing Land Bridge Technology Ltd., Beijing, China), and all swabs were placed into a sterile 50 mL flat bottom tube containing 30 mL of trypticase soy broth (TSB) (Beijing Land Bridge Technology Co. Ltd., Beijing, China). The solution was incubated at 37
C in an air bath with shaking at 100 rpm for 24 h. After pre-enrichment, 3 mL aliquot was transferred into a sterile 50 mL flat bottom tube containing 30 mL of trypticase soy broth (TSB, Beijing Land Bridge Technology Ltd., Beijing, China) containing 7.5% NaCl. After 18e24 h incubation at 35
C, a loopful culture was inoculated onto BairdeParker agar (BPA, Beijing Land Bridge Technology Ltd., Beijing, China) plates with 5% egg yolk and tellurite. Following incubation at 35
C for 24 h, one or two presumptive coagulase-positive colonies per sample (black colonies surrounded by 2e5 mm clear zones) were transferred to Trypticase soy agar (TSA, Beijing Land Bridge Technology Ltd., Beijing, China) plates for further purification. Colonies were then confirmed as S. aureus by PCR (Hema PCR system 9600, Zhuhai, China) detection of the thermonuclease gene (nuc, S. aureus specific) (Brakstad, Aasbakk, & Maeland, 1992). All isolates were stored at 80
C until use.

645

information of all primers used for PCR is shown in Table 1, and the references of all primers were shown in supplementary materials. The primers were synthesized by TaKaRa Biotechnology Co., Ltd (Dalian, China). The genes encoding enterotoxins (sea, seb, sec, sed, see, seg, seh, sei, ser, ses, and set), enterotoxin-like (selj, selk, sell, selm, seln, selo, selp, selq, selu, and selv), toxic-shock syndrome toxin-1 (tst), exfoliative toxin genes (eta and etb), Paton-Valentine Leukocidin (pvl), and methicillin resistance (mecA) were detected by PCR. PCR products were visualized by UV transillumination (Universal Hood II, Bio-Rad, Italy) after electrophoresis on 1.0% (w/ v) agarose gels (Hydragene) with 0.5 mg/ml ethidium bromide (Sigma) in 0.5  TBE buffer by a DYY-6C electrophoresis system (Beijing Liuyi Instrument Factory, Beijing). 2.3. Pulsed-field gel electrophoresis (PFGE) PFGE was performed for S. aureus isolates according to a standard protocol developed by Pulse Net for S. aureus (McDougal et al., 2003). Briefly, agarose-embedded DNA was digested with 50 U of SmaI for 3 h in a water bath at 30
C. DNA fragments were separated by electrophoresis in 0.5  TBE buffer at 14
C for 21 h on a CHEFIII Mapper electrophoresis system (Bio-Rad Laboratories, Richmond, CA, USA) with pulse time of 5e40 s. The gels were stained with ethidium bromide and images were taken under UV transillumination. The images were analyzed with BioNumerics Software (Applied Maths, Kortrijk, Belgium) by using Dice coefficients and unweighted pair group method with arithmetic averages (UPGMA) to achieve dendrograms with an optimization value of 0.5% and a 1.5% band position tolerance. Salmonella serotype Branderup strain H9812 digested with XbaI was used as a molecular size marker. 2.4. Antimicrobial susceptibility testing According to the agar dilution method described by Clinical Laboratory Standards Institute (CLSI, 2012), a total of 14 antibiotics, including erythromycin (ERY, 8 mg/mL), oxacillin (OXA, 4 mg/ mL), cefoxitin (FOX, 8 mg/mL), cefoperazone (CFP, 64 mg/mL), vancomycin (VAN, 32 mg/mL), tetracycline (TET, 16 mg/mL), chloramphenicol (CHL, 32 mg/mL), trimethoprim/sulfamethoxazole (SXT, 8/152 mg/mL), ciprofloxacin (CIP, 4 mg/mL), amikacin (AMK, 32 mg/mL), ampicillin (AMP, 32 mg/mL), rifampicin (RIF, 4 mg/mL), gatifloxacin (GAT, 2 mg/mL), and amoxicillinclavulanic acid (AMC, 8/4 mg/mL) were tested. S. aureus ATCC 29213 and E. coli ATCC 25922 were used as quality control in each run. 2.5. Statistical analysis The Chi-square (c2) tests were performed with SPSS 16.0 statistical software (SPSS Inc., Chicago, IL, USA) for Windows and a probability value of less than 5% was considered to be significant.

2.2. DNA extraction and PCR for virulence and mecA genes

3. Results

DNA of each isolate was obtained by boiling method. Briefly, all strains recovered on TSA plate at 37
C overnight. Approximately, 10e20 colonies were obtained with pre-moistened cotton swabs and suspended into 700 ml distilled water. The mixture was boiled at 100
C for 20 min. After centrifugation at 13,000 rmp for 5 min, supernatants were transferred to a new 1.5 mL collection tube. All the DNA templates stored at 40
C until use with PCR amplification. All isolates were screened for virulence and mecA genes by PCR amplification (Hema PCR system 9600, Zhuhai, China). The

3.1. Prevalence of S. aureus Out of 910 samples, 95 (10.4%) samples were positive for S. aureus, including 34 (54.8%) of 62 milking station samples and 61 (7.2%) of 848 milk powder processing plant samples. Among the 61 S. aureus-positive milk powder plant samples, 13 (6.7%; 13/195) samples were from plant A, followed by 12 (5.0%; 12/240) samples from plant B, 30 (12.4%; 30/241) samples from plant C, and 6 (3.5%; 6/172) samples from plant D. In addition, 16 S. aureus-positive samples were found in spray drying areas, followed by 13 samples

646

X. Xing et al. / Food Control 59 (2016) 644e650

Table 1 Oligonucleotide primers used in PCRs. Gene Forward primer sequence (50 e30 )

Reverse primer sequence (50 e30 )

nuc mecA pvl sea seb sec sed see seg seh sei selj selk

GCGATTGATGGTGATACGGTT GTAGAAATGACTGAACGTCCGATAA ATCATTAGGTAAAATGTCTGGACATGATCCA GGTTATCAATGTGCGGGTGG GTATGGTGGTGTAACTGAGC AGATGAAGTAGTTGATGTGTATGG CCAATAATAGGAGAAAATAAAAG AGGTTTTTTCACAGGTCATCC TGCTATCGACACACTACAACC CGAAAGCAGAAGATTTACACG GACAACAAAACTGTCGAAACTG CATCAGAACTGTTGTTCCGCTAG ACCGCTCAAGAGATTGAT

AGCCAAGCCTTGACGAACTAAAGC CCAATTCCACATTGTTTCGGTCTAA GCATCAAGTGTATTGGATAGCAAAAGC CGGCACTTTTTTCTCTTCGG CCAAATAGTGACGAGTTAGG CACACTTTTAGAATCAACCG ATTGGTATTTTTTTTCGTTC CTTTTTTTTCTTCGGTCAATC CCAGATTCAAATGCAGAACC GACCTTTACTTATTTCGCTGTC CCATATTCTTTGCCTTTACCAG CTGAATTTTACCATCAAAGGTAC TTATATCGTTTCTTTATAAGAA

279 310 433 102 164 451 278 209 704 495 630 142 278

sell selm seln ses selo

AATATATAACTAGTGATCTAAAGGG ATGCTGTAGATGTATATGGTCTAAG ATGAGATTGTTCTACATAGCTGCAAT TTCAGAAATAGCCAATCATTTCAA TGTAGTGTAAACAATGCATATGCAAATG

TATGGAATACTACACACCCCTTATA CGTCCTTATAAGATATTTCTACATC AACTCTGCTCCCACTGAAC CCTTTTTGTTGAGAGCCGTC TTATGTAAATAAATAAACATCAATATGATGTC

359 473 680 195 722

selp

TTAGACAAACCTATTATCATAATGG

TATTATCATGTAACGTTACACCGCC

272

selq

AAGAGGTAACTGCTCAAG

TTATTCAGTCTTCTCATATG

285

ser selu selv

AAACCAGATCCAAGGCCTGGAG TCACATTTGTAGTCAGGTGAACTT TAAAATAAATGGCTCTAAAATTGATGG ATCCGCTGAAAAATAGCATTGAT GCAGGATCCGATGTCGGAGTTTTGAATCTTAGG TAACTGCAGTTAGTTACTATCTACATATGATATTTCGACATC

set tst eta

GGTGATTATGTAGATGCTTGGG ACCCCTGTTCCCTTATCATC ATATCAACGTGAGGGCTCTAGTAC

TCGGGTGTTACTTCTGTTTGC TTTTCAGTATTTGTAACGCC ATGCAGTCAGCTTCTTACTGCTA

etb

CACACATTACGGATAATGCAAG

TCAACCGAATAGAGTGAACTTATCT

from tank milk, 4 samples from the prowder-packaging room, 2 samples from the pre-spray drying areas, and 1 sample from final products. Simultaneously, 25 S. aureus-positive samples were obtained from plant environments including 18 samples from ground or wall, followed by 7 samples from workers' hands or shoes (Table 2). 3.2. Virulence and mecA genes As shown in Table 3, 63.2% (60/95) of the isolates harbored one or more virulence genes. Twenty two different virulence gene profiles were detected. The seb (10.5%; 10/95) was the predominant genotype, followed by pvl þ tst (9.5%; 9/95), sec (6.3%; 6/95), sec þ pvl þ tst and pvl (5.3%; 5/95 each), sec þ sed þ pvl þ ser, sec þ ser, sea, and ser (3.2%; 3/95 each). The remaining virulence gene profiles were scattered among thirteen other virulence gene profiles, with one isolates per virulence gene profile. In addition,

Product size (bp)

700 141 720 170 326 1155 604

Reference (Brakstad et al., 1992) (Zhang et al., 2004) (McClure et al., 2006) (Mehrotra, Wang, & Johnson, 2000) (Peles et al., 2007) (Peles et al., 2007) (Peles et al., 2007) (Peles et al., 2007) (Peles et al., 2007) (Peles et al., 2007) (Peles et al., 2007) (Peles et al., 2007) (Yarwood, McCormick, Paustian, Orwin, Kapur, & Schlievert, 2002) (Fueyo, Mendoza, & Martin, 2005) (Fueyo, Mendoza, & Martin, 2005) (Jarraud et al., 2002) (Zhang et al., 2012) (Fueyo, Mendoza, Rodicio, Muniz, Alvarez, & Martin, 2005) (Fueyo, Mendoza, Rodicio, Muniz, Alvarez, & Martin, 2005) (Yarwood, McCormick, Paustian, Orwin, Kapur, & Schlievert, 2002) (Fueyo, Mendoza, & Martin, 2005) (Letertre, Perelle, Dilasser, & Fach, 2003) (Fusco, Quero, Morea, Blaiotta, & Visconti, 2011) (Zhang et al., 2012) (Gunaydin, Aslantas, & Demir, 2011) (Noguchi, Nakaminami, Nishijima, Kurokawa, So, & Sasatsu, 2006) (Noguchi, Nakaminami, Nishijima, Kurokawa, So, & Sasatsu, 2006)

there was only one strain harboring the mecA gene and it was isolated from the spray drying area (fluidized bed). Moreover, as shown in Table 3, the most predominant toxin genes were pvl (29.5%; 28/95), followed by sec (23.2%; 22/95), ser (16.8%; 16/95), tst (14.7%; 14/95), seb (12.6%; 12/95), sed (7.4%; 7/ 95), sea (6.3%; 6/95), selj and selm (3.2%; 3/95 each), and seg (1.1%; 1/ 95). The see, seh, sei, ses, set, selk, sell, seln, selo, selp, selq, selu, selv, eta, and etb genes were not detected in goat milk powder processing. 3.3. PFGE analysis Fig. 1 showed that a total of 95 S. aureus strains were analyzed for genetic relatedness by PFGE with SmaI digestion. Except for 3 isolates (1 ST398-t034 isolate and 2 ST398-t571 isolates) that were not typeable using the enzyme, the remaining 92 isolates were categorized into 43 different PFGE patterns (P). Isolates with

Table 2 The prevalence of S. aureus isolated from four goat milk powder processing plants and a milking station. Sample points

Plant A (%)

Plant B (%)

Plant C (%)

Plant D (%)

Milking station (%)

Tank milk Pre-spray drying areas Spray drying areas Powder-packaging room Ground and wall Workers Final products Raw milk from goat Total

3/15 (20.0) 0/18 (0) 1/50 (2.0) 1/53 (1.9) 6/29 (20.7) 2/13 (15.4) 0/17 (0) e 13/195 (6.7)

2/20 (10.0) 1/44 (2.3) 4/66 (6.1) 3/54 (5.6) 0/33 (0) 2/7 (28.6) 0/16 (0) e 12/240 (5.0)

3/15 (20.0) 1/21 (4.8) 11/72 (15.3) 0/49 (0) 11/62 (17.7 3/5 (60.0) 1/17 (5.9) e 30/241 (12.4)

5/10 (50.0) 0/15 (0) 0/29 (0) 0/61 (0) 1/40 (2.5) e 0/17 (0) e 6/172 (3.5)

e e e e e e e 34/62 (54.8) 34/62 (54.8)

X. Xing et al. / Food Control 59 (2016) 644e650

647

Table 3 Toxin gene profiles in 95 S. aureus isolates from four goat milk powder processing plants and a milking station. Genotype

pvl þ tst pvl þ ser sea þ pvl sea þ selm sea þ sec þ sed þ pvl seb þ pvl seb þ ser sec þ pvl þ ser sec þ pvl þ tst sec þ sed þ pvl sec þ sed þ pvl þ ser sec þ sed þ seg þ selj þ selm þ ser sec þ selj þ ser sec þ ser sed þ ser selj þ ser pvl sea seb sec selm ser Total

No. (%) of isolates from Milk powder plant (n ¼ 61)

Milking station(n ¼ 34)

Total (n ¼ 95)

0 1 1 1 1 1 1 1 0 1 3 1 0 3 1 1 5 3 10 0 0 3 38

9 0 0 0 0 0 0 0 5 0 0 0 1 0 0 0 0 0 0 6 1 0 22

9 1 1 1 1 1 1 1 5 1 3 1 1 3 1 1 5 3 10 6 1 3 60

(0) (1.6) (1.6) (1.6) (1.6) (1.6) (1.6) (1.6) (0) (1.6) (4.9) (1.6) (0) (4.9) (1.6) (1.6) (8.2) (4.9) (16.4) (0) (0) (4.9) (62.3)

identical P13, P22, and P35 were recovered from different sampling points in different plants. Isolates with identical P28 were isolated from same sampling point in the different plants. Moreover, isolates with identical P11, P18, P31, P32, P33 and P34 were recovered from same goat milk powder processing in same plant, and isolates with identical P17, P19, P23, P24, and P26 were isolated from different goat milk powder processing in same plant. Among all patterns, P35 was the predominant group, containing 20 isolates collected from raw goat milk at the milking station and 2 isolates from tank milk at plant D. 3.4. Antimicrobial susceptibility testing Among the 95 S. aureus strains, resistance to trimethoprim/ sulfamethoxazole (89.5%) was the most frequently observed, followed by erythromycin (30.5%), tetracycline (22.1%), ampicillin (16.8%), chloramphenicol (15.8%), and rifampicin (9.5%). All S. aureus isolates were susceptible to ciprofloxacin, amikacin, amoxicillin/clavulanic acid and vancomycin (Table 4). 90.5%(86/95) of the strains were resistant to at least one antibiotic, 32.6% (31/95) to three or more. The dominant multi-drug resistant (resistant to three or more antibiotics) profiles among 25 different drug resistant profiles were as follows: ERY þ TET þ SXT (6.3%, 6/95) and ERY þ CHL þ SXT (4.2%, 4/95) (Fig. 1). 4. Discussion In the present study, 1.5% (1/67) of final products was positive for S. aureus. It was significantly lower (P ¼ 0.016 < 0.05) than that in our previous reports (Wang et al., 2012) showed that the contamination rate of S. aureus in retail infant formula was 11.2% (16/143). In addition, the contamination rate of S. aureus in final products (1.5%, 1/67) was not significantly different (P ¼ 0.06 > 0.05) from that in goat milk powder processing plant environments (7.7%, 60/781) in this study. In contrast, a higher contamination rate of S. aureus was found in raw goat milk, tank milk, and workers' samples than that in other processing sites. This was confirmed in previous reports (Bianchi et al., 2014; Intrakamhaeng, Komutarin, Pimpukdee, & Aengwanich, 2012; Kousta, Mataragas, Skandamis, & Drosinos, 2010; Lyra et al., 2013;

(26.5) (0) (0) (0) (0) (0) (0) (0) (14.7) (0) (0) (0) (2.9) (0) (0) (0) (0) (0) (0) (17.6) (2.9) (0) (64.7)

(9.5) (1.1) (1.1) (1.1) (1.1) (1.1) (1.1) (1.1) (5.3) (1.1) (3.2) (1.1) (1.1) (3.2) (1.1) (1.1) (5.3) (3.2) (10.5) (6.3) (1.1) (3.2) (63.2)

Schlegelova et al., 2010; Spanu et al., 2013). Our results indicated that S. aureus was common in different goat milk powder processing plants. Further research is on going to explore the method of controlling S. aureus disseminating into final products. In this study, the S. aureus isolates from raw milk and processing plants carried different virulence genes. Pvl, tst and sec were frequently detected in the isolates from raw goat milk, while ser, seb, pvl, and sec were frequently found in the isolates from processing plants. The sec gene is often reported as the most frequent enterotoxin gene in S. aureus from goat milk (Chu, Yu, Lee, & Su, 2012; Lyra et al., 2013; Spanu et al., 2013). It was confirmed in this study. Numerous foodborne outbreaks caused by S. aureus enterotoxin C have been reported previously in dairy products (Valihrach, Alibayov, Zdenkova, & Demnerova, 2014). Their potential introduction into the dairy supply chain may represent a serious threat to human health. The tst and sec genes of S. aureus from goat and ovine milk are usually detected together (Lyra et al., 2013; Rosengren, Fabricius, Guss, Sylven, & Lindqvist, 2010; Spanu et al., 2013), which was in agreement with our study, suggesting that these genes may exist together. Pvl is associated with human infections (Chen, Hiramatsu, Huang, Wang, & Lauderdale, 2009) and goat mastitis (Unal et al., 2012). In this study, pvl was commonly found in these S. aureus isolates. This agreed with Unal et al. (2012) who reported that 66.6% of S. aureus strains from goat milk samples contained pvl. In contrast, no pvl-positive S. aureus strain was found from goat milk samples in Brazil (Aires-de-Sousa et al., 2007). Moreover, mecA-positive S. aureus causes hospitaland community-associated infection, and is a growing concern as it is resistant to a wide range of antimicrobials (Enright et al., 2002). In our study, we found MRSA strains in a fluidized bed sample. These results indicated that the mecA-positive S. aureus transmission may occur between food and processing environments. Furthermore, ser gene was the most frequent novel enterotoxin gene detected in the isolates from processing plants in this study, which agreed with Bianchi et al. (2014) who showed that 28% (134/481) of the isolates from milk and dairy products harbored ser gene. It is suggested that attention should not only be paid to classical exterotoxins, but also to novel ones since more and more foodborne outbreaks were associated with novel exterotoxins.

Fig. 1. Dendrogram of PFGE patterns of S. aureus isolated from four goat milk powder processing plants and a milking station. A: milk powder plant A; B: milk powder plant B; C: milk powder plant C; D: milk powder plant D; E: the milking station. ERY: Erythromycin; OXA: oxacillin; FOX: cefoxitin; CFP: cefoperazone; VAN: vancomycin; TET: tetracycline; CHL: chloramphenicol; SXT: trimethoprim/sulfamethoxazole; CIP: ciprofloxacin; AMK: amikacin; AMP: ampicillin; RIF: rifampicin; GAT: gatifloxacin; and AMC: amoxicillinclavulanic acid.

X. Xing et al. / Food Control 59 (2016) 644e650

649

Table 4 Antibiotic resistances among 95 S. aureus strains isolated from four goat milk powder processing plants and a milking station. Antimicrobial agent

Erythromycin Oxacillin Cefoxitin Cefoperazone Vancomycin Tetracycline Chloramphenicol Trimethoprim/sulfamethoxazole Ciprofloxacin Amikacin Amoxicillin/clavulanic acid Ampicillin Rifampicin Gatifloxacin

Resistance break point (mg/mL)

8 4 8 64 32 16 32 8/152 4 32 8/4 32 4 2

Because of the excessive use of antibiotics, the prevalence of drug resistant bacteria is increasing. In this study, more than 90% of isolates were resistant to at least one antibiotic, which was higher than other reports showed that 50% of the isolates from dairy animals in Ireland were resistant (Murphy, O'Mahony, Buckley, O'Brien, & Fanning, 2010), and 56% of the isolates from half-udder milk samples collected from goats with subclinical mastitis showed phenotypic resistance (Virdis et al., 2010). Unal et al. (2012) reported that all strains isolated from raw goat milk were sensitive to trimethoprim/sulphamethoxazole and cefoxitin. In contrast, resistance to trimethoprim/sulfamethoxazole (89.5%) was the most frequently observed, and five isolates were resistant to cefoxitin in this study. Goat milk powder is mostly being used as a raw material for infant formula. It suggests that these drug resistant S. aureus from goat milk powder processing plants may constitute a potential risk to infant health. From the PFGE analysis, a part of same isolates with the PFGE patterns (P13, P17, P19, P22, P23, P24, P26, and P35) came from different goat milk powder processing stages. This suggests that cross-contamination of S. aureus exists in different goat milk powder processing stages. So S. aureus can contaminate goat milk powder through ingredients, production, processing environments, equipment, and workers. That is, workers can carry the bacterial strains on their skin and clothes when they come in contact with the devices. In addition, S. aureus may not be completely inactivated by sterilization, as some S. aureus can recover activity during the next processing or shelf life (Wang et al., 2012), which may become a threat to consumers. Importantly, three non-typable S. aureus isolates by standard SmaI PFGE were confirmed as S. aureus ST398 by multilocus sequence typing (MLST). Since human infections caused by ST398 strains have been described (David et al., 2013; Mediavilla et al., 2012; Valentin-Domelier et al., 2011), this also proved the potential of the ST398 strain to invade humans. In conclusion, our work indicates that S. aureus has spread among different goat milk powder-producing plants in Shaanxi Province, China, and many S. aureus isolates are resistant to different antibiotics and carry various enterotoxin genes. In addition, PFGE indicates that cross-contamination of S. aureus exists in goat milk powder processing stages. To reduce the risk of S. aureus contamination, good hygiene practices are necessary from processing to storage. Acknowledgment This research was supported in part by the National Natural Science Foundation of China (No. 31271858) and Key Projects in the

No. (%) of resistant isolates from Milking station(n ¼ 34)

Milk powder plant (n ¼ 61)

Total(n ¼ 95)

2 4 1 0 0 1 0 34 0 0 0 0 0 0

27 4 4 2 0 20 15 51 0 0 0 16 9 1

29(30.5) 8(8.4) 5(5.3) 2(2.1) 0(0) 21(22.1) 15(15.8) 85(89.5) 0 (0) 0 (0) 0 (0) 16(16.8) 9(9.5) 1(1.1)

(5.9) (11.8) (2.9) (0) (0) (2.9) (0) (100) (0) (0) (0) (0) (0) (0)

(44.3) (6.6) (6.6) (3.3) (0) (32.8) (24.6) (83.6) (0) (0) (0) (26.2) (14.8) (1.6)

National Science & Technology Pillar Program during the Twelfth Five-year Plan Period (No. 2012BAK01B02). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.foodcont.2015.06.042. References Aires-de-Sousa, M., Parente, C. E., Vieira-da-Motta, O., Bonna, I. C., Silva, D. A., & De Lencastre, H. (2007). Characterization of Staphylococcus aureus isolates from buffalo, bovine, ovine, and caprine milk samples collected in Rio de Janeiro State, Brazil. Applied and Environmental Microbiology, 73, 3845e3849. Almeida, G., Magalhaes, R., Carneiro, L., Santos, I., Silva, J., Ferreira, V., et al. (2013). Foci of contamination of Listeria monocytogenes in different cheese processing plants. International Journal of Food Microbiology, 167, 303e309. Argudin, M. A., Mendoza, M. C., & Rodicio, M. R. (2010). Food poisoning and Staphylococcus aureus enterotoxins. Toxins (Basel), 2, 1751e1773. Barancelli, G. V., Camargo, T. M., Gagliardi, N. G., Porto, E., Souza, R. A., Campioni, F., et al. (2014). Pulsed-Field gel electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in Sao Paulo, Brazil. International Journal of Food Microbiology, 173, 21e29. Bianchi, D. M., Gallina, S., Bellio, A., Chiesa, F., Civera, T., & Decastelli, L. (2014). Enterotoxin gene profiles of Staphylococcus aureus isolated from milk and dairy products in Italy. Letters in Applied Microbiology, 58, 190e196. Brakstad, O. G., Aasbakk, K., & Maeland, J. A. (1992). Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. Journal of Clinical Microbiology, 30, 1654e1660. Cagri-Mehmetoglu, A., Yaldirak, G., Bodur, T., Simsek, M., Bozkir, H., & Eren, N. M. (2011). Incidence of Listeria monocytogenes and Escherichia coli O157:H7 in two Kasar Cheese processing environments. Food Control, 22, 762e766. Chen, F. J., Hiramatsu, K., Huang, I. W., Wang, C. H., & Lauderdale, T. L. (2009). Panton-Valentine leukocidin (PVL)-positive methicillin-susceptible and resistant Staphylococcus aureus in Taiwan: identification of oxacillin-susceptible mecA-positive methicillin-resistant S. aureus. Diagnostic Microbiology and Infectious Disease, 65, 351e357. Chu, C., Yu, C., Lee, Y., & Su, Y. (2012). Genetically divergent methicillin-resistant Staphylococcus aureus and sec-dependent mastitis of dairy goats in Taiwan. BMC Veterinary Research, 8, 39. CLSI. (2012). Performance standards for antimicrobial susceptibility testing 2012, twenty-second informational supplement. Pennsylvania, USA: Clinical and Laboratory Standards Institute (CLSI). document M100eS22. David, M. Z., Siegel, J., Lowy, F. D., Zychowski, D., Taylor, A., Lee, C. J., et al. (2013). Asymptomatic carriage of sequence type 398, spa type t571 methicillinsusceptible Staphylococcus aureus in an urban jail: a newly emerging, transmissible pathogenic strain. Journal of Clinical Microbiology, 51, 2443e2447. Enright, M. C., Robinson, D. A., Randle, G., Feil, E. J., Grundmann, H., & Spratt, B. G. (2002). The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proceedings of the National Academy of Sciences of the United States of America, 99, 7687e7692. Fusco, V., & Quero, G. M. (2014). Culture-dependent and culture-independent nucleic-acid-based methods used in the microbial safety assessment of milk and dairy products. Comprehensive Reviews in Food Science and Food Safety, 13, 493e537. Intrakamhaeng, M., Komutarin, T., Pimpukdee, K., & Aengwanich, W. (2012). Incidence of enterotoxin-producing MRSA in bovine mastitis cases, bulk milk tanks

650

X. Xing et al. / Food Control 59 (2016) 644e650

and processing plants in Thailand. Journal of Animal and Veterinary Advvances, 11, 87e93. Jorgensen, H. J., Mork, T., Hogasen, H. R., & Rorvik, L. M. (2005). Enterotoxigenic Staphylococcus aureus in bulk milk in Norway. Journal of Applied Microbiology, 99, 158e166. Kousta, M., Mataragas, M., Skandamis, P., & Drosinos, E. H. (2010). Prevalence and sources of cheese contamination with pathogens at farm and processing levels. Food Control, 21, 805e815. Lim, S. K., Nam, H. M., Jang, G. C., Lee, H. S., Jung, S. C., & Kim, T. S. (2013). Transmission and persistence of methicillin-resistant Staphylococcus aureus in milk, environment, and workers in dairy cattle farms. Foodborne Pathogens and Disease, 10, 731e736. Lyra, D. G., Sousa, F. G., Borges, M. F., Givisiez, P. E., Queiroga, R. C., Souza, E. L., et al. (2013). Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk. Foodborne Pathogens and Disease, 10, 126e130. McDougal, L. K., Steward, C. D., Killgore, G. E., Chaitram, J. M., McAllister, S. K., & Tenover, F. C. (2003). Pulsed-field gel electrophoresis typing of oxacillinresistant Staphylococcus aureus isolates from the United States: establishing a national database. Journal of Clinical Microbiology, 41, 5113e5120. Mediavilla, J. R., Chen, L., Uhlemann, A. C., Hanson, B. M., Rosenthal, M., Stanak, K., et al. (2012). Methicillin-susceptible Staphylococcus aureus ST398, New York and New Jersey, USA. Emerging Infectious Diseases, 18, 700e702. Murphy, B. P., O'Mahony, E., Buckley, J. F., O'Brien, S., & Fanning, S. (2010). Characterization of Staphylococcus aureus isolated from dairy animals in Ireland. Zoonoses and Public Health, 57, 249e257. Rosengren, A., Fabricius, A., Guss, B., Sylven, S., & Lindqvist, R. (2010). Occurrence of foodborne pathogens and characterization of Staphylococcus aureus in cheese produced on farm-dairies. International Journal of Food Microbiology, 144, 263e269.

Schlegelova, J., Babak, V., Holasova, M., Konstantinova, L., Necidova, L., Sisak, F., et al. (2010). Microbial contamination after sanitation of food contact surfaces in dairy and meat processing plants. Czech Journal of Food Sciences, 28, 450e461. Spanu, V., Scarano, C., Virdis, S., Melito, S., Spanu, C., & De Santis, E. P. (2013). Population structure of Staphylococcus aureus isolated from bulk tank goat's milk. Foodborne Pathogens and Disease, 10, 310e315. Unal, N., Askar, S., Macun, H. C., Sakarya, F., Altun, B., & Yildirim, M. (2012). Pantonvalentine leukocidin and some exotoxins of Staphylococcus aureus and antimicrobial susceptibility profiles of staphylococci isolated from milks of small ruminants. Tropical Animal Health and Production, 44, 573e579. Valentin-Domelier, A. S., Girard, M., Bertrand, X., Violette, J., Francois, P., Donnio, P. Y., et al. (2011). Methicillin-susceptible ST398 Staphylococcus aureus responsible for bloodstream infections: an emerging human-adapted subclone? Plos One, 6, e28369. Valihrach, L., Alibayov, B., Zdenkova, K., & Demnerova, K. (2014). Expression and production of staphylococcal enterotoxin C is substantially reduced in milk. Food Microbiology, 44, 54e59. Virdis, S., Scarano, C., Cossu, F., Spanu, V., Spanu, C., & De Santis, E. P. (2010). Antibiotic resistance in Staphylococcus aureus and coagulase negative Staphylococci isolated from goats with subclinical mastitis. Veterinary Medicine International, 2010, 517060. Wang, X., Meng, J., Zhang, J., Zhou, T., Zhang, Y., Yang, B., et al. (2012). Characterization of Staphylococcus aureus isolated from powdered infant formula milk and infant rice cereal in China. International Journal of Food Microbiology, 153, 142e147. Yamashita, K., Kanazawa, Y., Ueno, M., Ohta, H., Kitaguchi, M., Kawakami, T., et al. (2003). Significance of the detection of staphylococcal enterotoxin A gene in low fat milk which caused a serious outbreak of food poisoning. Journal of the Food Hygienic Society of Japan, 44, 186e190.